Structure of a rare non-standard sequence k-turn bound by L7Ae protein

Kt-23 from Thelohania solenopsae is a rare RNA kink turn (k-turn) where an adenine replaces the normal guanine at the 2n position. L7Ae is a member of a strongly conserved family of proteins that bind a range of k-turn structures in the ribosome, box C/D and H/ACA small nucleolar RNAs and U4 small nuclear RNA. We have solved the crystal structure of T. solenopsae Kt-23 RNA bound to Archeoglobus fulgidus L7Ae protein at a resolution of 2.95 Å. The protein binds in the major groove displayed on the outer face of the k-turn, in a manner similar to complexes with standard k-turn structures. The k-turn adopts a standard N3 class conformation, with a single hydrogen bond from A2b N6 to A2n N3. This contrasts with the structure of the same sequence located in the SAM-I riboswitch, where it adopts an N1 structure, showing the inherent plasticity of k-turn structure. This potentially can affect any tertiary interactions in which the RNA participates.     

The contribution of pseudouridine to stabilities and structure of RNAs

Thermodynamic data are reported revealing that pseudouridine (Ψ) can stabilize RNA duplexes when replacing U and forming Ψ-A, Ψ-G, Ψ-U and Ψ-C pairs. Stabilization is dependent on type of base pair, position of Ψ within the RNA duplex, and type and orientation of adjacent Watson–Crick pairs. NMR spectra demonstrate that for internal Ψ-A, Ψ-G and Ψ-U pairs, the N3 imino proton is hydrogen bonded to the opposite strand nucleotide and the N1 imino proton may also be hydrogen bonded. CD spectra show that general A-helix structure is preserved, but there is some shifting of peaks and changing of intensities. Ψ has two hydrogen donors (N1 and N3 imino protons) and two hydrogen bond acceptors because the glycosidic bond is C-C rather than C-N as in uridine. This greater structural potential may allow Ψ to behave as a kind of structurally driven universal base because it can enhance stability relative to U when paired with A, G, U or C inside a double helix. These structural and thermodynamic properties may contribute to the biological functions of Ψ.     

Building a stable RNA U-turn with a protonated cytidine

The U-turn is a classical three-dimensional RNA folding motif first identified in the anticodon and T-loops of tRNAs. It also occurs frequently as a building block in other functional RNA structures in many different sequence and structural contexts. U-turns induce sharp changes in the direction of the RNA backbone and often conform to the 3-nt consensus sequence 5′-UNR-3′ (N = any nucleotide, R = purine). The canonical U-turn motif is stabilized by a hydrogen bond between the N3 imino group of the U residue and the 3′ phosphate group of the R residue as well as a hydrogen bond between the 2′-hydroxyl group of the uridine and the N7 nitrogen of the R residue. Here, we demonstrate that a protonated cytidine can functionally and structurally replace the uridine at the first position of the canonical U-turn motif in the apical loop of the neomycin riboswitch. Using NMR spectroscopy, we directly show that the N3 imino group of the protonated cytidine forms a hydrogen bond with the backbone phosphate 3′ from the third nucleotide of the U-turn analogously to the imino group of the uridine in the canonical motif. In addition, we compare the stability of the hydrogen bonds in the mutant U-turn motif to the wild type and describe the NMR signature of the C+-phosphate interaction. Our results have implications for the prediction of RNA structural motifs and suggest simple approaches for the experimental identification of hydrogen bonds between protonated C-imino groups and the phosphate backbone.     

Bulged adenosine influence on the RNA duplex conformation in solution

The RNA single bulge motif is an unpaired residue within a strand of several complementary base pairs. To gain insight into structural changes induced by the presence of the adenosine bulge on RNA duplex, the solution structures of RNA duplex containing a single adenine bulge (5'-GCAGAAGAGCG-3'/5'-CGCUCUCUGC-3') and a reference duplex with all Watson-Crick base pairs (5'-GCAGAGAGCG-3'/5'-CGCUCUCUGC-3') have been determined by NMR spectroscopy. The reference duplex structure is a regular right-handed helix with all of the attributes of an A-type helix. In the bulged duplex, single adenine bulge stacks into the helix, and the bulge region forms a well-defined structure. Both structures were analyzed by the use of calculated helical parameters. Distortions induced by the accommodation of unpaired residue into the helical structure propagate over the entire structure and are manifested as the reduced base pairs inclination and x-displacement. Intrahelical position of bulged adenine A5 is stabilized by efficient stacking with 5'-neighboring residues G4.     

High-Resolution Crystal Structures of Protein Helices Reconciled with Three-Centered Hydrogen Bonds and Multipole Electrostatics

Theoretical and experimental evidence for non-linear hydrogen bonds in protein helices is ubiquitous. In particular, amide three-centered hydrogen bonds are common features of helices in high-resolution crystal structures of proteins. These high-resolution structures (1.0 to 1.5 Å nominal crystallographic resolution) position backbone atoms without significant bias from modeling constraints and identify Φ = -62°, ψ = -43 as the consensus backbone torsional angles of protein helices. These torsional angles preserve the atomic positions of α-β carbons of the classic Pauling α-helix while allowing the amide carbonyls to form bifurcated hydrogen bonds as first suggested by Némethy et al. in 1967. Molecular dynamics simulations of a capped 12-residue oligoalanine in water with AMOEBA (Atomic Multipole Optimized Energetics for Biomolecular Applications), a second-generation force field that includes multipole electrostatics and polarizability, reproduces the experimentally observed high-resolution helical conformation and correctly reorients the amide-bond carbonyls into bifurcated hydrogen bonds. This simple modification of backbone torsional angles reconciles experimental and theoretical views to provide a unified view of amide three-centered hydrogen bonds as crucial components of protein helices. The reason why they have been overlooked by structural biologists depends on the small crankshaft-like changes in orientation of the amide bond that allows maintenance of the overall helical parameters (helix pitch (p) and residues per turn (n)). The Pauling 3.6₁₃ α-helix fits the high-resolution experimental data with the minor exception of the amide-carbonyl electron density, but the previously associated backbone torsional angles (Φ, Ψ) needed slight modification to be reconciled with three-atom centered H-bonds and multipole electrostatics. Thus, a new standard helix, the 3.6_13/10-, Némethy- or N-helix, is proposed. Due to the use of constraints from monopole force fields and assumed secondary structures used in low-resolution refinement of electron density of proteins, such structures in the PDB often show linear hydrogen bonding.     

Internal dynamics in a DNA triple helix probed by (1)H-(15)N-NMR spectroscopy

The amino group of adenine plays a key role in maintaining DNA triple helical structures, being the only functional group in DNA that is involved in both Watson-Crick and Hoogsteen hydrogen bonds. In the present work we have probed the internal dynamics of the adenine amino group in the intramolecular YRY triple helix formed by the 31-mer DNA oligonucleotide d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT). The DNA triple helix was specifically labeled with (15)N at the amino group of the adenine in the fifth position. The rotation rate of the labeled amino group was measured as a function of temperature using (1)H-(15)N heteronuclear NMR spectroscopy. The results indicate that, in the DNA triple helix, the rotation of the adenine amino group is greatly slowed relative to that in a DNA double helix. The temperature dependence of the rotation rate suggests a large entropic contribution to this effect, which may originate from different hydration patterns of the adenine amino group in the two structures.     

A universal mode of helix packing in RNA

RNA molecules fold into specific three-dimensional shapes to perform structural and catalytic functions. Large RNAs can form compact globular structures, but the chemical basis for close helical packing within these molecules has been unclear. Analysis of transfer, catalysis, in vitro-selected and ribosomal RNAs reveal that helical packing predominantly involves the interaction of single-stranded adenosines with a helix minor groove. Using the Tetrahymena thermophila group I ribozyme, we show here that the near-perfect shape complementarity between the adenine base and the minor groove allows for optimal van der Waals contacts, extensive hydrogen bonding and hydrophobic surface burial, creating a highly energetically favorable interaction. Adenosine is recognized in a chemically similar fashion by a combination of protein and RNA components in the ribonucleoprotein core of the signal recognition particle. These results provide a thermodynamic explanation for the noted abundance of conserved adenosines within the unpaired regions of RNA secondary structures.     

Prediction of β-turns and β-turn types by a novel bidirectional Elman-type recurrent neural network with multiple output layers (MOLEBRNN)

Prediction of β-turns from amino acid sequences has long been recognized as an important problem in structural bioinformatics due to their frequent occurrence as well as their structural and functional significance. Because various structural features of proteins are intercorrelated, secondary structure information has been often employed as an additional input for machine learning algorithms while predicting β-turns. Here we present a novel bidirectional Elman-type recurrent neural network with multiple output layers (MOLEBRNN) capable of predicting multiple mutually dependent structural motifs and demonstrate its efficiency in recognizing three aspects of protein structure: β-turns, β-turn types, and secondary structure. The advantage of our method compared to other predictors is that it does not require any external input except for sequence profiles because interdependencies between different structural features are taken into account implicitly during the learning process. In a sevenfold cross-validation experiment on a standard test dataset our method exhibits the total prediction accuracy of 77.9% and the Mathew's Correlation Coefficient of 0.45, the highest performance reported so far. It also outperforms other known methods in delineating individual turn types. We demonstrate how simultaneous prediction of multiple targets influences prediction performance on single targets. The MOLEBRNN presented here is a generic method applicable in a variety of research fields where multiple mutually depending target classes need to be predicted. Availability: http://webclu.bio.wzw.tum.de/predator-web/.     

Crystal Structures of Ethanolamine Ammonia-lyase Complexed with Coenzyme B12 Analogs and Substrates

N-terminal truncation of the Escherichia coli ethanolamine ammonia-lyase β-subunit does not affect the catalytic properties of the enzyme (Akita, K., Hieda, N., Baba, N., Kawaguchi, S., Sakamoto, H., Nakanishi, Y., Yamanishi, M., Mori, K., and Toraya, T. (2010) J. Biochem. 147, 83–93). The binary complex of the truncated enzyme with cyanocobalamin and the ternary complex with cyanocobalamin or adeninylpentylcobalamin and substrates were crystallized, and their x-ray structures were analyzed. The enzyme exists as a trimer of the (αβ)₂ dimer. The active site is in the (β/α)₈ barrel of the α-subunit; the β-subunit covers the lower part of the cobalamin that is bound in the interface of the α- and β-subunits. The structure complexed with adeninylpentylcobalamin revealed the presence of an adenine ring-binding pocket in the enzyme that accommodates the adenine moiety through a hydrogen bond network. The substrate is bound by six hydrogen bonds with active-site residues. Argα¹⁶⁰ contributes to substrate binding most likely by hydrogen bonding with the O1 atom. The modeling study implies that marked angular strains and tensile forces induced by tight enzyme-coenzyme interactions are responsible for breaking the coenzyme Co–C bond. The coenzyme adenosyl radical in the productive conformation was modeled by superimposing its adenine ring on the adenine ring-binding site followed by ribosyl rotation around the N-glycosidic bond. A major structural change upon substrate binding was not observed with this particular enzyme. Gluα²⁸⁷, one of the substrate-binding residues, has a direct contact with the ribose group of the modeled adenosylcobalamin, which may contribute to the substrate-induced additional labilization of the Co–C bond.     

The solution structure of an oligonucleotide duplex containing a 2'-deoxyadenosine-3-(2-hydroxyethyl)- 2'-deoxyuridine base pair determined by NMR and molecular dynamics studies

Determination of the solution structure of the duplex d(GCAAGTC(HE)AAAACG)·d(CGTTTTAGACTTGC) containing a 3-(2-hydroxyethyl)-2′-deoxyuridine·deoxyadenine (HE·A) base pair is reported. The three-dimensional solution structure, determined starting from 512 models via restrained molecular mechanics using inter-proton distances and torsion angles, converged to two final families of structures. For both families the HE and the opposite A residues are intrahelical and in the anti conformation. The hydroxyethyl chain lies close to the helix axis and for one family the hydroxyl group is above the HE·A plane and in the other case it is below. These two models were used to start molecular dynamic calculations with explicit solvent to explore the hydrogen bonding possibilities of the HE·A base pair. The dynamics calculations converge finally to one model structure in which two hydrogen bonds are formed. The first is formed all the time and is between HEO4 and the amino group of A, and the second, an intermittent one, is between the hydroxyl group and the N1 of A. When this second hydrogen bond is not formed a weak interaction CH···N is possible between HEC7H2 and N1A21. All the best structures show an increase in the C1′–C1′ distance relative to a Watson–Crick base pair.     

The role of specific 2'-hydroxyl groups in the stabilization of the folded conformation of kink-turn RNA

The role of 2'-hydroxyl groups in stabilizing the tightly kinked geometry of the kink-turn (K-turn) has been investigated. Individual 2'-OH groups have been removed by chemical synthesis, and the kinking of the RNA has been studied by gel electrophoresis and fluorescence resonance energy transfer. The results have been analyzed by reference to a database of 11 different crystallographic structures of K-turns. The potential hydrogen bonds fall into several classes. The most important are those in the core of the turn and ribose-phosphate interactions around the bulge. Of these the single most important hydrogen bond is one donated from the 2'-OH of the 5' nucleotide of the bulge to the N1 of the adenine of the kink-proximal A*G pair. This is present in all known K-turn structures, and removal of the 2'-OH completely prevents metal ion-induced folding. Hydrogen bonds formed in the minor grooves of the helical stems are less important, and removal of the participating 2'-OH groups leads to reduced impairment of folding. These interactions are generally more polymorphic, and hydrogen bonds probably form where possible, as permitted by the global structure.     

Crystal structures of proto-oncogene kinase Pim1: a target of aberrant somatic hypermutations in diffuse large cell lymphoma

Pim1, a serine/threonine kinase, is involved in several biological functions including cell survival, proliferation, and differentiation. While pim1 has been shown to be involved in several hematopoietic cancers, it was also recently identified as a target of aberrant somatic hypermutation in diffuse large cell lymphoma (DLCL), the most common form of non-Hodgkin's lymphoma. The crystal structures of Pim1 in apo form and bound with AMPPNP have been solved and several unique features of Pim1 were identified, including the presence of an extra beta-hairpin in the N-terminal lobe and an unusual conformation of the hinge connecting the two lobes of the enzyme. While the apo Pim1 structure is nearly identical with that reported recently, the structure of AMPPNP bound to Pim1 is significantly different. Pim1 is unique among protein kinases due to the presence of a proline residue at position 123 that precludes the formation of the canonical second hydrogen bond between the hinge backbone and the adenine moiety of ATP. One crystal structure reported here shows that changing P123 to methionine, a common residue that offers the backbone hydrogen bond to ATP, does not restore the ATP binding pocket of Pim1 to that of a typical kinase. These unique structural features in Pim1 result in novel binding modes of AMP and a known kinase inhibitor scaffold, as shown by co-crystallography. In addition, the kinase activities of five Pim1 mutants identified in DLCL patients have been determined. In each case, the observed effects on kinase activity are consistent with the predicted consequences of the mutation on the Pim1 structure. Finally, 70 co-crystal structures of low molecular mass, low-affinity compounds with Pim1 have been solved in order to identify novel chemical classes as potential Pim1 inhibitors. Based on the structural information, opportunities for optimization of one specific example are discussed.     

Molecular dynamics simulations and coupled nucleotide substitution experiments indicate the nature of A·A base pairing and a putative structure of the coralyne-induced homo-adenine duplex

Coralyne is an alkaloid drug that binds homo-adenine DNA (and RNA) oligonucleotides more tightly than it does Watson–Crick DNA. Hud’s laboratory has shown that poly(dA) in the presence of coralyne forms an anti-parallel duplex, however attempts to determine the structure by NMR spectroscopy and X-ray crystallography have been unsuccessful. Assuming adenine–adenine hydrogen bonding between the two poly(dA) strands, we constructed 40 hypothetical homo-(dA) anti-parallel duplexes and docked coralyne into the six most favorable duplex structures. The two most stable structures had trans glycosidic bonds, but distinct pairing geometries, i.e. either Watson–Crick Hoogsteen (transWH) or Watson–Crick Watson–Crick (transWW) with stability of transWH > transWW. To narrow down the possibilities, 7-deaza adenine base substitutions (dA→7) were engineered into homo-(dA) sequences. These substitutions significantly reduced the thermal stability of the coralyne-induced homo-(dA) structure. These experiments strongly suggest the involvement of N7 in the coralyne-induced A·A base pairs. Moreover, due to the differential effect on melting as a function of the location of the dA→7 mutations, these results are consistent with the N1–N7 base pairing of the transWH pairs. Together, the simulation and base substitution experiments predict that the coralyne-induced homo-(dA) duplex structure adopts the transWH geometry.     

Structural and sequencing analysis of local target DNA recognition by MLV integrase

Target-site selection by retroviral integrase (IN) proteins profoundly affects viral pathogenesis. We describe the solution nuclear magnetic resonance structure of the Moloney murine leukemia virus IN (M-MLV) C-terminal domain (CTD) and a structural homology model of the catalytic core domain (CCD). In solution, the isolated MLV IN CTD adopts an SH3 domain fold flanked by a C-terminal unstructured tail. We generated a concordant MLV IN CCD structural model using SWISS-MODEL, MMM-tree and I-TASSER. Using the X-ray crystal structure of the prototype foamy virus IN target capture complex together with our MLV domain structures, residues within the CCD α2 helical region and the CTD β1-β2 loop were predicted to bind target DNA. The role of these residues was analyzed in vivo through point mutants and motif interchanges. Viable viruses with substitutions at the IN CCD α2 helical region and the CTD β1-β2 loop were tested for effects on integration target site selection. Next-generation sequencing and analysis of integration target sequences indicate that the CCD α2 helical region, in particular P187, interacts with the sequences distal to the scissile bonds whereas the CTD β1-β2 loop binds to residues proximal to it. These findings validate our structural model and disclose IN-DNA interactions relevant to target site selection.     

Side-chain structures in the first turn of the alpha-helix

The first three residues at the N terminus of the alpha-helix are called N1, N2 and N3. We surveyed 2102 alpha-helix N termini in 298 high-resolution, non-homologous protein crystal structures for N1, N2 and N3 amino acid and side-chain rotamer propensities and hydrogen-bonding patterns. We find strong structural preferences that are unique to these sites. The rotamer distributions as a function of amino acid identity and position in the helix are often explained in terms of hydrogen-bonding interactions to the free N1, N2 and N3 backbone NH groups. Notably, the "good N2" amino acid residues Gln, Glu, Asp, Asn, Ser, Thr and His preferentially form i, i or i,i+1 hydrogen bonds to the backbone, though this is hindered by good N-caps (Asp, Asn, Ser, Thr and Cys) that compete for these hydrogen bond donors. We find a number of specific side-chain to side-chain interactions between N1 and N2 or between the N-cap and N2 or N3, such as Arg(N-cap) to Asp(N2). The strong energetic and structural preferences found for N1, N2 and N3, which differ greatly from positions within helix interiors, suggest that these sites should be treated explicitly in any consideration of helical structure in peptides or proteins.     

Thymine-methyl/pi interaction implicated in the sequence-dependent deformability of DNA

The crystal structures of deoxy-oligonucleotides were retrieved from the Nucleic Acid Database and analyzed with the use of our program CHPI. The structure of 5′-ApTpApT-3′ has been shown to be stabilized by the 5-methyl group in the thymidine moiety that favorably interacts with the adenine π-ring preceding it. H2′ of the deoxyribose in adenine also interacts with the thymine ring next to it. Since a 5′-ApT-3′ sequence is accompanied by another 5′-ApT-3′ in the complementary strand, the interaction is duplicated, thus forming a ‘twin A/T-Me interaction’. Coordinates of oligonucleotides with A-T rich sequences were retrieved and analyzed. In almost every case, the thymidine 5-methyl group favorably interacts with an adenine ring in the same strand. The structure of duplexes incorporating A-tracts was also analyzed. The 5-methyl group in the thymidine moiety has been found to interact favorably with the base π-ring before it. Since an A-tract is lined with an oligo-T sequence in the complementary strand, a successive N/T-Me stacking may contribute in making the A-tracts robust and straight. The possible involvement of the  N/T-Me and the twin  A/T-Me motif in the deformability of DNA has been suggested. The role of methyl groups in modified DNA has been discussed on a similar basis.     

Detergent/Nanodisc Screening for High-Resolution NMR Studies of an Integral Membrane Protein Containing a Cytoplasmic Domain

Because membrane proteins need to be extracted from their natural environment and reconstituted in artificial milieus for the 3D structure determination by X-ray crystallography or NMR, the search for membrane mimetic that conserve the native structure and functional activities remains challenging. We demonstrate here a detergent/nanodisc screening study by NMR of the bacterial α-helical membrane protein YgaP containing a cytoplasmic rhodanese domain. The analysis of 2D [¹⁵N,¹H]-TROSY spectra shows that only a careful usage of low amounts of mixed detergents did not perturb the cytoplasmic domain while solubilizing in parallel the transmembrane segments with good spectral quality. In contrast, the incorporation of YgaP into nanodiscs appeared to be straightforward and yielded a surprisingly high quality [¹⁵N,¹H]-TROSY spectrum opening an avenue for the structural studies of a helical membrane protein in a bilayer system by solution state NMR.     

An eight-stranded helical fragment in RNA crystal structure: implications for tetraplex interaction

Multistranded helical structures in nucleic acids play various functions in biological processes. Here we report the crystal structure of a hexamer, rU(BrdG)r(AGGU),at 1.5 A resolution containing a structural complex of an alternating antiparallel eight-stranded helical fragment that is sandwiched in two tetraplexes. The octaplex is formed by groove binding interaction and base tetrad intercalation between two tetraplexes. Two different forms of octaplexes have been proposed, which display different properties in interaction with proteins and nucleic acids. Adenines form a base tetrad in the novel N6-H em leader N3 conformation and further interact with uridines to form an adenine-uridine octad in the reverse Hoogsteen pairing scheme. The conformational flexibility of adenine tetrad indicates that it can optimize its conformation in different interactions.     

A consensus-binding structure for adenine at the atomic level permits searching for the ligand site in a wide spectrum of adenine-containing complexes

Attempts to derive structural features of ligand-binding sites have traditionally involved seeking commonalities at the residue level. Recently, structural studies have turned to atomic interactions of small molecular fragments to extract common binding-site properties. Here, we explore the use of larger ligand elements to derive a consensus binding structure for the ligand as a whole. We superimposed multiple molecular structures from a nonredundant set of adenosine-5'-triphosphate (ATP) protein complexes, using the adenine moiety as template. Clustered binding-site atoms of compatible atomic classes forming attractive contacts with the adenine probe were extracted. A set of atomic clusters characterizing the adenine binding pocket was then derived. Among the clusters are three vertices representing the interactions of adenine atom N6 with its protein-binding niche. These vertices, together with atom C6 of the purine ring system, complete the set of four vertices for the pyramid-like structure of the N6 anchor atom. Also, the sequence relationship for the adenine-binding loop interacting with the C2-N6 end of the conjugated ring system is expanded to include a third hydrophilic cluster interacting with atom N1. A search procedure involving interatomic distances between cluster centers was formulated and applied to seek putative binding sites in test cases. The results show that a consensus network of clusters, based on an adenine probe and an ATP-complexed training set of proteins, is sufficient to recognize the experimental cavity for adenine in a wide spectrum of ligand-protein complexes.     

Brownian-dynamics simulations of metal-ion binding to four-way junctions

Four-way junctions (4Hs) are important intermediates in DNA rearrangements such as genetic recombination. Under the influence of multivalent cations these molecules undergo a conformational change, from an extended planar form to a quasi-continuous stacked X-structure. Recently, a number of X-ray structures and a nuclear magnetic resonance (NMR) structure of 4Hs have been reported and in three of these the position of multivalent cations is revealed. These structures belong to two main families, characterized by the angle between the two co-axial stacked helices, which is either around +40 to +55° or around –70 to –80°. To investigate the role of metal-ion binding on the conformation of folded 4Hs we performed Brownian-dynamics simulations on the set of available structures. The simulations confirm the proposed metal-ion binding sites in the NMR structure and in one of the X-ray structures. Furthermore, the calculations suggest positions for metal-ion binding in the other X-ray structures. The results show a striking dependence of the ion density on the helical environment (B-helix or A-helix) and the structural family.