The structural basis for the action of the antibiotics tetracycline, pactamycin, and hygromycin B on the 30S ribosomal subunit

We have used the recently determined atomic structure of the 30S ribosomal subunit to determine the structures of its complexes with the antibiotics tetracycline, pactamycin, and hygromycin B. The antibiotics bind to discrete sites on the 30S subunit in a manner consistent with much but not all biochemical data. For each of these antibiotics, interactions with the 30S subunit suggest a mechanism for its effects on ribosome function.     

Binding sites on laminin receptors as components for antibiotics

Bacteria use the receptor-adhesion-like interaction between laminin and the laminin receptor in the process of infection. We determined that bacteria do not interact with the receptor-binding site on laminin which could be expected for the bacterial laminin receptor. Rather, binding occurs via the laminin-binding site on the 67-kDa laminin receptor, which has a function similar to the one the bacterial laminin receptor possesses. This finding has implications for the effective use of antimicrobial peptides.     

Binding of tRNA alters the chemical accessibility of nucleotides within the large ribosomal RNAs of E. coli ribosomes.

Functionally active 70S ribosomes were chemically modified with dimethylsulfate (DMS) in the presence and absence of bound tRNA. The ribosomal 16S RNA and 23S RNA were extracted, separated and labeled radioactively at their 3'-ends. DMS modification sites within the last 200 nucleotides from the 3'-ends were investigated on sequencing gels, after borohydride reduction and aniline catalyzed strand scission of the isolated RNA's. tRNA binding caused enhanced reactivity at 9 nucleotide positions while three sites showed decreased reactivity in the 16S RNA. The effects of bound tRNA on the modification of 23S RNA were limited. Only one enhancement was observed in the presence of bound tRNA. mRNA binding alone showed two more sites with enhanced reactivity, however. The results are consistent with the view that the sequence 1400-1500 of the 16S RNA plays an important functional role in the translating ribosome and possibly constitutes part of the tRNA binding site.     

Binding sites of E. coli and B. stearothermophilus ribosomal proteins on B stearothermophilus 5S RNA.

The primary binding sites for Bacillus stearothermophilus proteins B-L5 and B-L22 and the Escherichia coli proteins E-L5, E-L18 and E-L25 on B. stearothermophilus 5S RNA were determined by limited ribonuclease digestion of the corresponding 5S RNA-protein complexes. The results obtained in this study are in agreement with our previous experiments in which the binding sites of E. coli and B. stearothermophilus proteins were determined for E. coli 5S RNA and lead to the conclusion that the proteins interact with the most conserved regions of 5S RNA. A comparison of the results obtained in this study with those of other published experiments suggest that the proposed interaction of nucleotides 16-21 with those of 58-63 is facilitated by protein binding to 5S RNA.     

Lead-catalysed specific cleavage of ribosomal RNAs.

Ribosomes have long been known to require divalent metal ions for their functional integrity. Pb2+-induced cleavage of the sugar-phosphate backbone has now been used to probe for metal binding sites in rRNA. Only three prominent Pb2+cleavages have been detected, with cleavage sites 5' of G240 in 16S rRNA and two sites 5' of A505 and C2347 in 23S rRNA. All cleavages occur in non-paired regions of the secondary structure models of the rRNAs and can be competed for by high concentrations of Mg2+, Mn2+, Ca2+ and Zn2+ ions, suggesting that lead is bound to general metal binding sites. Although Pb2+ cleavage is very efficient, ribosomes with fragmented RNAs are still functional in binding tRNA and in peptidyl transferase activity, indicating that the scissions do not significantly alter ribosomal structure. One of the lead cleavage sites (C2347 in 23S RNA) occurs in the vicinity of a region which is implicated in tRNA binding and peptidyl transferase activity. These results are discussed in the light of a recent model which proposes that peptide bond formation might be a metal-catalysed process.     

Generalized structures of the 5S ribosomal RNAs.

The sequences of 5S ribosomal RNAs from a wide-range of organisms have been compared. All sequences fit a generalized 5S RNA secondary structural model. Twenty-three nucleotide positions are found universally, i.e., in 5S RNAs of eukaryotes, prokaryotes, archaebacteria, chloroplasts and mitochondria. One major distinguishing feature between the prokaryotic and eukaryotic 5S RNAs is the number of nucleotide positions between certain universal positions, e.g., prokaryotic 5S RNAs have three positions between the universal positions PuU40 and G44 (using the E. coli numbering system) and eukaryotic 5S RNAs have two. The archaebacterial 5S RNAs appear to resemble the eukaryotic 5S RNAs to varying degrees depending on the species of archaebacteria although all the RNAs conform with the prokaryotic "rule" of chain length between PuU40 and G44. The green plant chloroplast and wheat mitochondrial 5S RNAs appear prokaryotic-like when comparing the number of positions between universal nucleotides. Nucleotide positions common to eukaryotic 5S RNAs have been mapped; in addition, nucleotide sequences, helix lengths and looped-out residues specific to phyla are proposed. Several of the common nucleotides found in the 5S RNAs of metazoan somatic tissue differ in the 5S RNAs of oocytes. These changes may indicate an important functional role of the 5S RNA during oocyte maturation.     

Two thraustochytrid 5S ribosomal RNAs.

The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs.     

Binding sites for ribosomal proteins S8 and S15 in the 16 S RNA of Escherichia coli.

A fragment of the 16 S ribosomal RNA of Escherichia coli that contains the binding sites for proteins S8 and S15 of the 30 S ribosomal subunit has been isolated and characterized. The RNA fragment, which sediments as 5 S, was partially protected from pancreatic RNAase digestion when S15 alone, or S8 and S15 together, were bound to the 16 S RNA. Purified 5 S RNA was shown to reassociate specifically with protein S15 by analysis of binding stoichiometry. Although interaction between the fragment and protein S8 alone could not be detected, the 5 S RNA selectively bound both S8 and S15 when incubated with an unfractionated mixture of 30-S subunit proteins. Nucleotide sequence analysis demonstrated that the 5 S RNA arises from the middle of the 16 S RNA molecule and encompasses approximately 150 residues from Sections C, C'1 and C'2. Section C consists of a long hairpin loop with an extensively hydrogen-bonded stem and is contiguous with Section C'1. Sections C'1 and C'2, although not contiguous, are highly complementary and it is likely that together they comprise the base-paired stem of an adjacent loop.     

Binding sites of rat liver 5S RNA to ribosomal protein L5

The ribonucleoprotein complex consisting of 5S RNA and the protein L5 was prepared from the large subunit of rat liver ribosomes. The RNA in the complex was digested in situ with RNase A or RNase T1. The RNase-resistant RNA fragments bound to the protein were recovered and purified by 2D-PAGE, and their nucleotide sequences were determined in order to elucidate the binding sites of the RNA to the protein. The results showed that the fragments had arisen from the 5'-end region (residues 1-21), from the second hairpin loop (residues 77-102) and from the 3'-end region (residues 106-120). Harsher digestion trimmed these fragments to shorter fragments. It was concluded that the minimal interactive sequences of 5S RNA to the protein L5 were residues 13-21, residues 85-102, and residues 106-114. A part of the first hairpin loop, residues 41-52, was also suspected to interact with the protein. These protein-binding sites of rat liver 5S RNA were compared with those of Escherichia coli, Halobacterium cutirubrum and yeast, and their probable conservation from eubacteria to eukaryotes is discussed.     

Interactions of ribosomal protein L1 with ribosomal and messenger RNAs

Crystal structures of unbound protein L1 and of its complexes with ribosomal an messenger RNAs are analyzed. It is shown that the values of the apparent association rate constant for L1-RNA depend on conformation of unbound protein L1. It is suggested that L1 binds to rRNA with higher affinity than to mRNA because of additional interactions between domain II of L1 and the loop rRNA region, which is absent in mRNA.     

Inhibition of ribosomal translocation by aminoglycoside antibiotics.

The translocation of AcPhe-tRNA in a purified system and that of peptidyl-tRNA in a crude, complete polypeptide synthesizing system containing endogenous $\text{E. coli}$ polysomes are inhibited by antibiotics of the neomycin, kanamycin and gentamicin groups. The extent of inhibition varies with the different antibiotics, but it correlates well with the capacity of each antibiotic to inhibit polypeptide chain elongation. Thus, the inhibition of translocation by these antibiotics is clearly significant for their inhibitory effect on polypeptide synthesis.     

Interactions of ribosomal protein L1 with ribosomal and messenger RNAs

The crystal structures of unbound protein L1 and its complexes with ribosomal and messenger RNAs were analyzed. The apparent association rate constants for L1-RNA complexes proved to depend on the conformation of unbound L1. It was suggested that L1 binds to rRNA with a higher affinity than to mRNA, owing to additional interactions between domain II of L1 and the loop rRNA region, which is absent in mRNA. Published in Russian in Molekulyarnaya Biologiya, 2006, Vol. 40, No. 4, pp. 650–657. The article was translated by the authors.     

Complementarity of sequences in low molecular weight RNAs to regions of messenger and ribosomal RNAs.

Total low molecular weight nuclear RNAs of mouse ascites cells have been labeled in vitro and used as probes to search for complementary sequences contained in nuclear or cytoplasmic RNA. From a subset of hybridizing lmw RNAs, two major species of 58,000 and 35,000 mol. wt. have been identified as mouse 5 and 5.8S ribosomal RNA. Mouse 5 and 5.8S rRNA hybridize not only to 18 and 28S rRNA, respectively, but also to nuclear and cytoplasmic poly(A+) RNA. Northern blot analysis and oligo-dT cellulose chromatography have confirmed the intermolecular base-pairing of these two small rRNA sequences to total poly(A+) RNA as well as to purified rabbit globin mRNA. 5 and 5.8S rRNA also hybridize with positive (coding) but not negative (noncoding) strands of viral RNA. Temperature melting experiments have demonstrated that their hybrid stability with mRNA sequences is comparable to that observed for the 5S:18S and 5.8S:28S hybrids. The functional significance of 5 and 5.8S rRNA base-pairing with mRNAs and larger rRNAs is unknown, but these interactions could play important coordinating roles in ribosome structure, subunit interaction, and mRNA binding during translation.     

The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron.

The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are (formula: see text), respectively. Specific phylogenetic relationships of P. denitrificans with purple non-sulphur bacteria, and of Prochloron with cyanobacteria are demonstrated, and unique features of potential secondary structure are described.     

Paclitaxel-HSA interaction. Binding sites on HSA molecule

Paclitaxel (trade name Taxol) is one of the world's most effective anticancer drugs. It is used to treat several cancers including tumours of the breast, ovary and lung. In the present work the interaction of paclitaxel with human serum albumin (HSA) in aqueous solution at physiological pH has been investigated through CD, fluorescence spectroscopy and by the antibody precipitate test. Binding of paclitaxel to albumin impact on protein structure and it influences considerably albumin binding of other molecules like warfarin, heme or bilirubin. The paclitaxel-HSA interaction causes the conformational changes with the loss of helical stability of protein and local perturbation in the domain IIA binding pocket. The relative fluorescence intensity of the paclitaxel-bound HSA decreased, suggesting that perturbation around the Trp 214 residue took place. This was confirmed by the destabilization of the warfarin binding site, which includes Trp 214, and high affinity bilirubin binding site located in subdomain IIA.