A simple assay to amplify the electrochemical signal by the aptamer based biosensor modified with CdS hollow nanospheres

A simple method to amplify the electrochemical signal by an aptamer with 22 bases modified with CdS hollow nanospheres (CdSHNs) was described. Using the thrombin as a model, the interaction between the aptamer and CdSHNs was characterized by cyclic voltammetry, electrochemical impedance spectroscopy and circular dichroism spectroscopy. CdSHNs promoted the electron transfer between the gold electrode and K(3)[Fe(CN)(6)] and facilitated the conformation conversion of the aptamer from hairpin to G-quadruplex after the aptamer interacted with thrombin. Under optimal conditions, the modified electrode could be used for the determination of thrombin from 0 to 33 μg mL(-1) and the sensitivity was 1.34 μA mL μg(-1)cm(-2), while the linear range of the modified electrode without the immobilization of CdSHNs was from 2.75 to 27.5 μg mL(-1) and the sensitivity was 0.062 μA mL μg(-1)cm(-2). This constructed biosensor also had a good stability, specificity, reproducibility and accuracy which could provide a promising platform for fabrication of aptamer based biosensors.     

Preparation of novel cisplatin-conjugated hollow gold nanospheres for targeting cervical cancer

Cervical cancer is a deadly gynecological malignancy in need of innovative treatment strategies. Emerging preclinical data has suggested the benefits of nanocarriers over the traditional chemotherapy for cancer treatment. In particular, gold nanoparticles are gaining popularity due to gold's inert nature, limited side effects, good cytocompatibility, and flexibility in preparation/modification. We conjugated polyethylene glycol (PEG) with hollow gold nanospheres (HGNs) and loaded the pegylated HGNs with an anticancer drug, cisplatin to target cervical cancer. HGNs were irradiated with noninfrared laser to increase the penetration of drug into tumor tissue and improve the delivery of cisplatin. We investigated the comparative characterization studies of prepared cisplatin loaded pegylated HGNs (cis PEG-HGNs), free cisplatin, cisplatin loaded HGNs (cis-HGNs), cis PEG-HGNs without laser, and cis PEG-HGNs with laser and its effects over cervical cancer cells. Transmission electron microscopy photomicrographs confirmed the integrity of prepared HGNs. While no significant difference was observed between encapsulation efficiency and drug loading of cis-HGNs (84.6%) and cis PEG-HGNs (86.7%), the encapsulation efficiency increased almost twice in HGNs, compared with control gold nanoparticles (GNs) because of the hollow cavity in HGNs. In-vitro cytotoxicity was measured by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay using HeLa cells. With irradiation, HGNs induced much elevated cytotoxicity. Not only HGNs were internalized by HeLa cells, they were retained in the cellular compartment. We also tested formulations in vivo and observed that the irradiated cis-HGNs and cis PEG-HGNs were most effective in regressing tumors in mice.     

Highly sensitive gold nanoparticles biosensor chips modified with a self-assembled bilayer for detection of Con A

In this paper, an improved method for detection of Concanavalin A (Con A) with label-free optical biosensors is reported. 1-Dodecanethiol (DDT) was self-assembled onto gold nanoparticles which were deposited on glass slides, and then glycolipid molecules were inserted into dodecanethiol by physical interactions only. The recognition between Con A and carbohydrate was observed by UV-vis spectrophotometry. The absorption spectrum shifted when Con A was bound to the sugar residues of glycolipids immobilized onto nanogold slides, while almost no spectrum change was observed when another nonspecific protein molecule met the nanogold slides. The self-assembled bilayer on nanogold substrates had very high sensitivity for Con A, the minimum detection concentration of Con A can be down to 0.1 nM. In addition to the ultra sensitivity for investigating carbohydrate-lectin interaction, the self-assembled bilayer structure, is expected to replace many receptors which require time-consuming organic syntheses for the fixation to the transducer. The simplicity and sensitivity of this biosensor architecture once again show the prospect of nanogold application in biosensor.     

A novel nitrite biosensor based on the direct electron transfer of hemoglobin immobilized on CdS hollow nanospheres

A novel nitrite biosensor based on the direct electron transfer of hemoglobin (Hb) immobilized on CdS hollow nanospheres (HS-CdS) modified glassy carbon electrode was constructed. The direct electron transfer of Hb showed a pair of redox peaks with a formal potential of -286 mV (vs. SCE) in 0.1M pH 7.0 phosphate buffer solution. It was a surface-controlled electrode process involving a single proton transfer coupled with a reversible one-electron transfer for each heme group of Hb. HS-CdS had a large specific surface area and good biocompatibility and had a better electrochemical response than that of solid spherical CdS. The immobilized Hb on HS-CdS displayed an excellent response to NO(2)(-) with one irreversible electrode process for NO reduction. Under optimal conditions, the biosensor could be used for the determination of NO(2)(-) with a linear range from 0.3 to 182 microM and a detection limit of 0.08 microM at 3 sigma based on the irreversible reduction of NO. HS-CdS provided a good matrix for protein immobilization and had a promising application in constructing sensors.     

A novel surface acoustic wave-based biosensor for highly sensitive functional assays of olfactory receptors

Olfactory receptors, which are responsible for sensing odor molecules, form the largest G protein-coupled receptor (GPCR) family in mammalian animals. These proteins play an important role in the detection of chemical signals and signal transduction to the brain. Currently, only a limited number of olfactory receptors have been characterized, which is mainly due to the lack of sensitive and efficient tools for performing functional assays of these receptors. This paper describes a novel surface acoustic wave (SAW)-based biosensor for highly sensitive functional assays of olfactory receptors. An olfactory receptor of Caenorhabditis elegans, ODR-10, was expressed on the plasma membrane of human breast cancer MCF-7 cells, which was used as a model system for this study. For specific odorant response assays, the membrane fraction of MCF-7 cells containing ODR-10 was extracted and integrated with our SAW sensors. The response of ODR-10 to various odorants was monitored by recording the resonance frequency shifts of SAWs applied to the sensor. Our results show that heterologously expressed ODR-10 receptors can specifically respond to diacetyl, its natural ligand. Dose-dependent responses were obtained by performing measurements using various concentrations of diacetyl. The sensitivity of this biosensor is 2 kHz/ng and can detect concentrations as low as 10⁻¹⁰ mM, which is 10× lower than what has previously been reported. This biosensor can be used to characterize odorant response profiles of olfactory receptors and provide information rich data for functional assays of olfactory receptors. In addition to providing a greater understanding of the biological mechanisms of GPCRs, such data holds great potential in many other fields such as food industry, biomedicine, and environmental protection.     

Simultaneous immobilization of glucose oxidase on the surface and cavity of hollow gold nanospheres as labels for highly sensitive electrochemical immunoassay of tumor marker

A novel tracer, glucose oxidase (GOD)-functionalized hollow gold nanospheres encapsulating glucose oxidase (Au(shell)@GOD), was designed to label the ferrocenemonocarboxylic-grafted secondary antibodies (Fc@Ab(2)) for highly sensitive detection of tumor marker using carboxyl group functionalized multiwall carbon nanotubes as platform. Initially, Au(shell)@GOD was synthesized specially by reverse micelle approach, and then the labeling of antibody and the preparation of GOD-functionalized Au(shell)@GOD were performed by one-pot assembly of Fc@Ab(2) and GOD on the surface of Au(shell)@GOD. The ferrocene used to label antibodies acted as a mediator of electron transfer between GOD and electrode surface. The high-content glucose oxidase in the tracer (on the surface and in the cavity) could significantly amplify the amperometric signal for sandwich-type immunoassay. Using carcinoembryonic antigen (CEA) as model analyte, the designed tracer showed linear range from 0.02 to 5.0 ng mL(-1) with the detection limit down to 6.7 pg mL(-1). The assay results of serum samples with the proposed method were in an acceptable agreement with the reference values. The new protocol showed acceptable stability and reproducibility, high sensitivity, and good precision, which could provide a promising potential for clinical screening and diagnosis of tumor disease.     

A novel method to construct a third-generation biosensor: self-assembling gold nanoparticles on thiol-functionalized poly(styrene-co-acrylic acid) nanospheres

A novel method for fabrication of horseradish peroxidase (HRP) biosensor has been developed by self-assembling gold nanoparticles on thiol-functionalized poly(styrene-co-acrylic acid) (St-co-AA) nanospheres. At first, a cleaned gold electrode was immersed in thiol-functionalized poly(St-co-AA) nanosphere latex prepared by emulsifier-free emulsion polymerization of St with AA and function with dithioglycol to assemble the nanospheres, then gold nanoparticles were chemisorbed onto the thiol groups. Finally, horseradish peroxidase was immobilized on the surface of the gold nanoparticles. The sensor displayed an excellent electrocatalytical response to reduction of H2O2 without the aid of an electron mediator. The sensor was highly sensitive to hydrogen peroxide with a detection limit of 4.0 micromoll(-1), and the linear range was from 10.0 micromoll(-1) to 7.0 mmoll(-1). The biosensor retained more than 97.8% of its original activity after 60 days of use. Moreover, the studied biosensor exhibited good current repeatability and good fabrication reproducibility.     

A super highly sensitive glucose biosensor based on Au nanoparticles-AgCl@polyaniline hybrid material

Gold nanoparticles (AuNPs) with an average diameter of 5nm were assembled on the surface of silver chloride@polyaniline (PANI) core-shell nanocomposites (AgCl@PANI). Attenuated total reflection Fourier transform infrared spectroscopy (ATR-FTIR) suggested that AuNPs were incorporated on AgCl@PANI through coordination bonds instead of electrostatic interaction. The resulting AuNPs-AgCl@PANI hybrid material exhibited good electroactivity at a neutral pH environment. An amperometric glucose biosensor was developed by adsorption of glucose oxidase (GOx) on an AuNPs-AgCl@PANI modified glassy carbon (GC) electrode. AuNPs-AgCl@PANI could provide a biocompatible surface for high enzyme loading. Due to size effect, the AuNPs in the hybrid material could act as a good catalyst for both oxidation and reduction of H(2)O(2). As the measurement of glucose was based on the electrochemical detection of H(2)O(2) generated by enzyme-catalyzed-oxidation of glucose, the biosensor exhibited a super highly sensitive response to the analyte with a detection limit of 4 pM. Moreover, the biosensor showed good reproducibility and operation stability. The effects of some factors, such as temperature and pH value, were also studied.     

A novel immunochromatographic electrochemical biosensor for highly sensitive and selective detection of trichloropyridinol, a biomarker of exposure to chlorpyrifos

We present a novel portable immunochromatographic electrochemical biosensor (IEB) for simple, rapid, and sensitive biomonitoring of trichloropyridinol (TCP), a metabolite biomarker of exposure to organophosphorus insecticides. Our new approach takes the advantage of immunochromatographic test strip for a rapid competitive immunoreaction and a disposable screen-printed carbon electrode for a rapid and sensitive electrochemical analysis of captured HRP labeling. Several key experimental parameters (e.g. immunoreaction time, the amount of HRP labeled TCP, concentration of the substrate for electrochemical measurements, and the blocking agents for the nitrocellulose membrane) were optimized to achieve a high sensitivity, selectivity and stability. Under optimal conditions, the IEB has demonstrated a wide linear range (0.1-100 ng/ml) with a detection limit as low as 0.1 ng/ml TCP. Furthermore, the IEB has been successfully applied for biomonitoring of TCP in the rat plasma samples with in vivo exposure to organophosphorus insecticides like Chlorpyrifos-oxon (CPF-oxon). The IEB thus opens up new pathways for designing a simple, rapid, clinically accurate, and quantitative tool for TCP detection, as well as holds a great promise for in-field screening of metabolite biomarkers, e.g., TCP, for humans exposed to organophosphorus insecticides.     

A novel urea sensitive biosensor with extended dynamic range based on recombinant urease and ISFETs

A novel urea biosensor based on immobilised recombinant urease as sensitive element and ion sensitive field effect transistor as transducer was developed. Recombinant urease from E. coli with an increased Km was photoimmobilised in PVA/SbQ (poly(vinyl alcohol) containing styrylpyridinium) membrane and has demonstrated quite good performance as biosensitive element. Enzymatic field effect transistors based on such a bioselective element were studied in model buffer solutions. This biosensor demonstrated an extended dynamic range up to 80 mM, a quite good reproducibility (standard deviation of the sensor responses was approximately 2.5%, n= 20 for urea concentration 10 mM) and a high stability. Such characteristics fit with the analytical requirements needed for urea control in plasma and liquids used during renal dialysis.     

A novel bioluminescent bacterial biosensor using the highly specific oxidative stress-inducible pgi gene

A new oxidative stress-responsive bacterial biosensor was constructed using the promoter of the pgi gene fused to the luxCDABE reporter. This strain (PGRFM) responded in a dose-dependent manner to methyl viologen (MV), a model redox chemical that results in oxidative stress. The responses of strain PGRFM to redox chemicals was strongly dependent on the available carbon source. For example, when the strain was grown under nutrient-limited conditions in the presence of glucose or gluconate it was capable of responding to low MV concentrations (0.6-19.3ppm), whereas the same cells grown in LB (a nutrient rich media) only responded to higher concentrations (4.9-625ppm). This allowed us to select PGRFM's growth conditions and extend the range of concentrations at which a stress-inducing chemical could be detected. Further, strain PGRFM responded to structural analogs of MV (i.e., ethyl and benzyl viologen), demonstrating that this strain is responsive to the presence of superoxide radicals, regardless of the chemical by which they are generated. Strain PGRFM's response patterns to these analogs were distinct from each other, which determined their strength to induce oxidative stress. As well, a significant induction was seen when this strain was exposed to hydrogen peroxide, illustrating that strain PGRFM is responsive in the presence of both the superoxide (O(2)(-)) and hydroxyl (OH) radicals.     

Binding of Leishmania spp with gold nanoparticles supported polyethylene glycol and its application for the sensitive detection of infectious photogenes in human plasma samples: A novel biosensor

The management of pathogen detection using a rapid and cost‐effective method presents a major challenge to the biological safety of the world. The field of pathogen detection is nascent and therefore, faces a dynamic set of challenges as the field evolves. Visceral leishmaniasis (VL), or kala‐azar is the most severe form of leishmaniasis. Delay to the accurate diagnosis and treatment is likely to lead to fatality. The reliable, fast and sensitive detection is closely linked to safe and effective treatment of Leishmania spp. Despite several routine and old method for sensitive and specificity detection of Leishmania spp, there is highly demand for developing modern and powerfully system. In this study a novel ultra‐sensitive DNA‐based biosensor was prepared for detection of Leishmania spp. For the first time, the specific and thiolated sequences of the Leishmania spp genome (5′‐SH‐[CH₂]₆ ATCTCGTAAGCAGATCGCTGTGTCAC‐3′) were recognized by electrochemical methods. Also, selectivity of the proposed bioassay was examined by three sequences that were mismatched in 1, 2, and 3 nucleotides. The linear range (10^?6 to 10^?21 M) and limit of detection (LLOQ = 1 ZM) obtained are remarkable in this study. Also, simple and cost‐effective construction of genosensors was another advantage of the proposal DNA‐based assay. The experimental results promise a fast and simple method in detection of kala‐azar patients with huge potential of the nanocomposite‐based probe for development of ideal biosensors.     

Rapid and highly sensitive electrochemical determination of alkaline phosphatase using a composite tyrosinase biosensor

The use of an amperometric graphite-Teflon composite tyrosinase biosensor for the rapid monitoring of alkaline phosphatase (ALP), with no need of an incubation step and using phenyl phosphate as the substrate, is reported. Phenol generated by the action of ALP is monitored at the tyrosinase composite electrode through the electrochemical reduction of the o-quinone produced to catechol, which produces a cycle between the tyrosinase substrate and the electroactive product, giving rise to the amplification of the biosensor response and to the sensitive detection of ALP. The current was measured at -0.10 V 5 min after the addition of ALP. As a compromise between high ALP activity and high sensitivity for the detection of phenol, a pH of 8.5 was chosen. The substrate concentration was also optimized. A linear calibration plot was obtained for ALP between 2.0 x 10(-13) and 2.5 x 10(-11), with a detection limit of 6.7 x 10(-14) M. Different types of milk were analyzed with good results, using an extremely simple and rapid procedure.     

A novel nitrite biosensor based on conductometric electrode modified with cytochrome c nitrite reductase composite membrane

A conductometric biosensor for nitrite detection was developed using cytochrome c nitrite reductase (ccNiR) extracted from Desulfovibrio desulfuricans ATCC 27774 cells immobilized on a planar interdigitated electrode by cross-linking with saturated glutaraldehyde (GA) vapour in the presence of bovine serum albumin, methyl viologen (MV), Nafion, and glycerol. The configuration parameters for this biosensor, including the enzyme concentration, ccNiR/BSA ratio, MV concentration, and Nafion concentration, were optimized. Various experimental parameters, such as sodium dithionite added, working buffer solution, and temperature, were investigated with regard to their effect on the conductance response of the biosensor to nitrite. Under the optimum conditions at room temperature (about 25 degrees C), the conductometric biosensor showed a fast response to nitrite (about 10s) with a linear range of 0.2-120 microM, a sensitivity of 0.194 microS/microM [NO(2)(-)], and a detection limit of 0.05 microM. The biosensor also showed satisfactory reproducibility (relative standard deviation of 6%, n=5). The apparent Michaelis-Menten constant (K(M,app)) was 338 microM. When stored in potassium phosphate buffer (100mM, pH 7.6) at 4 degrees C, the biosensor showed good stability over 1 month. No obvious interference from other ionic species familiar in natural waters was detected. The application experiments show that the biosensor is suitable for use in real water samples.     

Sensor and biosensor based on Prussian Blue modified gold and platinum screen printed electrodes

Gold (Au) and platinum (Pt) screen-printed electrodes were modified with Prussian Blue (PB) for the development of amperometric sensors selective for hydrogen peroxide detection. The sensors exhibited sensitivities towards H(2)O(2) equal to 2 A M(-1) cm(-2) for Au and 1 A M(-1) cm(-2) for Pt electrodes. The sensors were also employed as the basis for construction of glucose biosensors through further modification with crystallised glucose oxidase immobilised in a Nafion membrane. In order to improve the operational stability of the modified electrodes a buffer solution containing tetrabutylammonium toluene-4-sulfonate was used. The long-term performance of the sensors and biosensors were evaluated by continuous monitoring of hydrogen peroxide and glucose solutions (50 microM and 1 mM, respectively) in the flow-injection mode for 10 h.     

Au nanospheres and nanorods for enzyme-free electrochemical biosensor applications

Au nanocrystals with different morphologies were prepared and used for enzyme-free electrochemical biosensor applications. To investigate the electrocatalytic properties of Au nanocrystals as a function on their morphologies, Au nanocrystals, Au nanospheres (NSs) on silica, Au NSs, and Au nanorods (NRs) with aspect ratios of 1:3 and 1:5, were coated on the screen printed electrodes and further measure the amperometric responses to hydrogen peroxide via three-electrode system. The electrodes modified with Au nanocrystals showed biosensing properties without any enzyme being attached or immobilized at their surface. The hydrogen peroxide detection limits of the biosensors with Au NSs, Au NRs (1:3), and Au NRs (1:5) were 6.48, 8.65, and 9.38 μM (S/N = 3), respectively. The biosensors with Au NSs, Au NRs (1:3), and Au NRs (1:5) showed the sensitivities of 11.13, 54.53, and 58.51 μA/mM, respectively. These results indicate that morphologies of Au nanocrystals significantly influence the sensitivity of the biosensors. In addition, the enzyme-free biosensors with Au nanocrystals were stable for 2 months. Au nanocrystal-based enzyme-free system, which is proposed in this study, can be used as a platform for various electrochemical biosensors.     

A novel nanolayer biosensor principle

A method for eliminating the mass transport limitation on biosensor surfaces is introduced. The measurement of macromolecular binding kinetics on plane surfaces is the key objective of many evanescent wave (e.g. total internal reflection fluorescence (TIRF)), and surface plasmon resonance (SPR) based biosensor systems, allowing the determination of binding constants within minutes or hours. However, these methods are limited in not being rigorously applicable to large macromolecules like proteins or DNA, since the on-rates are transport limited due to a Nernst diffusion layer of 5-10 microm thickness. Thus, for the binding of fibrinogen (340 kDa) to a surface current SPR biosensors will show a mass transport coefficient of ca. 2 x 10(-6) m/s. In a novel approach with an immiscible fluid vesicle (e.g. air bubble), it has been possible to generate nanoscopic fluid films of ca. 200 nm thickness on the sensor surface of an interfacial TIRF rheometer system. The thickness of the liquid film can be can be easily probed and measured by evanescent wave technology. This nanofilm technique increases the mass transport coefficient for fibrinogen to ca. 1 x 10(-4) m/s eliminating the mass transport limitation, making the binding rates reaction-rate limited. From the resulting exponential kinetic functions, lasting only 20-30s, the kinetic constants for the binding reaction can easily be extracted and the binding constants calculated. As a possible mechanism for the air bubble effect it is suggested that the aqueous fluid flow in the rheometer cell is separated by the air bubble below the level of the Nernst boundary layer into two independent laminar fluid flows of differing velocity: (i) a slow to stationary nanostream ca. 200 nm thick strongly adhering to the surface; and (ii) the bulk fluid streaming over it at a much higher rate in the wake of the air bubble. Surprising properties of the nanofluidic film are: (i) its long persistence for at least 30-60s after the air bubble has passed (2.5s); and (ii) the absence of solute depletion. It is suggested that a new liquid-liquid interface (i.e. a "vortex sheet") between the two fluid flows plays a decisive role, lending metastability to the nanofluidic film and replenishing its protein concentration via the vortices-thus upholding exponential binding kinetics. Finally, the system relaxes via turbulent reattachment of the two fluid flows to the original velocity profile. It is concluded that this technique opens a fundamentally novel approach to the construction of macromolecular biosensors.     

Electrochemical synthesis of gold nanostructure modified electrode and its development in electrochemical DNA biosensor

In this article, gold nanostructure modified electrodes were achieved by a simple one-step electrodeposition method. The morphologies of modified electrodes could be easily controlled by changing the pH of HAuCl₄ solution. The novel nanoflower-like particles with the nanoplates as the building blocks could be interestingly obtained at pH 5.0. The gold nanoflower modified electrodes were then used for the fabrication of electrochemical DNA biosensor. The DNA biosensor fabrication process was characterized by cyclic voltammetry and electrochemical impedance spectroscopy with the use of ferricyanide as an electrochemical redox indicator. The DNA immobilization and hybridization on gold nanoflower modified electrode was studied with the use of [Ru(NH₃)₆]³⁺ as a hybridization indicator. The electrochemical DNA biosensor shows a good selectivity and sensitivity toward the detection of target DNA. A detection limit of 1 pM toward target DNA could be obtained.     

A sensitive NADH and glucose biosensor tuned by visible light based on thionine bridged carbon nanotubes and gold nanoparticles multilayer

A NADH and glucose biosensor based on thionine cross-linked multiwalled carbon nanotubes (MWNTs) and Au nanoparticles (Au NPs) multilayer functionalized indium-doped tin oxide (ITO) electrode were presented in this paper. The effect of light irradiation on the enhancement of bioelectrocatalytic processes of the biocatalytic systems by the photovoltaic effect was investigated. This bioelectrode exhibited excellent catalytic activity of the oxidation towards dihydronicotinamide adenine dinucleotide (NADH). Most interesting, the performance of this NADH sensor could be tuned by the visible light. When the biosensor was performed in the dark, the anodic current increased linearly with NADH concentration over the range from 0.5 to 237 microM with detection limit 0.1 microM and sensitivity 17 nA microM(-1). The sensitivity became 115 nA microM(-1) with detection limit 0.05 microM with the light irradiation. Compared with the reaction in dark, the sensitivity increased around 7 folds while the detection limit decreased 2 folds. The glucose biosensor also exhibited the same behavior. The linear range was from 10 microM to 2.56 mM with the sensitivity of 7.8 microAmM(-1) and detection limit 5.0 microM in the dark. After the light irradiation, the linear range was from 1 microM to 3.25 mM with the sensitivity of 18.5 microA mM(-1) and detection limit 0.7 microM. It indicated a potential to provide an operational access to develop new kinds of photocontrolled dehydrogenase enzyme-based bioelectronics.