共查询到20条相似文献,搜索用时 31 毫秒
1.
A 46,XY female patient with streak gonads and a large deletion of Yp is described. The deletion included the Y chromosomal genes SRY, ZFY, and RPS4Y. The patient did not display any Turner stigmata, such as webbing of the neck, cardiac or other abnormalities. The findings argue against an important role of RPS4Y in the prevention of Turner stigmata in males and are consistent with a role of SRY in testis differentiation in humans. 相似文献
2.
A case of deletion of the proximal one-fourth of chromosome 3 long arm is described. While the Turner syndrome phenotype was present neonatally, the patient has no structural or numerical abnormality of the sex chromosomes, and thus may represent an autosomal deletion with a clinical picture similar to Turner syndrome. Her score on the Noonan syndrome index of Duncan et al. (1981) is 27%, making Noonan syndrome unlikely. 相似文献
3.
A case of a 46,XYp- phenotypic female provided an opportunity to evaluate both sexual and somatic determinants for the Y chromosome. The patient had multiple stigmata of Turner syndrome, but normal stature. Laparotomy revealed a normal uterus and tubes, with 1.5 cm undifferentiated gonads. Serological tests for H-Y antigen (ostensibly the product of Y-chromosomal testis-determining genes) indicated absence of the H-Y+ phenotype normally associated with the intact Y chromosome. We conclude that genes exist on the short arm of the human Y chromosome which both suppress some of the somatic stigmata of Turner syndrome and determine normal expression of H-Y antigen and testicular differentiation of the primitive gonad. Our data are consistent with the view that H-Y genes comprise a family of testis-determinants, and that loss of a critical moiety is inconsistent with normal development of the male gonad. 相似文献
4.
BACKGROUND/AIMS: Leri-Weill dyschondrosteosis (LWD), a mesomelic short stature syndrome with Madelung deformity, was recently reported to be caused by SHOX (short stature homeobox-containing gene) haploinsufficiency. The loss of SHOX on Xp22.32, also called PHOG (pseudoautosomal homeobox-containing osteogenic gene), through structural aberrations of the X chromosome was also implicated in the short stature phenotype and some additional stigmata of Turner syndrome. The aim of this study was to systematically examine left-hand radiographs from Turner girls for the presence of signs of LWD. METHODS: We retrospectively studied 168 left-hand radiographs from 54 patients with Turner syndrome (bone age >10.5 years) who were treated with rhGH and seen during the last 10 years in our clinic. For comparison, we analyzed 7 radiographs from 5 patients with LWD and 52 radiographs from 20 patients with GH deficiency. The shape of the distal radial epiphysis (triangularisation index = TI) and the carpal angle were quantitatively measured. In addition, we screened for the presence of a premature cleft fusion or an ulnar deviation of the articular surface of the distal radial epiphysis and for fourth metacarpal shortening. One of 54 Turner girls (2%) was affected with LWD and presented with Madelung deformity. RESULTS: No milder forms of Madelung deformity were detected. However, there was a significant trend to a triangular shape of the distal radial epiphysis in Turner syndrome: the median TI was 2.7 in normal controls (range 1.8-3.7), 3.1 in Turner girls (range 2.0-6.3) (p < 0.001 against controls), and 6.0 in patients with LWD (range 3.5-11.0) (p < 0.001 against controls). CONCLUSIONS: The triangularisation index did not correlate with the carpal angle (median 122.5 Copyright 2001 S. Karger AG, Basel 相似文献
5.
We report a Turner patient aged 22 years with a 45,X/46,X,del(X)(q23) karyotype. Late replication studies showed preferential inactivation of the deleted X chromosome; FISH studies with a probe for total human telomeres showed hybridisation signal in the telomeres on both the normal and the deleted X chromosomes. Microsatellite analysis in the proposita and her family permitted us to conclude to the maternal origin of the deleted X chromosome, and to detect using the marker DXS1106 (Xq22) a probable meiotic recombination event above the breakage point suggesting that the deletion occurred underneath this point.The mild Turner stigmata may be explained by the 45,X cell line, and the gonadal dysgenesis probably by a partial deletion of the gonadal dysgenesis region Xq13-q23 (excluding Xq22). 相似文献
6.
We report a rare association of Turner syndrome with both Neurofibromatosis type I and Tuberous Sclerosis. The patient had XOkaryotype with Turners stigmata and also had features of Neurofibromatosis 1 in the form of significant café-au-lait spots and Plexiform neurofibroma along with typical features of Tuberous Sclerosis complex. Pedigree analysis revealed that the elder brother of the proband in the family also suffered from Tuberous Sclerosis without the manifestation of Neurofibromatosis or any other genetic disorders. We hypothesize that these associations could be due to new independent mutations and also increased maternal and paternal age in a pre-disposition of Turner syndrome. 相似文献
7.
We report the results of a molecular investigation of 25 patients who had Turner syndrome and who had previously been subject
to analysis using cytogenetic techniques. When in situ hybridization and polymerase chain reaction (PCR) techniques were applied,
a larger number of mosaic individuals were observed than were detected by cytogenetic methods. This was mainly because of
the presence of the cell line 46,XX. The most frequent mosaics were 45,X/46,XX (36%); the presence of isochromosomes comprised
24% and fragments 12%. The patients who had been previously diagnosed with mosaicism displayed a higher complexity in their
karyotypes because of the presence of new cellular lines. The isodicentric X chromosome for the long arm, idic(Xq), gave rise
to complex mosaics of up to nine cell lines. The application of fluorescence in situ hybridization and PCR led to a clearer
definition of alterations at the centromeric level and the identification of the nature of chromosome fragments.
Received: 2 August 1995 / Revised: 5 February 1996 相似文献
8.
INTRODUCTION: The most frequent physical features associated with Turner syndrome is short stature. The main goal of the research was to estimate the height of women with Turner syndrome and to analyze the correlation between their height and their sisters and parents height. MATERIAL AND METHODS: The research was based on the 176 women with Turner syndrome (number of parents = 176; number of sisters = 122). The data was collected from 1995 to 2002 in Out-patient Clinic for Women with Turner's Syndrome in Bytom. RESULTS: Average height in the group of women non treated with growth hormone and anabolic drugs was 144.1 +/- 6.8 cm (n = 105), mothers average height: 162 +/- 5.3 cm, fathers average height: 172.4 +/- 6.1 cm, sisters: 164.9 +/- 5.2 cm (n = 79). The height of women with karyotype 45,X was slightly shorter: 143.1 +/- 6.9 cm, while the height of the family have remained unchanged. Contrary to all untreated women with Turner syndrome where the height was correlated with the mothers and fathers height (pearson's r = 0.32 and 0.34 respectively), sisters height was correlated mainly with fathers height (pearson's r = 0.47 and 0.34 respectively). In the group with karyotype 45,X patients' height was correlated mainly with mothers height (r = 0.55). In this group sisters height is correlated stronger with fathers' height (r = 0.45) than with mothers' height (r = 0.35). CONCLUSIONS: 1. The height of non treated women with Turner syndrome is correlated with both parents height while the height of sisters is correlated mainly with fathers. 2. The height of Turner syndrome women with karyotype 45,X is correlated with their mothers height. 相似文献
9.
In this report we describe a female neonate with 12p interstitial deletion (karyotype: 46,XX,del(12)(pter----p13.1::p11.2----cen----qter). In addition to severe psychomotor retardation, facial dysmorphism and Turner like stigmata, she presented marked hypoplasia of the external genitalia and right heart hypoplasia. Study of LDH activity showed a marked decrease of LDHB activity contrasting with an elevated LDHA. 相似文献
10.
BACKGROUNDS/AIMS: Turner syndrome is not usually associated with thrombotic events. The aim of this study is to report 3 Turner syndrome patients with portal vein thrombosis and, in 2 of them, high factor VIII. These findings are compared to values in Turner syndrome patients without thrombosis and controls. METHODS: In different years, 3 patients with Turner syndrome were initially seen at the Gastroenterology Clinic of Hospital de Clínicas de Porto Alegre, Brazil, for portal vein thrombosis. After the most common causes of portal vein thrombosis and thrombophilias had been excluded, the 2 surviving patients were studied for clotting factors VIII, IX and von Willebrand factor. The same factors were also assessed in 25 Turner syndrome patients without thrombosis and 25 normal girls. RESULTS: One of the patients with portal vein thrombosis died before the study. In the 2 surviving patients, factors VIII and von Willebrand levels were >150 IU/dl, which is considered to be high. In Turner syndrome patients without thrombosis, the mean factor VIII level was 127.2 +/- 41.1 IU/dl and for von Willebrand factor 101.2 +/- 26.9 IU/dl, while in control girls these were 116.0 +/- 27.6 and 94.28 +/- 27.5 IU/dl, respectively. Factor VIII and von Willebrand factor were not different between these 2 groups. When non-O blood group Turner syndrome patients and normal girls were compared, the former had significantly higher levels of factor VIII. CONCLUSIONS: This is the first report on the unusual finding of portal thrombosis in patients with Turner syndrome in whom high levels of factor VIII and von Willebrand factor were found. Factor VIII is higher in the non-O blood group Turner syndrome patients without thrombosis when compared to normal girls. 相似文献
11.
Summary A large submetacentric and late-replicating X chromosome in a patient with Turner stigmata was identified as pericentric inversion of an isochromosome of the long arm by means of the G-banding pattern. 相似文献
12.
Turner syndrome is the complex human phenotype associated with complete or partial monosomy X. Principle features of Turner syndrome include short stature, ovarian failure, and a variety of other anatomic and physiological abnormalities, such as webbed neck, lymphedema, cardiovascular and renal anomalies, hypertension, and autoimmune thyroid disease. We studied 28 apparently nonmosaic subjects with partial deletions of Xp, in order to map loci responsible for various components of the Turner syndrome phenotype. Subjects were carefully evaluated for the presence or absence of Turner syndrome features, and their deletions were mapped by FISH with a panel of Xp markers. Using a statistical method to examine genotype/phenotype correlations, we mapped one or more Turner syndrome traits to a critical region in Xp11.2-p22.1. These traits included short stature, ovarian failure, high-arched palate, and autoimmune thyroid disease. The results are useful for genetic counseling of individuals with partial monosomy X. Study of additional subjects should refine the localization of Turner syndrome loci and provide a rational basis for exploration of candidate genes. 相似文献
13.
BACKGROUND: A female fetus with massive truncal-limb hydrops and large, loculated, nuchal hygromas in midgestation is highly likely to have Turner syndrome. This phenotype is recognized to be usually lethal, with only more mildly affected fetuses surviving to term birth. METHODS: The morphology and morphometrics of 117 midgestation fetuses with phenotypic Turner syndrome were analyzed. RESULTS: More than 90% of fetuses with phenotypic Turner syndrome were found to have heart weights below the 2.5 centile, as well as lung hypoplasia and restricted limb growth for brain weight standards, although brain weight was only mildly reduced for gestational age. In contrast, subnormal heart weight was much less common among fetuses with other etiologies of hydrops, hygromas, or pleural effusions. CONCLUSIONS: We hypothesize that myocardial hypoplasia is a primary defect in Turner syndrome, and it leads to or is a major contributor to the phenotypic features that end in midgestational death. 相似文献
14.
The objective of this study was to test a device developed to improve the functionality, accuracy and precision of the original
technique for sweating rate measurements proposed by Schleger and Turner [Schleger AV, Turner HG ( 1965) Aust J Agric Res 16:92–106]. A device was built for this purpose and tested against the original Schleger and Turner technique.
Testing was performed by measuring sweating rates in an experiment involving six Mertolenga heifers subjected to four different
thermal levels in a climatic chamber. The device exhibited no functional problems and the results obtained with its use were
more consistent than with the Schleger and Turner technique. There was no difference in the reproducibility of the two techniques
(same accuracy), but measurements performed with the new device had lower repeatability, corresponding to lower variability
and, consequently, to higher precision. When utilizing this device, there is no need for physical contact between the operator
and the animal to maintain the filter paper discs in position. This has important advantages: the animals stay quieter, and
several animals can be evaluated simultaneously. This is a major advantage because it allows more measurements to be taken
in a given period of time, increasing the precision of the observations and diminishing the error associated with temporal
hiatus (e.g., the solar angle during field studies). The new device has higher functional versatility when taking measurements
in large-scale studies (many animals) under field conditions. The results obtained in this study suggest that the technique
using the device presented here could represent an advantageous alternative to the original technique described by Schleger
and Turner. 相似文献
15.
In this report we describe two adult male patients with a chromosomal rearrangement involving the short arm of chromosome 18 and an acrocentric chromosome. In addition to moderate mental retardation and verbal disability they presented dysmorphic stigmata similar to those found in the Noonan syndrome. 相似文献
16.
A female of 20 years of age with short stature, gonadal dysgenesis and Turner stigmata with a de novo dup Xq22-q23 was studied. The maternal cytogenetic study was normal. This case represents the smallest Xq duplication in an abnormal female. We discuss the possibility of a maternal imprinting. 相似文献
17.
Introduction. The moss Dicranum scottianum Turner, described based on material collected in Ireland by Robert Scott, is currently known from Europe and Macaronesia (Canary Islands and the Azores). The previously proposed authorship of ‘Turner ex Robt. Scott’ and lectotype for this name proved to be erroneous. Methods. Over 60 herbarium specimens, including types, of D. scottianum and putative allies were examined with the aim of outlining the diagnostic features of the taxon or taxa concerned, and establishing any necessary synonymy. Key results. The true authorship of Dicranum scottianum by Turner is re-established, and the name is effectively lectotypified with extant original material from BM. The type specimen and some subsequent collections of the species are described and illustrated. New nomenclatural synonyms of D. scottianum (namely Dicranum canariense Hampe ex Müll.Hal., D. erythrodontium Hampe ex Müll.Hal. and Orthodicranum allorgei J.J.Amann & Loeske) are detailed. Conclusions. Dicranum scottianum is characterised by its asymmetrical leaves with one side of the leaf wider than the other, the difference in the angle of insertion of the lamina with respect to the costa (one side of the leaf is inserted at a 45° angle and the other is plane but widely incurved), the laminal cells that are thick-walled with quadrate or rectangular lumina (seen in cross-section), and the wide and deep costa that has two bands of stereids. 相似文献
18.
Turner syndrome is caused by haploinsufficiency of the short arm of X-chromosome, and is usually diagnosed by karyotyping. This procedure is time-consuming, expensive and unfeasible for population screening. We propose molecular detection of 45XO Turner patients based on the ability of HpaII, a methylation sensitive endonuclease, to induce the cleavage of non-methylated DNA in the active X-allele. Genomic DNA was obtained from 22 patients with Turner syndrome confirmed by karyotype (45XO, N = 18; 45XO/46XX, N = 4). After digestion, DNA was amplified with primers directed to exon 1 of the androgen receptor (AR) gene and to the GAPDH control gene. Normal control females or mosaic patients, with a second methylated X-chromosome, escaped from HpaII digestion and produced a band corresponding to AR gene amplification. 45XO patients have just one active non-methylated X-chromosome, completely digested by HpaII, thus preventing the amplification of the AR gene. Three of the 45XO cases gave amplified bands, suggesting low-frequency mosaicisms that are not detected by karyotyping. Compared to classical karyotype studies for the detection of 45XO Turner patients, this new molecular method is simpler, faster and less expensive. 相似文献
19.
This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome. 相似文献
20.
Turner syndrome, occurring in 1:2500 female births, is caused by the complete or partial absence of one X chromosome. Amniotic fluid supernatant proteins from five second trimester pregnancies with Turner syndrome fetuses and five normal ones were analyzed by 2DE, MALDI-TOF-MS, and Western blot. Serotransferin, lumican, plasma retinol-binding protein, and apolipoprotein A-I were increased in Turner syndrome, while kininogen, prothrombin, and apolipoprotein A-IV were decreased. Since differentially expressed proteins are likely to cross the placenta barrier and be detected in maternal plasma, proteomic analysis may enhance research for noninvasive prenatal diagnosis of Turner syndrome. 相似文献
|