共查询到20条相似文献,搜索用时 15 毫秒
1.
《Journal of enzyme inhibition and medicinal chemistry》2013,28(4):661-670
Cruzain is the major cysteine protease of Trypanosoma cruzi, the infectious agent responsible for Chagas disease, and cruzain inhibitors display considerable antitrypanosomal activity. In the present work we elucidated crystallographic data of fukugetin, a biflavone isolated from Garcinia brasiliensis, and investigated the role of this molecule as cysteine protease inhibitor. The kinetic analyses demonstrated that fukugetin inhibited cruzain and papain by a slow reversible type inhibition with KI of 1.1 and 13.4 µM, respectively. However, cruzain inhibition was about 12 times faster than papain inhibition. Lineweaver–Burk plots demonstrated partial competitive inhibition for cruzain and hyperbolic mixed-type inhibition for papain. Furthermore, the docking results showed that the biflavone binds to ring C′ in the S2 pocket and to ring C in the S3 pocket through hydrophobic interactions and hydrogen bonds. Finally, fukugetin also presented inhibitory activity on proteases of the T. cruzi extract, with IC50 of 7 µM. 相似文献
2.
Nelilma C. Romeiro Gabriela Aguirre Paola Hernández Mercedes González Hugo Cerecetto Ignacio Aldana Silvia Pérez-Silanes Antonio Monge Eliezer J. Barreiro Lídia M. Lima 《Bioorganic & medicinal chemistry》2009,17(2):641-652
In this paper, we report the structural design, synthesis, trypanocidal activity and docking studies of novel quinoxaline-N-acylhydrazone (NAH) derivatives, planned as cruzain inhibitors candidates, a cysteine protease essential for the survival of Trypanosoma cruzi within the host cell. The salicylaldehyde N-acylhydrazones 7a and 8a presented IC50 values of the same magnitude order than the standard drug nifurtimox (Nfx), when tested in vitro against epimastigote forms of Trypanosoma cruzi (Tulahuen 2 strain) and were non-toxic at the highest assayed doses rendering selectivity indexes (IC50 (macrophages)/IC50 (Trypanosoma cruzi)) of >25 for 7a and >20 for 8a, with IC50 values in macrophages >400 μM. 相似文献
3.
José Maurício dos Santos Filho Diogo Rodrigo M. Moreira Carlos Alberto de Simone Rafaela Salgado Ferreira James H. McKerrow Cássio Santana Meira Elisalva Teixeira Guimarães Milena Botelho Pereira Soares 《Bioorganic & medicinal chemistry》2012,20(21):6423-6433
We recently showed that oxadiazoles have anti-Trypanosoma cruzi activity at micromolar concentrations. These compounds are easy to synthesize and show a number of clear and interpretable structure–activity relationships (SAR), features that make them attractive to pursue potency enhancement. We present here the structural design, synthesis, and anti-T. cruzi evaluation of new oxadiazoles denoted 5a–h and 6a–h. The design of these compounds was based on a previous model of computational docking of oxadiazoles on the T. cruzi protease cruzain. We tested the ability of these compounds to inhibit catalytic activity of cruzain, but we found no correlation between the enzyme inhibition and the antiparasitic activity of the compounds. However, we found reliable SAR data when we tested these compounds against the whole parasite. While none of these oxadiazoles showed toxicity for mammalian cells, oxadiazoles 6c (fluorine), 6d (chlorine), and 6e (bromine) reduced epimastigote proliferation and were cidal for trypomastigotes of T. cruzi Y strain. Oxadiazoles 6c and 6d have IC50 of 9.5 ± 2.8 and 3.5 ± 1.8 μM for trypomastigotes, while Benznidazole, which is the currently used drug for Chagas disease treatment, showed an IC50 of 11.3 ± 2.8 μM. Compounds 6c and 6d impair trypomastigote development and invasion in macrophages, and also induce ultrastructural alterations in trypomastigotes. Finally, compound 6d given orally at 50 mg/kg substantially reduces the parasitemia in T. cruzi-infected BALB/c mice. Our drug design resulted in potency enhancement of oxadiazoles as anti-Chagas disease agents, and culminated with the identification of oxadiazole 6d, a trypanosomicidal compound in an animal model of infection. 相似文献
4.
Saulo C. Bourguignon Danielle F.B. Cavalcanti Alessandra M.T. de Souza Helena C. Castro Carlos R. Rodrigues Magaly G. Albuquerque Dilvani O. Santos Gabriel Gomes da Silva Fernando C. da Silva Vitor F. Ferreira Rosa T. de Pinho Carlos R. Alves 《Experimental parasitology》2011,(1):160-166
In this study we compared the effects of naphthoquinones (α-lapachone, β-lapachone, nor-β-lapachone and Epoxy-α-lap) on growth of Trypanosoma cruzi epimastigotes forms, and on viability of VERO cells. In addition we also experimentally analyzed the most active compounds inhibitory profile against T. cruzi serine- and cysteine-proteinases activity and theoretically evaluated them against cruzain, the major T. cruzi cysteine proteinase by using a molecular docking approach. Our results confirmed β-lapachone and Epoxy-α-lap with a high trypanocidal activity in contrast to α-lapachone and nor-β-lapachone whereas Epoxy-α-lap presented the safest toxicity profile against VERO cells. Interestingly the evaluation of the active compounds effects against T. cruzi cysteine- and serine-proteinases activities revealed different targets for these molecules. β-Lapachone is able to inhibit the cysteine-proteinase activity of T. cruzi proteic whole extract and of cruzain, similar to E-64, a classical cysteine-proteinase inhibitor. Differently, Epoxy-α-lap inhibited the T. cruzi serine-proteinase activity, similar to PMSF, a classical serine-proteinase inhibitor. In agreement to these biological profiles in the enzymatic assays, our theoretical analysis showed that E-64 and β-lapachone interact with the cruzain specific S2 pocket and active site whereas Epoxy-α-lap showed no important interactions. Overall, our results infer that β-lapachone and Epoxy-α-lap compounds may inhibit T. cruzi epimastigotes growth by affecting T. cruzi different proteinases. Thus the present data shows the potential of these compounds as prototype of protease inhibitors on drug design studies for developing new antichagasic compounds. 相似文献
5.
《Bioorganic & medicinal chemistry》2016,24(18):4228-4240
In this study, we designed and synthesized a series of thiophen-2-iminothiazolidine derivatives from thiophen-2-thioureic with good anti-Trypanosoma cruzi activity. Several of the final compounds displayed remarkable trypanocidal activity. The ability of the new compounds to inhibit the activity of the enzyme cruzain, the major cysteine protease of T. cruzi, was also explored. The compounds 3b, 4b, 8b and 8c were the most active derivatives against amastigote form, with significant IC50 values between 9.7 and 6.03 μM. The 8c derivative showed the highest potency against cruzain (IC50 = 2.4 μM). Molecular docking study showed that this compound can interact with subsites S1 and S2 simultaneously, and the negative values for the theoretical energy binding (Eb = −7.39 kcal·mol−1) indicates interaction (via dipole–dipole) between the hybridized sulfur sp3 atom at the thiazolidine ring and Gly66. Finally, the results suggest that the thiophen-2-iminothiazolidines synthesized are important lead compounds for the continuing battle against Chagas disease. 相似文献
6.
Jos Mauricio dos Santos Filho Ana Cristina Lima Leite Boaz Galdino de Oliveira Diogo Rodrigo Magalhes Moreira Milena S. Lima Milena Botelho Pereira Soares Lucia Fernanda C.C. Leite 《Bioorganic & medicinal chemistry》2009,17(18):6682-6691
Research in recent years has demonstrated that the Trypanosoma cruzi cysteine protease cruzain (TCC) is a valid chemotherapeutic target, since inhibitors of this protease affect the pathology appropriately. By exploring the N-acylhydrazones (NAH) as privileged structures usually present in antiparasitic agents, we investigated a library of 16 NAH bearing the 3-(4-substituted-aryl)-1,2,4-oxadiazole scaffold (NAH 3a–h, 4a–h). The in vitro bioactivity against epimastigote and trypomastigote forms of T. cruzi was evaluated, and some NAH under study exhibited antitrypanosomal activity at concentrations that are not toxic to mammalian cells. The series of compounds based on the 3-(4-substituted-aryl)-1,2,4-oxadiazole scaffold revealed the remarkable importance of each substituent at the phenyl’s 4-position for the inhibitory activity. Non-nitrated compounds 3a and 4e were found to be as potent as the reference drug, Benznidazole. In addition, the molecular origin of the antitrypanosomal properties for these series was investigated using docking studies of the TCC structure. 相似文献
7.
Poonam Piplani Manish Sharma Pakhuri Mehta 《Journal of biomolecular structure & dynamics》2018,36(7):1867-1877
The present paper describes the synthesis, biological evaluation and molecular simulation studies of a series of N-(4-hydroxyphenyl)-3,4,5-trimethoxybenzamide derivatives with N,N-dialkylaminoethoxy/propoxy moiety as potential memory enhancers with acetylcholinesterase-inhibiting activity having IC50 in low micromolar range (4.0–16.5 μM). All the compounds showed a good degree of agreement between in vivo and in vitro results as most of these derivatives showed dose-dependent increase in percent retention. Compound 10a showed significant % retention of 84.73 ± 4.51 as compared to piracetam (46.88 ± 5.42) at 3 mg kg?1 and also exhibited a maximal percent inhibition of 97% at 50 μM. Molecular docking, MM-GBSA and molecular simulation studies were performed establishing a correlation between the experimental biology and in silico results. In silico results indicate that all the compounds have better docking scores and predicted binding free energies as compared to cocrystallized ligand with the best potent ligand retaining conserved hydrophobic interactions with residues of catalytic triad (HIS447), catalytic anionic site (CAS) (TRP86, TYR337, PHE338) and peripheral anionic site (PAS) (TYR72, TYR124, TRP286 and TYR341). Root mean square deviation (RMSD = 2.4 Å) and root mean square fluctuations of 10a–AChE complex during simulation proved its stable nature in binding toward acetylcholinesterase. The docked conformation of 10a and other analogs at the binding site have also been simulated with polar and nonpolar interactions interlining the gorge residues from PAS to catalytic triad. 相似文献
8.
Silvia Melchor-Doncel de la Torre Citlali Vázquez Zabdi González-Chávez Lilián Yépez-Mulia Rocío Nieto-Meneses Ricardo Jasso-Chávez Emma Saavedra Francisco Hernández-Luis 《Bioorganic & medicinal chemistry letters》2017,27(15):3403-3407
Twelve novel benzimidazole derivatives were synthesized and their in vitro activities against epimastigotes of Trypanosoma cruzi were evaluated. Two derivatives (6 and 7), which have 4-hydroxy-3-methoxyphenyl moiety in their structures, proved to be the most active in inhibiting the parasite growth. Compound 6 showed a trypanocidal activity higher than benznidazole (IC50 = 5 µM and 7.5 µM, respectively) and less than nifurtimox (IC50 = 3.6 µM). In addition, the ability of 6 and 7 to modify the redox homeostasis in T cruzi epimastigote was studied; cysteine and glutathione increased in parasites exposed to both compounds, whereas trypanothione only increased with 7 treatment. These results suggest that the decrease in viability of T. cruzi may be attributed to the change in cellular redox balance caused by compound 6 or 7. Furthermore, compounds 6 and 7 showed CC50 values of 160.64 and 160.66 µM when tested in mouse macrophage cell line J774 and selectivity indexes (macrophage/parasite) of 32 and 20.1, respectively. 相似文献
9.
A series of sixteen benzoylthioureas derivatives were initially evaluated in vitro against the epimastigote form of Trypanosoma cruzi. All of the tested compounds inhibited the growth of this form of the parasite, and due to the promising anti-epimastigote activity from three of these compounds, they were also assayed against the trypomastigote and amastigote forms. ADMET-Tox in silico predictions and molecular docking studies with two main enzymatic targets (cruzain and CYP-51) were performed for the three compounds with the highest activity. The docking studies showed that these compounds can interact with the active site of cruzain by hydrogen bonds and can be coordinated with Fe-heme through the carbonyl oxygen atom of the CYP51. These findings can be considered an important starting point for the proposal of the benzoylthioureas as potent, selective, and multi-target antitrypanosomal agents. 相似文献
10.
Cassiano Martin Batista Rafael Luis Kessler Iriane Eger Maurilio José Soares 《BMC cell biology》2018,19(1):19
Background
The palmitate analogue 2-bromopalmitate (2-BP) is a non-selective membrane tethered cysteine alkylator of many membrane-associated enzymes that in the last years emerged as a general inhibitor of protein S-palmitoylation. Palmitoylation is a post-translational protein modification that adds palmitic acid to a cysteine residue through a thioester linkage, promoting membrane localization, protein stability, regulation of enzymatic activity, and the epigenetic regulation of gene expression. Little is known on such important process in the pathogenic protozoan Trypanosoma cruzi, the etiological agent of Chagas disease.Results
The effect of 2-BP was analyzed on different developmental forms of Trypanosoma cruzi. The IC50/48 h value for culture epimastigotes was estimated as 130 μM. The IC50/24 h value for metacyclic trypomastigotes was 216 nM, while for intracellular amastigotes it was 242 μM and for cell derived trypomasigotes was 262 μM (IC50/24 h). Our data showed that 2-BP altered T. cruzi: 1) morphology, as assessed by bright field, scanning and transmission electron microscopy; 2) mitochondrial membrane potential, as shown by flow cytometry after incubation with rhodamine-123; 3) endocytosis, as seen after incubation with transferrin or albumin and analysis by flow cytometry/fluorescence microscopy; 4) in vitro metacyclogenesis; and 5) infectivity, as shown by host cell infection assays. On the other hand, lipid stress by incubation with palmitate did not alter epimastigote growth, metacyclic trypomastigotes viability or trypomastigote infectivity.Conclusion
Our results indicate that 2-BP inhibits key cellular processes of T. cruzi that may be regulated by palmitoylation of vital proteins and suggest a metacyclic trypomastigote unique target dependency during the parasite development.11.
Urmila Saha Asma Yasmeen Khan Sutanwi Bhuiya Suman Das Gaetano Fiorillo Paolo Lombardi 《Journal of biomolecular structure & dynamics》2019,37(6):1375-1389
Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 105 M?1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 105 M?1, and that of BER was (0.98 ± 0.03) × 105 M?1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands. 相似文献
12.
Amanda Santos Gusmão Lucas Silva Abreu Josean Fechine Tavares Humberto Fonseca de Freitas Samuel Silva da Rocha Pita Elda Gonçalves dos Santos Ivo Santana Caldas André Alexandre Vieira Eliane Oliveira Silva 《化学与生物多样性》2021,18(10):e2100493
Hundreds of millions of people worldwide are affected by Chagas’ disease caused by Trypanosoma cruzi. Since the current treatment lack efficacy, specificity, and suffers from several side-effects, novel therapeutics are mandatory. Natural products from endophytic fungi have been useful sources of lead compounds. In this study, three lactones isolated from an endophytic strain culture were in silico evaluated for rational guidance of their bioassay screening. All lactones displayed in vitro activity against T. cruzi epimastigote and trypomastigote forms. Notably, the IC50 values of (+)-phomolactone were lower than benznidazole (0.86 vs. 30.78 μM against epimastigotes and 0.41 vs. 4.88 μM against trypomastigotes). Target-based studies suggested that lactones displayed their trypanocidal activities due to T. cruzi glyceraldehyde-3-phosphate dehydrogenase (TcGAPDH) inhibition, and the binding free energy for all three TcGAPDH-lactone complexes suggested that (+)-phomolactone has a lower score value (−3.38), corroborating with IC50 assays. These results highlight the potential of these lactones for further anti-T. cruzi drug development. 相似文献
13.
Inhibition of leukotriene biosynthesis is considered to be one of the potential treatment strategies for controlling inflammation, respiratory diseases and many neurodegenerative disorders. Designing of specific functional inhibitors against Lipoxygenases (LOX) has got considerable attention due to its ability to block leukotriene biosynthesis. Molecular docking analysis of two indole derivatives such as indoleacetic acid (IAA) and indolebutyric acid (IBA) are reported here. Both compounds give glide scores better than that of protocatechuic acid and nitro catechol, the two known LOX inhibitors. From the enzyme kinetic analysis, it was revealed that IAA and IBA inhibit competitively. The IC50 values determined for both IAA and IBA were 42.98 μM and 17.82 μM, respectively. The binding free energy of these compounds was determined using isothermal titration calorimetric assay and was found to be ? 6.12 kcal/mol for IAA and ? 7.84 kcal/mol for IBA. From the analysis, it can be concluded that both IAA and IBA might be useful as anti-inflammatory agents. 相似文献
14.
Hernandes MZ Rabello MM Leite AC Cardoso MV Moreira DR Brondani DJ Simone CA Reis LC Souza MA Pereira VR Ferreira RS McKerrow JH 《Bioorganic & medicinal chemistry》2010,18(22):7826-7835
In previous studies, we identified promising anti-Trypanosoma cruzi cruzain inhibitors based on thiazolylhydrazones. To optimize this series, a number of medicinal chemistry directions were explored and new thiazolylhydrazones and thiosemicarbazones were thus synthesized. Potent cruzain inhibitors were identified, such as thiazolylhydrazones 3b and 3j, which exhibited IC(50) of 200-400nM. Furthermore, molecular docking studies showed concordance with experimentally derived structure-activity relationships (SAR) data. In the course of this work, lead compounds exhibiting in vitro activity against both the epimastigote and trypomastigote forms of T. cruzi were identified and in vivo general toxicity analysis was subsequently performed. Novel SAR were documented, including the importance of the thiocarbonyl carbon attached to the thiazolyl ring and the direct comparison between thiosemicarbazones and thiazolylhydrazones. 相似文献
15.
《Bioorganic & medicinal chemistry》2020,28(1):115185
Novel isothiocyanate derivatives were synthesized starting from noscapine, bile acids, amino acids, and some aromatic compounds. Antiparasitic activities of the synthesized derivatives were tested against four unicellular protozoa, i.e., Trypanosoma brucei rhodesiense, T. cruzi, Leishmania donovani, and Plasmodium falciparum. Interestingly, seven isothiocyanate analogues displayed promising antiparasitic activity against Leishmania donovani with IC50 values between 0.4 and 1.0 µM and selectivity index (SI) ranged from 7.8 to 18.4, comparable to the standard drug miltefosine (IC50 = 0.7 μM). Compound 7h demonstrated the best antileishmanial activity with an IC50 value of 0.4 µM. Seven products exhibited inhibition activity against T. brucei rhodesiense with IC50s below 2.0 μM and SI between 2.7 and 29.3. Four primary amine derivatives of noscapine and five isothiocyanate derivatives exhibited antiplasmodial activity with IC50s in the range of 1.1–2.7 µM and SI values between 1.1 and 14.5. The isothiocyanate derivative 7c showed against T. cruzi with an IC50 value of 1.9 µM and SI 4. Molecular docking and ADMET studies were performed to investigate the interaction between active ligands and T. brucei trypanothione reductase active site. The docking studies showed significant binding affinity of noscapine derivatives to enzyme active site and good compatibility with experimental data. 相似文献
16.
Yusuf Scak Emine Elin Oru‐Emre Mehmet
ztürk Tuba Takn‐Tok Ayegül Karaküük‐Iyidoan 《Chirality》2019,31(8):603-615
In this study, a series of fluorine‐containing chiral hydrazide‐hydrazone derivatives [III‐XII] from ?‐cysteine ethyl ester hydrochloride was synthesized as new antioxidant and anticholinesterase agents. The antioxidant activity of these derivatives was evaluated by ABTS+· and DPPH· scavenging and CUPRAC assays and the anticholinesterase activity by the Ellman method spectrophotometrically. The results of the antioxidant assay showed that compounds V , IX , and X exhibited higher activity than BHT and α‐tocopherol used as positive standards. Among the synthesized derivatives, compound IX (IC50: 2.3 ± 1.6 μM) exhibited higher acetylcholinesterase inhibitory activity than galantamine (IC50: 4.5 ± 0.8 μM). Compounds XI (IC50: 9.6 ± 1.0 μM), IX (IC50: 12.5 ± 1.6 μM), III (IC50: 16.0 ± 1.6 μM), X (IC50: 17.2 ± 1.8 μM), VI (IC50: 20.2 ± 0.8 μM), XII (IC50: 21.5 ± 1.0 μM), and VII (IC50: 24.6 ± 0.6 μM) displayed better butyrylcholinesterase inhibitory activity than galantamine (IC50: 46.03 ± 0.14 μM). ADME‐Tox analysis was used to probe the drug‐like properties of the compounds. Molecular docking studies were also applied to understand the interactions between compounds and targets. The docking calculations were supported by the experimental data. In particular, compound IX , having better activity than galantamine against acetylcholinesterase and butyrylcholinesterase enzymes, was visualized using molecular docking. 相似文献
17.
Marcelo N. Gomes Laura M. Alcântara Bruno J. Neves Cleber C. Melo-Filho Lucio H. Freitas-Junior Carolina B. Moraes Rui Ma Scott G. Franzblau Eugene Muratov Carolina Horta Andrade 《Bioorganic & medicinal chemistry letters》2017,27(11):2459-2464
Leishmaniasis are infectious diseases caused by parasites of genus Leishmania that affect affects 12 million people in 98 countries mainly in Africa, Asia, and Latin America. Effective treatments for this disease are urgently needed. In this study, we present a computer-aided approach to investigate a set of 32 recently synthesized chalcone and chalcone-like compounds to act as antileishmanial agents. As a result, nine most promising compounds and three potentially inactive compounds were experimentally evaluated against Leishmania infantum amastigotes and mammalian cells. Four compounds exhibited EC50 in the range of 6.2–10.98 μM. In addition, two compounds, LabMol-65 and LabMol-73, exhibited cytotoxicity in macrophages >50 μM that resulted in better selectivity compared to standard drug amphotericin B. These two compounds also demonstrated low cytotoxicity and high selectivity towards Vero cells. The results of target fishing followed by homology modeling and docking studies suggest that these chalcone compounds could act in Leishmania because of their interaction with cysteine proteases, such as procathepsin L. Finally, we have provided structural recommendations for designing new antileishmanial chalcones. 相似文献
18.
Muhammad Taha Hayat Ullah Laode Muhammad Ramadhan Al Muqarrabun Muhammad Naseem Khan Fazal Rahim Norizan Ahmat Muhammad Tariq Javid Muhammad Ali Khalid Mohammed Khan 《Bioorganic & medicinal chemistry》2018,26(1):152-160
Bisindolylmethane thiosemicarbazides 1-18 were synthesized, characterized by 1H NMR and ESI MS and evaluated for urease inhibitory potential. All analogs showed outstanding urease inhibitory potentials with IC50 values ranging between 0.14?±?0.01 to 18.50?±?0.90?μM when compared with the standard inhibitor thiourea having IC50 value 21.25?±?0.90?μM. Among the series, analog 9 (0.14?±?0.01?μM) with di-chloro substitution on phenyl ring was identified as the most potent inhibitor of urease. The structure activity relationship has been also established on the basis of binding interactions of the active analogs. These binding interactions were identified by molecular docking studies. 相似文献
19.
Guangcheng Wang Ming Chen Jie Qiu Zhenzhen Xie Anbai Cao 《Bioorganic & medicinal chemistry letters》2018,28(2):113-116
A novel series of chromone-isatin derivatives 6a–6p were designed, synthesized and characterized by 1H NMR, 13C NMR and HRMS. These novel synthetic compounds were evaluated for inhibitory activity against yeast α-glucosidase enzyme. The results of biological test have shown that all tested compounds exhibited excellent to potent inhibitory activity in the range of IC50?=?3.18?±?0.12–16.59?±?0.17?μM as compared to the standard drug acarbose (IC50?=?817.38?±?6.27?μM). Compound 6j (IC50?=?3.18?±?0.12?μM) with a hydroxyl group at the 7-position of chromone and a 4-bromobenzyl group at the N1-positions of isatin, was found to be the most active compound among the series. Furthermore, molecular docking study was performed to help understand binding interactions of the most active analogs with α-glucosidase enzyme. These results indicated that this class of compounds had potential for the development of anti-diabetic agents. 相似文献
20.
César?Echeverría Valentina?Romero Rodrigo?Arancibia Hugo?Klahn Ignacio?Montorfano Ricardo?Armisen Vincenzo?Borgna Felipe?Simon Rodrigo?Ramirez-Tagle
Trypanosoma cruzi (T. cruzi) is the parasite that causes Chagas disease. Nifurtimox is the most used drug against the T. cruzi, this drug increases intermediaries nitro group, being mainly responsible for the high toxicity component, for this reason it is important to study new organic compounds and thus improve therapeutic strategies against Chagas disease. The electronic effects of ferrocenyl and cyrhetrenyl fragments were investigated by DFT calculation. A close correlation was found between HOMO–LUMO gap of nitro radical NO 2 ? with the experimental reduction potential found for nitro group and IC50 of two forms the T. cruzi (epimastigote and trypomastigote). The IC50 on human hepatoma cells is higher for both compounds compared to IC50 demonstrated in the two forms the T. cruzi, and additionally show reactive oxygen species release. The information obtained in this paper could generate two new drugs with anti-T. cruzi activity, but additional studies are needed. 相似文献