Flowering in Pisum: the Sites and Possible Mechanisms of the Vernalization Response

Grafting experiments with several genotypes provide evidencethat vernalization acts through at least two mechanisms. Vernalization of the stock promoted flowering by 26 nodes ingenotype If e Sn Hr and 5.5 nodes in genotype If e Sn hr buthad no detectable effect in genotype If e sn hr. Cold treatmentappears to cause a higher ratio of promoter to inhibitor, atleast in part, through low temperature repression of Sn activity.This mechanism is particularly evident in the cotyledons sincethey form a major area of Sn activity during vernalization.Continuous light was shown previously to prevent Sn forminginhibitor. It seems therefore that both photoperiod and vernalizationhave an effect through the Sn gene. Vernalization of the shoot promoted flowering by 19 nodes ingenotype If e Sn Hr, 3 nodes genotype If e Sn hr, and 1 nodein genotype If e sn hr1 grafted to an If e Sn hr stock. Theshoot effect may result from one or possibly two mechanisms.Firstly, vernalization may lower the threshold ratio of promoterto inhibitor required at the apex for floral initiation. Thesame change in threshold could result in changes in the floweringnode of quite different magnitude depending on the rate of changein the hormonal levels in the different genotypes. Secondly,vernalization may disturb the ageing process relative to theplastochronic age leading to an earlier (nodewise) decline ininhibitor level.     

Genetic and Photoperiodic Control of the Relative Rates of Reproductive and Vegetative Development in Peas

The rates of leaf and flower production were determined in peas(Pisum sativum L.) of genotypes e sn hr (line 13), E Sn hr (line60), and E Sn Hr (line G2), to assess the role of the interactionof alleles Sn and Hr with photoperiod in development. The ratesat which flowers at successive nodes opened (AR) and leavesat successive nodes unfolded (PR) were constant. The AR wasfaster than the PR so that successive flowers opened at nodescloser to the apical bud. The rate at which this occurred wasindependent of photoperiod in line 13 but was slightly or markedlyslower in short days (SD) than long days (LD) in lines 60 andG2, respectively. The opening of flowers closer to the apicalbud of G2 peas in SD was so slow as to not be visually apparentduring the time of this study. The number of nodes between thefirst open flower and the apical bud was unaffected by photoperiodin line 13 but was greater in SD than LD in lines 60 and G2.The daylength effects are photoperiodic, since development ofG2 peas in LD with respect to the parameters measured was unaffectedby light intensity. It is concluded that photoperiod and theE Sn allele combination control the rate of reproductive developmentrelative to vegetative development in peas. The effects of ESn are magnified by the presence of the Hr allele. The constantrates of development measured are not consistent with declineof Sn allele expression with age. Delay of the rate of reproductivedevelopment relative to vegetative development correlated withdelay of apical senescence, suggesting that these processesare related. Pisum sativum, genotypes, photoperiod, flowering, reproductive development, vegetative development, senescence     

Flowering in Pisum: A Fifth Locus, Veg

In addition to the known loci, If, e, sn and hr, a fifth locus,veg, is shown to control flowering in peas. Regardless of thegenotype for the other flowering genes, plants homozygous forthe gene veg did not initiate flower buds under a wide rangeof photoperiod and temperature regimes, including those normallyhighly promotory in peas. Treatment with various plant growthsubstances and grafting to stocks known to promote floweringalso failed to cause initiation. Gene veg prevented expressionof allelic differences at the If locus but segregation for allelesat the sn and hr loci was clearly visible by examination ofseveral vegetative characteristics. For example, sn hr veg andSn hr veg plants showed an opening of the apical bud, productionof lateral branches, and a reduction in growth rate, leafletsize, internode length and stem thickness at approx the sametime as sn hr Veg and Sn hr Veg plants carrying the Lf allelecommenced fruit production, respectively. The graft-transmissibleinhibitor controlled by gene Sn is therefore not specific forthe transition from vegetative to reproductive growth. Geneveg allows the processes leading to apical and foliar senescenceto be examined independently of any effect of flowering andfruiting. We found that gene Sn influenced the total numberof leaves expanded in veg plants but not the time of shoot senescence,which, in plants without flowers and fruits appeared to resultfrom failure of the root system. Pisum sativum L., garden pea, flowering, senescence, genetics     

Apical Senescence in Pisum: A Direct or Indirect Role for the Flowering Genes ?

Apical senescence was examined in a range of intact and defloweredflowering genotypes under both long and short photoperiods.The flower inhibitor produced by the gene Sn, appears to havea direct effect on apical senescence since it can delay apicalsenescence under short day conditions in the absence of flowerand fruit development or where the rate of such developmentis the same in different treatments. Gene Hr can magnify thiseffect. Gene E, on the other hand, appears to influence apicalsenescence only indirectly through the effect it has on flowerand fruit development. The flowering genes at the If, sn andhr loci are also thought to have indirect effects on apicalsenescence. Even in deflowered plants apical senescence appearsto occur eventually in continuous light in all genotypes testedindicating that the presence of developing fruits, althoughpromotory, is not essential for apical senescence. Pisum sativum L., garden pea, flowering, senescence     

Flowering in Pisum: the Effect of Age on the Gene Sn and the Site of Action of Gene Hr

Late cultivars of peas behave as quantitative long day plants.The reason that they flower between nodes 20 and 35 under an8 h photoperiod is shown to be because the leaves and maturestem produce a more promotory ratio of the flowering hormonesas they age. Later formed leaves may also start with a slightlymore promotory ratio than the leaves produced at a lower node.The gene Sn controls the production of a flower inhibitor andit is suggested that the activity of this gene in a leaf isgradually reduced as the leaf ages. From grafting experiments,the site of action of the gene Hr is shown to be in the leavesor mature stem and not at the shoot apex. This supports a previoussuggestion that the gene Hr is a specific inhibitor of the ageingresponse of gene Sn. Gene Hr is shown to cause a substantial delay in the floweringnode of decotyledonized plants of genotype If e sn hr undershort day conditions, suggesting that Hr has little effect inthe cotyledons. It is argued that the gene sn is a leaky mutantand that gene Hr does not control a photoperiod response inits own right but has its effect through the Sn locus. From a comparison of intact plants and self-grafts of the lategenotype If e Sn hr it is shown that under the conditions usedphysiological age may be of more importance than chronologicalage in determining flowering in peas. Reasons for the smalleffect of defoliation treatments on flowering are discussedas well as possible reasons for the promotory effect of decotyledonizationon the flowering node of late lines. Pisum sativum L, flowering, ageing, genetic control     

Flowering in Pisum: the Effect of Genotype, Plant Age, Photoperiod, and Number of Inductive Cycles

The genotypes If e Sn hr, Lf e Sn hr, and If e Sn Hr requirefewer inductive cycles as they age. It is suggested that thisresults from a decrease in the activity of the Sn gene in theleaves as they age, resulting in a higher ratio of promoterto inhibitor. Gene Lf does not affect the rate of this agingbut it does increase the number of inductive cycles requiredfor flower induction over the first 5 weeks of growth. The geneHr has no effect until week 4 but thereafter causes a reductionin the effect of age on the Sn gene. The genotype If e Sn Hrcan be induced by a single inductive cycle (32 h of light) fora relatively long period. The length of dark period required for the expression of theSn gene is shown to be less than 4 h providing a relativelylong photoperiod precedes the dark period. It appears that noper manent induction of tissue by photoperiods favourable toflowering occurs in peas. The critical photoperiod for plantsof genotype if e Sn Hr is shown to be between 12 and 14 h atl7·5 °C and the usefulness of the term ‘criticalphotoperiod’ is discussed with respect to quantitativelong-day plants.     

Quantitative effects of the genes Lf, Sn, E, and Hr on time to flowering in pea (Pisum sativum L.)

Flowering time in pea (Pisum sativum L.) is determined by genetically controlled responses to photoperiod and temperature. To investigate these responses, 11 lines homozygous for the flowering genes Lf, Sn, E, and Hr were grown under contrasting semi-controlled photothermal environments and the durations (d) from sowing to first flower (f) were recorded. The effects of the four genes were quantified using a two-plane photothermal model which linearly relates the rate of progress from sowing to flowering (1/f) with the mean pre-flowering values of temperature (T) and/or photo-period (P), based on 1/fa + bT (when P is longer than the critical photoperiod, Pc) and 1/fa + bT + cP (when P<Pc). The main effect of Lf alleles was on temperature sensitivity (b) when P>Pc, which increased in the sequence Lf^d<Lf< lf<lf^a. Gene Hr, when together with Sn, increased photoperiod sensitivity (c) and reduced the intercept (a) when P<Pc. Allele sn determined a single plane response to temperature alone (i.e. a day-neutral response). Gene E, when present with lf Sn, increased 1/f in both the thermal (P<Pc) and photothermal (PPc) domains, mainly by increasing a and b, respectively. Variations in the coefficients of the thermal and photothermal responses determined that the critical photoperiod varied with temperature in all photoperiod-sensitive genotypes. A common base temperature of 0.2C was determined amongst Day-Neutral Class genotypes (sn) and thermal time from sowing to flowering increased in the sequence lf^a<lf< <:f<Lf^d. Intra-Class variations attributed to the Lf alleles were also detected in the Late (Sn hr) and Late High Response (Sn Hr) Classes. The linear photothermal model provided a sound basis for studying the quantitative effects of flowering genes in pea.     

Zygosity Determination in Hairless Mice by PCR Based on Hrhr Gene Analysis

We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr^hr allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hr^hr in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hr^hr allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hr^hr (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hr^hr gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.     

Natural variation in the genes responsible for maturity loci E1, E2, E3 and E4 in soybean

Background and Aims

The timing of flowering has a direct impact on successful seed production in plants. Flowering of soybean (Glycine max) is controlled by several E loci, and previous studies identified the genes responsible for the flowering loci E1, E2, E3 and E4. However, natural variation in these genes has not been fully elucidated. The aims of this study were the identification of new alleles, establishment of allele diagnoses, examination of allelic combinations for adaptability, and analysis of the integrated effect of these loci on flowering.

Methods

The sequences of these genes and their flanking regions were determined for 39 accessions by primer walking. Systematic discrimination among alleles was performed using DNA markers. Genotypes at the E1–E4 loci were determined for 63 accessions covering several ecological types using DNA markers and sequencing, and flowering times of these accessions at three sowing times were recorded.

Key Results

A new allele with an insertion of a long interspersed nuclear element (LINE) at the promoter of the E1 locus (e1-re) was identified. Insertion and deletion of 36 bases in the eighth intron (E2-in and E2-dl) were observed at the E2 locus. Systematic discrimination among the alleles at the E1–E3 loci was achieved using PCR-based markers. Allelic combinations at the E1–E4 loci were found to be associated with ecological types, and about 62–66 % of variation of flowering time could be attributed to these loci.

Conclusions

The study advances understanding of the combined roles of the E1–E4 loci in flowering and geographic adaptation, and suggests the existence of unidentified genes for flowering in soybean,     

Microbial Community Dynamics and Activity Link to Indigo Production from Indole in Bioaugmented Activated Sludge Systems

Biosynthesis of the popular dyestuff indigo from indole has been comprehensively studied using pure cultures, but less has been done to characterize the indigo production by microbial communities. In our previous studies, a wild strain Comamonas sp. MQ was isolated from activated sludge and the recombinant Escherichia coli _nagAc carrying the naphthalene dioxygenase gene (nag) from strain MQ was constructed, both of which were capable of producing indigo from indole. Herein, three activated sludge systems, G1 (non-augmented control), G2 (augmented with Comamonas sp. MQ), and G3 (augmented with recombinant E. coli _nagAc), were constructed to investigate indigo production. After 132-day operation, G3 produced the highest yields of indigo (99.5 ± 3.0 mg/l), followed by G2 (27.3 ± 1.3 mg/l) and G1 (19.2 ± 1.2 mg/l). The microbial community dynamics and activities associated with indigo production were analyzed by Illumina Miseq sequencing of 16S rRNA gene amplicons. The inoculated strain MQ survived for at least 30 days, whereas E. coli _nagAc was undetectable shortly after inoculation. Quantitative real-time PCR analysis suggested the abundance of naphthalene dioxygenase gene (nagAc) from both inoculated strains was strongly correlated with indigo yields in early stages (0–30 days) (P < 0.001) but not in later stages (30–132 days) (P > 0.10) of operation. Based on detrended correspondence analysis (DCA) and dissimilarity test results, the communities underwent a noticeable shift during the operation. Among the four major genera (> 1% on average), the commonly reported indigo-producing populations Comamonas and Pseudomonas showed no positive relationship with indigo yields (P > 0.05) based on Pearson correlation test, while Alcaligenes and Aquamicrobium, rarely reported for indigo production, were positively correlated with indigo yields (P < 0.05). This study should provide new insights into our understanding of indigo bio-production by microbial communities.     

Dermal cysts participate in reparative regeneration of epidermis in Hrhr/Hrhr mice

One of the phenotypic effects of mutation in the Hr gene in mice is disintegration of hair follicles and their degeneration into open funnel-shaped structures (utricles) opened on skin surface and cysts located in the depth of the dermis. The aim of the current study consists in analysis of the process of reparative regeneration of skin in homozygotous mice with one of the mutant alleles of the Hr gene—Hr ^hr . It is shown that epithelial cells that constitute the inner pavement of cysts take part in the process of epithelization of deep skin wounds. This indicates that the competence of ectodermal cells in relation to inductive signals from injured skin remains in Hr ^hr homozygote mice, in spite of the significant anatomic abnormalities of the hair follicles.     

Effect of Low pH and Aluminum Toxicity on the Photosynthetic Characteristics of Different Fast-Growing Eucalyptus Vegetatively Propagated Clones

Knowing how acid soils and aluminum in soils may limit the growth of Eucalyptus trees in plantations is important because these plantations grow in many tropical and subtropical regions. Seedlings of four vegetatively propagated Eucalyptus clones, E. grandis × E. urophylla ‘GLGU9’(G9), E. grandis × E. urophylla ‘GLGU12’ (G12), E. urophylla × E. camaldulensis ‘GLUC3’ (G3) and E. urophylla ‘GLU4’(G4), were subjected to liquid culture with Hoagland nutrient solution for 40 days, then treated with four different treatments of acid and aluminum for 1 day. The four treatments used either pH 3.0 or 4.0 with or without added aluminum (4.4 mM) in all possible combinations; a control used no added aluminum at pH 4.8. Subsequently, the photosynthetic parameters and morphology of leaves from eucalypt seedlings were determined and observed. The results showed that the tested chlorophyll content, net photosynthetic rate, transpiration rate and water use efficiency were apparently inhibited by aluminum. Under uniform Al concentration (4.4 mM), the Al-induced limitation to photosynthetic parameters increased with pH, indicating acid stimulation to Al toxicity. Among all treatments, the most significant reduction was found in the combination of pH 3.0 and 4.4 mM Al. The photosynthetic and transpiration rates showed similar trends with G9 > G12 > G3 > G4, suggesting that G9 and G12 had higher Al-tolerance than other two clones. Microscopic observation revealed changes in leaf morphology when exposed to Al stress; for example, a reduced thickness of leaf epidermis and palisade tissue, the descendant palisade tissue/spongy tissue ratio and leaf tissue looseness. Overall, the acid and aluminum stress exerted negative effects on the photosynthetic activity of eucalypt seedlings, but the differences in tolerance to Al toxicity between the clones were favorable, offering potential to improve Eucalyptus plantation productivity by selecting Al tolerant clones.     

Genetic Variation for Life History Sensitivity to Seasonal Warming in Arabidopsis thaliana

Climate change has altered life history events in many plant species; however, little is known about genetic variation underlying seasonal thermal response. In this study, we simulated current and three future warming climates and measured flowering time across a globally diverse set of Arabidopsis thaliana accessions. We found that increased diurnal and seasonal temperature (1°–3°) decreased flowering time in two fall cohorts. The early fall cohort was unique in that both rapid cycling and overwintering life history strategies were revealed; the proportion of rapid cycling plants increased by 3–7% for each 1° temperature increase. We performed genome-wide association studies (GWAS) to identify the underlying genetic basis of thermal sensitivity. GWAS identified five main-effect quantitative trait loci (QTL) controlling flowering time and another five QTL with thermal sensitivity. Candidate genes include known flowering loci; a cochaperone that interacts with heat-shock protein 90; and a flowering hormone, gibberellic acid, a biosynthetic enzyme. The identified genetic architecture allowed accurate prediction of flowering phenotypes (R² > 0.95) that has application for genomic selection of adaptive genotypes for future environments. This work may serve as a reference for breeding and conservation genetic studies under changing environments.     

Location of Homologous DNA Sequences Interspersed at Five Regions in the Baculovirus AcMNPV Genome

An examination of Autographa californica nuclear polyhedrosis virus DNA revealed the presence of five interspersed regions, rich in EcoRI restriction sites, which shared homologous sequences. These homologous regions (hr), designated hr₁ to hr₅, occur at or near the following EcoRI fragment junctions: hr₁EcoRI-B—EcoRI-I (0.0 map units); hr₂, EcoRI-A—EcoRI-J (19.8 map units); hr₃, EcoRI-C—EcoRI-G (52.9 map units); hr₄, EcoRI-Q—EcoRI-L (69.8 map units); and hr₅, EcoRI-S—EcoRI-X (88.0 map units). Four of these regions were identified, by cross-blot hybridization of HindIII-restricted A. californica nuclear polyhedrosis virus DNA, to be within the HindIII-A/B, -F, -L, and -Q fragments. The location of these regions and the identification of a fifth homologous region were confirmed, and their characterization was facilitated, by using two plasmids with HindIII-L or -Q fragment insertions, which contained the homologous regions hr₂ and hr₅, respectively. The sizes of the homologous regions were about 800 base pairs for hr₂, 500 base pairs for hr₅, and less than 500 base pairs for hr₁, hr₃, and hr₄. A set of small EcoRI fragments (EcoRI minifragments) which ranged in size from 225 to 73 base pairs were detected in A. californica nuclear polyhedrosis virus DNA and HindIII-L and -Q fragments by polyacrylamide gel analysis. Some of the minifragments in viral DNA were present in extramolar amounts and corresponded in size to some of the minifragments present in HindIII-L and -Q. Clones of some of the EcoRI minifragments were used as probes in hybridizations to digests of viral DNA and of HindIII-L and -Q. The hybridization data, obtained under various levels of stringency, suggested that there was a degree of mismatching between the sequences which were responsible for the homology.     

Allergens Induce the Release of Lactoferrin by Neutrophils from Asthmatic Patients

BackgroundDespite the evidence that Lactoferrin (Lf) is involved in allergic asthma processes, it is unknown whether neutrophils can be one of the main cellular sources of this key inflammatory mediator directly in response of an IgE mediated stimulus. The present study was undertaken to analyze this question.MethodsNeutrophils from healthy subjects (n = 34) and neutrophils from allergic asthmatic patients (n = 102) were challenged in vitro with specific allergens to which the patients were sensitized, PAF, or agonist mAbs against IgE-receptors, and the levels of Lf were measured in the culture supernatant. The levels of serum IgE together with the severity of symptoms were also analyzed.ResultsLf was released into the culture supernatant of neutrophils from allergic asthmatic patients in response to allergens and PAF. This response was highly allergen-specific, and did not happen in neutrophils from healthy donors. Allergen effect was mimicked by Abs against FcεRI and galectin-3 but not by FcεRII. The levels of released Lf correlated well with the levels of serum specific IgE and severity of asthma symptoms. These observations represent a novel view of neutrophils as an important source of Lf in allergic asthma. Importantly, the levels of released Lf by neutrophils could therefore be used to evaluate disease severity in allergic asthmatic patients.     

Photoperiodic and genetic control of carbon partitioning in peas and its relationship to apical senescence

Apical senescence but not flower initiation is delayed by short days (SD) compared to long days (LD) in pea plants (Pisum sativum L.) of genotype E Sn Hr. We recently reported that delay of senescence correlated with slower reproductive development, suggesting that fruits are weaker sinks for assimilates under delayed senescence conditions. Thus, we have examined assimilate partitioning in peas to determine if genotype and photoperiod regulate relative sink strength. Assimilate diversion by developing fruit has been implicated in senescence induction. A greater percentage of leaf-exported ¹⁴C was transported to fruits and a smaller percentage to the apical bud of G2 peas (genotype E Sn Hr) in LD than in SD. Relatively more of the ¹⁴C delivered to the apical bud of G2 peas was transported to flower buds than to young leaves in LD as compared to SD. There was no striking photoperiodic difference in carbon partitioning in genetic lines without the Sn Hr allele combination. The Sn Hr allele combination and photoperiod may regulate the relative strength of reproductive and vegetative sinks. Photoperiodic differences in sink strength early in reproduction suggest that these genes regulate sink strength by affecting the physiology of the whole plant. High vegetative sink strength in SD may maintain assimilate supply to the apical bud, delaying senescence.     

Flowering in Pisum: A Sixth Locus, Dne

A sixth major flowering gene, dne, is identified in the gardenpea (Pisum salivum L.). Linkage tests show dne is located onchromosome 3 near locus st. The ability to respond to photoperioddepends on the joint presence of the dominant genes Sn and Dnewhich together confer a long day habit. Genotypes Sn dne, snDne and sn dne are all essentially day-neutral although by examiningseveral flowering criteria under strictly controlled conditionssome small responses could be demonstrated. Like sn, dne reducedthe response to vernalization when substituted into genotypeSn Dne. It is suggested genes Sn and Dne both control steps in a biosyntheticpathway which leads to the production of a graft-transmissibleinhibitor of flowering and apical senescence. Stocks of genotypeSn dne and sn Dne promoted flowering in Sn Dne scions whileSn Dne stocks delayed flowering in Sn dne (and sn Dne) scions.However, reciprocal grafting between genotypes Sn dne and snDne gave no evidence of physiological complementarity correspondingto the genetic complementarity ofSn and Dne. Initial resultssuggest dne may be less effective than sn at blocking inhibitorproduction but this requires confirmation.     

Tropical Plant Extracts Modulating the Growth of Mycobacterium ulcerans

Mycobacterium ulcerans, the etiologic agent of Buruli ulcer, has been detected on aquatic plants in endemic tropical regions. Here, we tested the effect of several tropical plant extracts on the growth of M. ulcerans and the closely related Mycobacterium marinum. M. ulcerans and M. marinum were inoculated on Middlebrook 7H11 medium with and without extracts from tropical aquatic plants, including Ammannia gracilis, Crinum calamistratum, Echinodorus africanus, Vallisneria nana and Vallisneria torta. Delay of detection of the first colony and the number of colonies at day 7 (M. marinum) or day 16 (M. ulcerans) were used as endpoints. The first M. ulcerans colonies were detected at 8 ± 0 days on control Middlebrook 7H11 medium, 6.34 ± 0.75 days on A. gracilis-enriched medium (p<0.01), 6 ± 1 days on E. africanus- and V. torta-enriched media (p<0.01), 6 ± 0 days on V. nana-enriched medium (p<0.01) and 5.67 ± 0.47 days on C. calamistratum-enriched medium (p<0.01). Furthermore, the number of detected colonies was significantly increased in C. calamistratum- and E. africanus-enriched media at each time point compared to Middlebrook 7H11 (p<0.05). V. nana- and V. torta-enriched media significantly increased the number of detected colonies starting from day 6 and day 10, respectively (p<0.001). At the opposite, A. gracilis-enriched medium significantly decreased the number of detected colonies starting from day 8 PI (p<0.05). In conclusion, some aquatic plant extracts, could be added as adjuvants to the Middlebrook 7H11 medium for the culturing of M. marinum and M. ulcerans.