Stem-loop structures can effectively substitute for an RNA pseudoknot in -1 ribosomal frameshifting

-1 Programmed ribosomal frameshifting (PRF) in synthesizing the gag-pro precursor polyprotein of Simian retrovirus type-1 (SRV-1) is stimulated by a classical H-type pseudoknot which forms an extended triple helix involving base-base and base-sugar interactions between loop and stem nucleotides. Recently, we showed that mutation of bases involved in triple helix formation affected frameshifting, again emphasizing the role of the triple helix in -1 PRF. Here, we investigated the efficiency of hairpins of similar base pair composition as the SRV-1 gag-pro pseudoknot. Although not capable of triple helix formation they proved worthy stimulators of frameshifting. Subsequent investigation of ～30 different hairpin constructs revealed that next to thermodynamic stability, loop size and composition and stem irregularities can influence frameshifting. Interestingly, hairpins carrying the stable GAAA tetraloop were significantly less shifty than other hairpins, including those with a UUCG motif. The data are discussed in relation to natural shifty hairpins.     

Characterization of an efficient coronavirus ribosomal frameshifting signal: requirement for an RNA pseudoknot

The genomic RNA of the coronavirus IBV contains an efficient ribosomal frameshifting signal at the junction of two overlapping open reading frames. We have defined by deletion analysis an 86 nucleotide sequence encompassing the overlap region which is sufficient to allow frameshifting in a heterologous context. The upstream boundary of the signal consists of the sequence UUUAAAC, which is the likely site of ribosomal slippage. We show by creation of complementary nucleotide changes that the RNA downstream of this "slippery" sequence folds into a tertiary structure termed a pseudoknot, the formation of which is essential for efficient frameshifting.     

The role of RNA pseudoknot stem 1 length in the promotion of efficient -1 ribosomal frameshifting.

The ribosomal frameshifting signal present in the genomic RNA of the coronavirus infectious bronchitis virus (IBV) contains a classic hairpin-type RNA pseudoknot that is believed to possess coaxially stacked stems of 11 bp (stem 1) and 6 bp (stem 2). We investigated the influence of stem 1 length on the frameshift process by measuring the frameshift efficiency in vitro of a series of IBV-based pseudoknots whose stem 1 length was varied from 4 to 13 bp in single base-pair increments. Efficient frameshifting depended upon the presence of a minimum of 11 bp; pseudoknots with a shorter stem 1 were either non-functional or had reduced frameshift efficiency, despite the fact that a number of them had a stem 1 with a predicted stability equal to or greater than that of the wild-type IBV pseudoknot. An upper limit for stem 1 length was not determined, but pseudoknots containing a 12 or 13 bp stem 1 were fully functional. Structure probing analysis was carried out on RNAs containing either a ten or 11 bp stem 1; these experiments confirmed that both RNAs formed pseudoknots and appeared to be indistinguishable in conformation. Thus the difference in frameshifting efficiency seen with the two structures was not simply due to an inability of the 10 bp stem 1 construct to fold into a pseudoknot. In an attempt to identify other parameters which could account for the poor functionality of the shorter stem 1-containing pseudoknots, we investigated, in the context of the 10 bp stem 1 construct, the influence on frameshifting of altering the slippery sequence-pseudoknot spacing distance, loop 2 length, and the number of G residues at the bottom of the 5'-arm of stem 1. For each parameter, it was possible to find a condition where a modest stimulation of frameshifting was observable (about twofold, from seven to a maximal 17 %), but we were unable to find a situation where frameshifting approached the levels seen with 11 bp stem 1 constructs (48-57 %). Furthermore, in the next smaller construct (9 bp stem 1), changing the bottom four base-pairs to G.C (the optimal base composition) only stimulated frameshifting from 3 to 6 %, an efficiency about tenfold lower than seen with the 11 bp construct. Thus stem 1 length is a major factor in determining the functionality of this class of pseudoknot and this has implications for models of the frameshift process.     

Equilibrium unfolding pathway of an H-type RNA pseudoknot which promotes programmed -1 ribosomal frameshifting.

The equilibrium unfolding pathway of a 41-nucleotide frameshifting RNA pseudoknot from the gag-pro junction of mouse intracisternal A-type particles (mIAP), an endogenous retrovirus, has been determined through analysis of dual optical wavelength, equilibrium thermal melting profiles and differential scanning calorimetry. The mIAP pseudoknot is an H-type pseudoknot proposed to have structural features in common with the gag-pro frameshifting pseudoknots from simian retrovirus-1 (SRV-1) and mouse mammary tumor virus (MMTV). In particular, the mIAP pseudoknot is proposed to contain an unpaired adenosine base at the junction of the two helical stems (A15), as well as one in the middle of stem 2 (A35). A mutational analysis of stem 1 hairpins and compensatory base-pair substitutions incorporated into helical stem 2 was used to assign optical melting transitions to molecular unfolding events. The optical melting profile of the wild-type RNA is most simply described by four sequential two-state unfolding transitions. Stem 2 melts first in two closely coupled low-enthalpy transitions at low tmin which the stem 3' to A35, unfolds first, followed by unfolding of the remainder of the helical stem. The third unfolding transition is associated with some type of stacking interactions in the stem 1 hairpin loop not present in the pseudoknot. The fourth transition is assigned to unfolding of stem 1. In all RNAs investigated, DeltaHvH approximately DeltaHcal, suggesting that DeltaCpfor unfolding is small. A35 has the thermodynamic properties expected for an extrahelical, unpaired nucleotide. Deletion of A15 destabilizes the stem 2 unfolding transition in the context of both the wild-type and DeltaA35 mutant RNAs only slightly, by DeltaDeltaG degrees approximately 1 kcal mol-1(at 37 degrees C). The DeltaA15 RNA is considerably more susceptible to thermal denaturation in the presence of moderate urea concentrations than is the wild-type RNA, further evidence of a detectable global destabilization of the molecule. Interestingly, substitution of the nine loop 2 nucleotides with uridine residues induces a more pronounced destabilization of the molecule (DeltaDeltaG degrees approximately 2.0 kcal mol-1), a long-range, non-nearest neighbor effect. These findings provide the thermodynamic basis with which to further refine the relationship between efficient ribosomal frameshifting and pseudoknot structure and stability.     

Mutational analysis of the RNA pseudoknot involved in efficient ribosomal frameshifting in simian retrovirus-1.

Mutational effects on frameshifting efficiency of the RNA pseudoknot involved in ribosomal frameshifting in simian retrovirus-1 (SRV-1) have been investigated. The primary sequence and the proposed secondary structure of the SRV-1 pseudoknot are similar to those of other efficient frameshifting pseudoknots in mouse mammary tumor virus (MMTV) and feline immunodeficiency virus (FIV), where an unpaired adenine nucleotide intercalates between stem 1 and stem 2. In SRV-1 pseudoknot, the adenine nucleotide in between stem 1 and stem 2 has a potential to form an A*U base pair with the last uridine nucleotide in the loop 2, resulting in a continuous A-form helix with coaxially stacked stem 1 and stem 2. To test whether this A*U base pairing and coaxial stacking of stem 1 and stem 2 is absolutely required for efficient frameshifting in SRV-1, a series of mutants changing this potential A.U base pair to either G.C base pair or A.A, A.G, A.C, G.A, G.G mismatch is generated, and their frameshifting efficiencies are investigated in vitro using rabbit reticulocyte lysate translation assay. The frameshifting abilities of these mutant pseudoknots are similar to that of the wild-type pseudoknot, suggesting that the A*U base pair in between stem 1 and stem 2 is not necessary to promote efficient frameshifting in SRV-1. These results reveal that coaxial stacking of stem 1 and stem 2 with a Watson-Crick A.U base pair in between two stems is not a required structural feature of the pseudoknot for promoting efficient frameshifting in SRV-1. Our mutational data suggest that SRV-1 pseudoknot adopts similar structural features common to other efficient frameshifting pseudoknots as observed in MMTV and FIV.     

Identification of novel ligands for the RNA pseudoknot that regulate -1 ribosomal frameshifting

In many viruses, -1 ribosomal frameshifting (-1RF) regulates synthesis of proteins and is crucial for virus production. An RNA pseudoknot is one of the essential components of the viral -1RF system. Thermodynamic or kinetic control of pseudoknot folding may be important in regulating the efficiency of -1RF. Thus, small molecules that interact with viral RNA pseudoknots may disrupt the -1RF system and show antiviral activity. In this study, we conducted virtual screening of a chemical database targeting the X-ray crystal structure of RNA pseudoknot complexed with biotin to identify ligands that may regulate an -1RF system containing biotin-aptamer as an RNA pseudoknot component. After docking screening of about 80,000 compounds, 58 high-ranked hits were selected and their activities were examined by in vitro and cell-based -1 frameshifting assays. Six compounds increased the efficiency of -1 frameshifting, and these are novel small molecule compounds that regulate the -1RF.     

An atypical RNA pseudoknot stimulator and an upstream attenuation signal for -1 ribosomal frameshifting of SARS coronavirus

The −1 ribosomal frameshifting requires the existence of an in cis RNA slippery sequence and is promoted by a downstream stimulator RNA. An atypical RNA pseudoknot with an extra stem formed by complementary sequences within loop 2 of an H-type pseudoknot is characterized in the severe acute respiratory syndrome coronavirus (SARS CoV) genome. This pseudoknot can serve as an efficient stimulator for −1 frameshifting in vitro. Mutational analysis of the extra stem suggests frameshift efficiency can be modulated via manipulation of the secondary structure within the loop 2 of an infectious bronchitis virus-type pseudoknot. More importantly, an upstream RNA sequence separated by a linker 5′ to the slippery site is also identified to be capable of modulating the −1 frameshift efficiency. RNA sequence containing this attenuation element can downregulate −1 frameshifting promoted by an atypical pseudoknot of SARS CoV and two other pseudoknot stimulators. Furthermore, frameshift efficiency can be reduced to half in the presence of the attenuation signal in vivo. Therefore, this in cis RNA attenuator represents a novel negative determinant of general importance for the regulation of −1 frameshift efficiency, and is thus a potential antiviral target.     

Solution structure of the pseudoknot of SRV-1 RNA, involved in ribosomal frameshifting

RNA pseudoknots play important roles in many biological processes. In the simian retrovirus type-1 (SRV-1) a pseudoknot together with a heptanucleotide slippery sequence are responsible for programmed ribosomal frameshifting, a translational recoding mechanism used to control expression of the Gag-Pol polyprotein from overlapping gag and pol open reading frames. Here we present the three-dimensional structure of the SRV-1 pseudoknot determined by NMR. The structure has a classical H-type fold and forms a triple helix by interactions between loop 2 and the minor groove of stem 1 involving base-base and base-sugar interactions and a ribose zipper motif, not identified in pseudoknots so far. Further stabilization is provided by a stack of five adenine bases and a uracil in loop 2, enforcing a cytidine to bulge. The two stems of the pseudoknot stack upon each other, demonstrating that a pseudoknot without an intercalated base at the junction can induce efficient frameshifting. Results of mutagenesis data are explained in context with the present three-dimensional structure. The two base-pairs at the junction of stem 1 and 2 have a helical twist of approximately 49 degrees, allowing proper alignment and close approach of the three different strands at the junction. In addition to the overwound junction the structure is somewhat kinked between stem 1 and 2, assisting the single adenosine in spanning the major groove of stem 2. Geometrical models are presented that reveal the importance of the magnitude of the helical twist at the junction in determining the overall architecture of classical pseudoknots, in particular related to the opening of the minor groove of stem 1 and the orientation of stem 2, which determines the number of loop 1 nucleotides that span its major groove.     

A mutant RNA pseudoknot that promotes ribosomal frameshifting in mouse mammary tumor virus.

A single A-->G mutation that changes a potential A.U base pair to a G.U pair at the junction of the stems and loops of a non-frameshifting pseudoknot dramatically increases its frameshifting efficiency in mouse mammary tumor virus. The structure of the non-frameshifting pseudoknot APK has been found to be very different from that of pseudoknots that cause efficient frameshifting [Kang,H., Hines,J.V. and Tinoco,I. (1995) J. Mol. Biol. , 259, 135-147]. The 3-dimensional structure of the mutant pseudoknot was determined by restrained molecular dynamics based on NMR-derived interproton distance and torsion angle constraints. One striking feature of the mutant pseudoknot compared with the parent pseudoknot is that a G.U base pair forms at the top of stem 2, thus leaving only 1 nt at the junction of the two stems. The conformation is very different from that of the previously determined non-frameshifting parent pseudoknot, which lacks the A.U base pair at the top of the stem and has 2 nt between the stems. However, the conformation is quite similar to that of efficient frameshifting pseudoknots whose structures were previously determined by NMR. A single adenylate residue intervenes between the two stems and interrupts their coaxial stacking. This unpaired nucleotide produces a bent structure. The structural similarity among the efficient frameshifting pseudoknots indicates that a specific conformation is required for ribosomal frameshifting, further implying a specific interaction of the pseudoknot with the ribosome.     

Functional analysis of the SRV-1 RNA frameshifting pseudoknot

Simian retrovirus type-1 uses programmed ribosomal frameshifting to control expression of the Gag-Pol polyprotein from overlapping gag and pol open-reading frames. The frameshifting signal consists of a heptanucleotide slippery sequence and a downstream-located 12-base pair pseudoknot. The solution structure of this pseudoknot, previously solved by NMR [Michiels,P.J., Versleijen,A.A., Verlaan,P.W., Pleij,C.W., Hilbers,C.W. and Heus,H.A. (2001) Solution structure of the pseudoknot of SRV-1 RNA, involved in ribosomal frameshifting. J. Mol. Biol., 310, 1109–1123] has a classical H-type fold and forms an extended triple helix by interactions between loop 2 and the minor groove of stem 1 involving base–base and base–sugar contacts. A mutational analysis was performed to test the functional importance of the triple helix for −1 frameshifting in vitro. Changing bases in L2 or base pairs in S1 involved in a base triple resulted in a 2- to 5-fold decrease in frameshifting efficiency. Alterations in the length of L2 had adverse effects on frameshifting. The in vitro effects were well reproduced in vivo, although the effect of enlarging L2 was more dramatic in vivo. The putative role of refolding kinetics of frameshifter pseudoknots is discussed. Overall, the data emphasize the role of the triple helix in −1 frameshifting.     

Regulated ribosomal frameshifting by an RNA-protein interaction.

Ribosomal frameshifting is a translational mechanism used as an essential step in the replication cycle of retroviruses. Programmed frameshifting in retroviral translation involves two sequence elements: A heptanucleotide slippery sequence which induces a low basal level of frameshifting and a downstream RNA structure as an enhancer of the process. The precise mechanism of function of these downstream elements is still unclear, but their effect does not solely depend on their stability. Likewise, the possibility that frameshifting could be controlled by specific proteins that bind to these elements and enable or modulate their effects has yet not been substantiated. The RNA hairpin of the HIV-1 gag-pol frameshift cassette was replaced by the iron-responsive element (IRE) from ferritin mRNA, a stem-loop structure that binds iron regulatory proteins (IRPs) in dependence of the iron status of the cell. When a lacZ/luciferase reporter construct was expressed in transfected BHK-21 cells, the IRE or a point-mutated version that is unable to bind IRPs were found to functionally substitute for the HIV-1 hairpin. When cells were treated with the iron chelator desferrioxamine to stimulate IRP binding to the wild-type IRE, frameshift activity was specifically and strongly augmented by protein binding Our data establish that frameshifting can be regulated in a reversible fashion by mRNA-binding proteins.     

Crystal structure of a luteoviral RNA pseudoknot and model for a minimal ribosomal frameshifting motif

To understand the role of structural elements of RNA pseudoknots in controlling the extent of -1-type ribosomal frameshifting, we determined the crystal structure of a high-efficiency frameshifting mutant of the pseudoknot from potato leaf roll virus (PLRV). Correlations of the structure with available in vitro frameshifting data for PLRV pseudoknot mutants implicate sequence and length of a stem-loop linker as modulators of frameshifting efficiency. Although the sequences and overall structures of the RNA pseudoknots from PLRV and beet western yellow virus (BWYV) are similar, nucleotide deletions in the linker and adjacent minor groove loop abolish frameshifting only with the latter. Conversely, mutant PLRV pseudoknots with up to four nucleotides deleted in this region exhibit nearly wild-type frameshifting efficiencies. The crystal structure helps rationalize the different tolerances for deletions in the PLRV and BWYV RNAs, and we have used it to build a three-dimensional model of the PRLV pseudoknot with a four-nucleotide deletion. The resulting structure defines a minimal RNA pseudoknot motif composed of 22 nucleotides capable of stimulating -1-type ribosomal frameshifts.     

The stimulatory RNA of the Visna-Maedi retrovirus ribosomal frameshifting signal is an unusual pseudoknot with an interstem element

The stimulatory RNA of the Visna-Maedi virus (VMV) -1 ribosomal frameshifting signal has not previously been characterized but can be modeled either as a two-stem helix, reminiscent of the HIV-1 frameshift-stimulatory RNA, or as an RNA pseudoknot. The pseudoknot is unusual in that it would include a 7 nucleotide loop (termed here an interstem element [ISE]) between the two stems. In almost all frameshift-promoting pseudoknots, ISEs are absent or comprise a single adenosine residue. Using a combination of RNA structure probing, site directed mutagenesis, NMR, and phylogenetic sequence comparisons, we show here that the VMV stimulatory RNA is indeed a pseudoknot, conforming closely to the modeled structure, and that the ISE is essential for frameshifting. Pseudoknot function was predictably sensitive to changes in the length of the ISE, yet altering its sequence to alternate pyrimidine/purine bases was also detrimental to frameshifting, perhaps through modulation of local tertiary interactions. How the ISE is placed in the context of an appropriate helical junction conformation is not known, but its presence impacts on other elements of the pseudoknot, for example, the necessity for a longer than expected loop 1. This may be required to accommodate an increased flexibility of the pseudoknot brought about by the ISE. In support of this, (1)H NMR analysis at increasing temperatures revealed that stem 2 of the VMV pseudoknot is more labile than stem 1, perhaps as a consequence of its connection to stem 1 solely via flexible single-stranded loops.     

Minor groove RNA triplex in the crystal structure of a ribosomal frameshifting viral pseudoknot

Many viruses regulate translation of polycistronic mRNA using a -1 ribosomal frameshift induced by an RNA pseudoknot. A pseudoknot has two stems that form a quasi-continuous helix and two connecting loops. A 1.6 A crystal structure of the beet western yellow virus (BWYV) pseudoknot reveals rotation and a bend at the junction of the two stems. A loop base is inserted in the major groove of one stem with quadruple-base interactions. The second loop forms a new minor-groove triplex motif with the other stem, involving 2'-OH and triple-base interactions, as well as sodium ion coordination. Overall, the number of hydrogen bonds stabilizing the tertiary interactions exceeds the number involved in Watson-Crick base pairs. This structure will aid mechanistic analyses of ribosomal frameshifting.     

The Q-base of asparaginyl-tRNA is dispensable for efficient -1 ribosomal frameshifting in eukaryotes

The frameshift signal of the avian coronavirus infectious bronchitis virus (IBV) contains two cis-acting signals essential for efficient frameshifting, a heptameric slippery sequence (UUUAAAC) and an RNA pseudoknot structure located downstream. The frameshift takes place at the slippery sequence with the two ribosome-bound tRNAs slipping back simultaneously by one nucleotide from the zero phase (U UUA AAC) to the -1 phase (UUU AAA). Asparaginyl-tRNA, which decodes the A-site codon AAC, has the modified base Q at the wobble position of the anticodon (5' QUU 3') and it has been speculated that Q may be required for frameshifting. To test this, we measured frameshifting in cos cells that had been passaged in growth medium containing calf serum or horse serum. Growth in horse serum, which contains no free queuine, eliminates Q from the cellular tRNA population upon repeated passage. Over ten cell passages, however, we found no significant difference in frameshift efficiency between the cell types, arguing against a role for Q in frameshifting. We confirmed that the cells cultured in horse serum were devoid of Q by purifying tRNAs and assessing their Q-content by tRNA transglycosylase assays and coupled HPLC-mass spectroscopy. Supplementation of the growth medium of cells grown either on horse serum or calf serum with free queuine had no effect on frameshifting either. These findings were recapitulated in an in vitro system using rabbit reticulocyte lysates that had been largely depleted of endogenous tRNAs and resupplemented with Q-free or Q-containing tRNA populations. Thus Q-base is not required for frameshifting at the IBV signal and some other explanation is required to account for the slipperiness of eukaryotic asparaginyl-tRNA.     

A functional pseudoknot in 16S ribosomal RNA.

Several lines of evidence indicate that the universally conserved 530 loop of 16S ribosomal RNA plays a crucial role in translation, related to the binding of tRNA to the ribosomal A site. Based upon limited phylogenetic sequence variation, Woese and Gutell (1989) have proposed that residues 524-526 in the 530 hairpin loop are base paired with residues 505-507 in an adjoining bulge loop, suggesting that this region of 16S rRNA folds into a pseudoknot structure. Here, we demonstrate that Watson-Crick interactions between these nucleotides are essential for ribosomal function. Moreover, we find that certain mild perturbations of the structure, for example, creation of G-U wobble pairs, generate resistance to streptomycin, an antibiotic known to interfere with the decoding process. Chemical probing of mutant ribosomes from streptomycin-resistant cells shows that the mutant ribosomes have a reduced affinity for streptomycin, even though streptomycin is thought to interact with a site on the 30S subunit that is distinct from the 530 region. Data from earlier in vitro assembly studies suggest that the pseudoknot structure is stabilized by ribosomal protein S12, mutations in which have long been known to confer streptomycin resistance and dependence.     

Ribosomal frameshifting requires a pseudoknot in the Saccharomyces cerevisiae double-stranded RNA virus.

The large double-stranded RNA of the Saccharomyces cerevisiae (yeast) virus has two large overlapping open reading frames on the plus strand, one of which is translated via a -1 ribosomal frameshift. Sequences including the overlapping region, placed in novel contexts, can direct ribosomes to make a -1 frameshift in wheat germ extract, Escherichia coli and S. cerevisiae. This sequence includes a consensus slippery sequence, GGGUUUA, and has the potential to form a pseudoknot 3' to the putative frameshift site. Based on deletion analysis, a region of 71 nucleotides including the potential pseudoknot and the putative slippery sequence is sufficient for frameshifting. Site-directed mutagenesis demonstrates that the pseudoknot is essential for frameshifting.     

Conformation of an RNA pseudoknot.

The structure of the 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' RNA oligonucleotide was investigated using biochemical and chemical probes and nuclear magnetic resonance spectroscopy. Formation of a pseudoknot is indicated by the imino proton spectrum. Imino protons are observed consistent with formation of two helical stem regions; nuclear Overhauser enhancements between imino protons show that the two stem regions stack to form a continuous helix. In the stem regions, nucleotide conformations (3'-endo, anti) and internucleotide distances, derived from two-dimensional correlated, spectroscopy and two-dimensional nuclear Overhauser effect spectra, are characteristic of A-form geometry. The data suggest minor distortion in helical stacking at the junctions of stems and loops. The model of the pseudoknot is consistent with the structure originally proposed by Pleij et al.     

Structural and functional studies of retroviral RNA pseudoknots involved in ribosomal frameshifting: nucleotides at the junction of the two stems are important for efficient ribosomal frameshifting.

Ribosomal frameshifting, a translational mechanism used during retroviral replication, involves a directed change in reading frame at a specific site at a defined frequency. Such programmed frameshifting at the mouse mammary tumor virus (MMTV) gag-pro shift site requires two mRNA signals: a heptanucleotide shifty sequence and a pseudoknot structure positioned downstream. Using in vitro translation assays and enzymatic and chemical probes for RNA structure, we have defined features of the pseudoknot that promote efficient frameshifting. Heterologous RNA structures, e.g. a hairpin, a tRNA or a synthetic pseudoknot, substituted downstream of the shifty site fail to promote frameshifting, suggesting that specific features of the MMTV pseudoknot are important for function. Site-directed mutations of the MMTV pseudoknot indicate that the pseudoknot junction, including an unpaired adenine nucleotide between the two stems, provides a specific structural determinant for efficient frameshifting. Pseudoknots derived from other retroviruses (i.e. the feline immunodeficiency virus and the simian retrovirus type 1) also promote frameshifting at the MMTV gag-pro shift site, dependent on the same structure at the junction of the two stems.     

The 9-A solution: how mRNA pseudoknots promote efficient programmed -1 ribosomal frameshifting

There is something special about mRNA pseudoknots that allows them to elicit efficient levels of programmed -1 ribosomal frameshifting. Here, we present a synthesis of recent crystallographic, molecular, biochemical, and genetic studies to explain this property. Movement of 9 A by the anticodon loop of the aminoacyl-tRNA at the accommodation step normally pulls the downstream mRNA a similar distance along with it. We suggest that the downstream mRNA pseudoknot provides resistance to this movement by becoming wedged into the entrance of the ribosomal mRNA tunnel. These two opposing forces result in the creation of a local region of tension in the mRNA between the A-site codon and the mRNA pseudoknot. This can be relieved by one of two mechanisms; unwinding the pseudoknot, allowing the downstream region to move forward, or by slippage of the proximal region of the mRNA backwards by one base. The observed result of the latter mechanism is a net shift of reading frame by one base in the 5' direction, that is, a -1 ribosomal frameshift.