14-3-3sigma is a p37 AUF1-binding protein that facilitates AUF1 transport and AU-rich mRNA decay

Short-lived cytokine mRNAs contain an AU-rich destabilizing element (ARE). AUF1 proteins bind the ARE, undergo shuttling, and promote cytoplasmic ARE-mRNA decay through a poorly understood mechanism. We therefore identified AUF1-interacting proteins that may play a role in ARE-mRNA decay. We used mass-spectrometry to identify 14-3-3sigma protein as an AUF1-interacting protein. 14-3-3sigma binds selectively and strongly to p37 AUF1 and to a lesser extent to the p40 isoform, the two isoforms most strongly associated with ARE-mRNA decay, but not to the two larger isoforms, p42 and p45. The 14-3-3sigma interaction site on p37 was mapped to a region found only in the two smaller AUF1 isoforms and which overlaps a putative nuclear localization signal (NLS). Stable overexpression of 14-3-3sigma significantly increased cytoplasmic accumulation of p37 AUF1 and reduced the steady-state level and half-life of a reporter ARE-mRNA. siRNA silencing of AUF1 eliminated the effect of 14-3-3sigma overexpression. 14-3-3sigma therefore binds to p37 AUF1, retains it in the cytoplasm probably by masking its NLS, and enhances rapid turnover of ARE-mRNAs.     

Differential stability of thymidylate synthase 3'-untranslated region polymorphic variants regulated by AUF1

A 6-nucleotide insertion (I)/deletion (D) polymorphism in the 3'-untranslated region of the thymidylate synthase gene was shown to influence mRNA stability, but the molecular basis of this effect has not been elucidated. Here, studies of both endogenous and ectopically expressed thymidylate synthase alleles revealed that the mRNA-binding, decay-promoting protein AUF1 has higher affinity for allele D mRNA. AUF1 overexpression preferentially suppressed D allele mRNA levels, whereas AUF1 silencing selectively elevated D allele mRNA levels. Our results illustrate the functional consequences of ribonucleoprotein associations involving a polymorphic RNA sequence and uncover a novel mechanism of action for non-coding RNA polymorphisms.     

Amastin mRNA abundance in Trypanosoma cruzi is controlled by a 3'-untranslated region position-dependent cis-element and an untranslated region-binding protein

The genome of Trypanosoma cruzi contains tandem arrays of alternating genes encoding amastin and tuzin. Amastin is a surface glycoprotein abundantly expressed on the intracellular mammalian amastigote form of the protozoan parasite, and tuzin is a G-like protein. We demonstrated previously that the amastin-tuzin gene cluster is polycistronically transcribed to an equal extent in all parasite life cycle stages. The steady state level of amastin mRNA, however, is 68-fold more abundant in amastigotes than in epimastigotes. Here we show that the half-life of amastin mRNA is 7 times longer in amastigotes than in epimastigotes. Linker replacement experiments demonstrate that the middle one-third of the 630-nucleotide 3'-untranslated region (UTR) is responsible for the amastin mRNA up-regulation. This positive effect is dependent on the distance of the 3'-UTR segment from the stop codon and the polyadenylation site as well as on its orientation. A protein or protein complex more abundant in amastigotes than in epimastigotes binds to this minimally defined 3'-UTR segment and may be involved in its regulatory function.     

Identification of AUF1 (heterogeneous nuclear ribonucleoprotein D) as a component of the alpha-globin mRNA stability complex.

mRNA turnover is an important regulatory component of gene expression and is significantly influenced by ribonucleoprotein (RNP) complexes which form on the mRNA. Studies of human alpha-globin mRNA stability have identified a specific RNP complex (alpha-complex) which forms on the 3' untranslated region (3'UTR) of the mRNA and appears to regulate the erythrocyte-specific accumulation of alpha-globin mRNA. One of the protein activities in this multiprotein complex is a poly(C)-binding activity which consists of two proteins, alphaCP1 and alphaCP2. Neither of these proteins, individually or as a pair, can bind the alpha-globin 3'UTR unless they are complexed with the remaining non-poly(C) binding proteins of the alpha-complex. With the yeast two-hybrid screen, a second alpha-complex protein was identified. This protein is a member of the previously identified A+U-rich (ARE) binding/degradation factor (AUF1) family of proteins, which are also known as the heterogeneous nuclear RNP (hnRNP) D proteins. We refer to these proteins as AUF1/hnRNP-D. Thus, a protein implicated in ARE-mediated mRNA decay is also an integral component of the mRNA stabilizing alpha-complex. The interaction of AUF1/hnRNP-D is more efficient with alphaCP1 relative to alphaCP2 both in vitro and in vivo, suggesting that the alpha-complex might be dynamic rather than a fixed complex. AUF1/hnRNP-D could, therefore, be a general mRNA turnover factor involved in both stabilization and decay of mRNA.     

The protein phosphatase calcineurin determines basal parathyroid hormone gene expression

Calcium and phosphate regulate PTH mRNA stability through differences in binding of parathyroid (PT) proteins to a minimal 63-nucleotide (nt) cis-acting instability element in its 3'-untranslated region. One of these proteins is adenosine-uridine-rich binding factor (AUF1), whose levels are not regulated in PT extracts from rats fed the different diets. However, two-dimensional gels showed posttranslational modification of AUF1 that included phosphorylation. There is no PT cell line, but in HEK 293 cells the 63-nt element is recognized as an instability element, and RNA interference for AUF1 decreased human PTH secretion in cotransfection experiments. Stably transfected cells with a chimeric GH gene containing the PTH 63-nt cis-acting element were used to study the signal transduction pathway that regulates AUF1 modification and chimeric gene mRNA stability. Cyclosporine A, the calcineurin inhibitor, regulated AUF1 posttranslationally, and this correlated with an increase in the stability of GH-PTH 63-nt mRNA but not of the control GH mRNA. Mice with genetic deletion of the calcineurin Abeta gene had markedly increased PTH mRNA levels that were still regulated by low calcium and phosphorus diets. Therefore, calcineurin regulates AUF1 posttranslationally in vitro and PTH gene expression in vivo but still allows its physiological regulation by calcium and phosphate.     

Identification and characterization of proteins that selectively interact with isoforms of the mRNA binding protein AUF1 (hnRNP D)

The mRNAs that encode certain cytokines and proto-oncogenes frequently contain a typical AU-rich motif that is located in their 3'-untranslated region. The protein AUF1 is the first factor identified that binds to AU-rich regions and mediates the fast degradation of the target mRNAs. AUF1 exists as four different isoforms (p37, p40, p42 and p45) that are generated by alternative splicing. The fact that AUF1 does not degrade mRNA itself had led to the suggestion that other AUF1 interacting proteins might be involved in the process of selective mRNA degradation. Here we used the yeast two-hybrid system in order to identify proteins that bind to AUF1. We detected AUF1 itself, as well as the ubiquitin-conjugating enzyme E2I and three RNA binding proteins: NSEP-1, NSAP-1 and IMP-2, as AUF1 interacting proteins. We confirmed all interactions in vitro and mapped the protein domains that are involved in the interaction with AUF1. Gel-shift assays with the recombinant purified proteins suggest that the interacting proteins and AUF1 can bind simultaneously to an AU-rich RNA oligonucleotide. Most interestingly, the AUF1 interacting protein NSEP-1 showed an endoribonuclease activity in vitro. These data suggest the possibility that the identified AUF1 interacting proteins might be involved in the regulation of mRNA stability mediated by AUF1.     

Cell death inhibiting RNA (CDIR) derived from a 3'-untranslated region binds AUF1 and heat shock protein 27

Regulators of programmed cell death were previously identified using a technical knockout genetic screen. Among the elements that inhibited interferon-gamma-induced apoptosis of HeLa cells was a 441-nucleotide fragment derived from the 3'-untranslated region (UTR) of KIAA0425, a gene of unknown function. This fragment was termed cell death inhibiting RNA (CDIR). Deletion and mutation analyses of CDIR were employed to identify the features required for its anti-apoptotic activity. Single nucleotide alterations within either copy of the duplicated U-rich motif found in the CDIR sequence abolished the anti-apoptotic activity of CDIR and altered its in vitro association with a protein complex. Further analysis of the CDIR-binding complex indicated that it contained heat shock protein 27 (Hsp27) and the regulator of mRNA turnover AUF1 (heterogeneous nuclear ribonucleoprotein D). In addition, recombinant AUF1 bound directly to CDIR. Furthermore, expression of another AUF1-binding RNA element, derived from the 3'-UTR of c-myc, inhibited apoptosis. We also demonstrate that the level and the stability of p21(waf1/Cip1/sdi1) mRNA, a target of AUF1 with anti-apoptotic activity, were increased in CDIR-transfected cells. The level of mRNA and protein of Bcl-2, another anti-apoptotic gene, containing an AUF1 binding site in its 3'-UTR was also increased in CDIR-transfected cells. Our data suggest that AUF1 regulates apoptosis by altering mRNA turnover. We propose that CDIR inhibits apoptosis by acting as a competitive inhibitor of AUF1, preventing AUF1 from binding to its targets.     

Identification of a GA-rich sequence as a protein-binding site in the 3'-untranslated region of chicken elastin mRNA with a potential role in the developmental regulation of elastin mRNA stability

Synthesis of aortic elastin peaks in the perinatal period and then is strongly down-regulated with postnatal development and growth. Decreased stability of elastin mRNA contributes to this developmental decrease in chick aortic elastin production. We have previously shown that destabilization of elastin mRNA is correlated with decreased binding of cytosolic protein(s) to a large, GC-rich region of secondary structure in the 3'-untranslated region (3'-UTR) of elastin mRNA. In this study, using gel migration shift assays, deletion constructs, and antisense competition assays, we identify a major protein-binding site in the 3'-UTR of elastin as a GA-rich sequence (UGGGGGGAGGGAGGGAGGGA), which we have designated the G3A motif. This motif is present in the 3'-UTR of elastin from several species. Binding proteins are present in both nuclear and cytoplasmic extracts, and their abundance is associated with tissues producing elastin and correlated with circumstances in which elastin mRNA is stable. These results suggest that the conserved GA-rich sequence of the elastin 3'-UTR is an important element in the regulation of stability of the elastin mRNA.     

Identification of two proteins that bind to a pyrimidine-rich sequence in the 3'-untranslated region of GAP-43 mRNA.

GAP-43 is a membrane phosphoprotein that is important for the development and plasticity of neural connections. In undifferentiated PC12 pheochromocytoma cells, GAP-43 mRNA degrades rapidly ( t = 5 h), but becomes stable when cells are treated with nerve growth factor. To identify trans- acting factors that may influence mRNA stability, we combined column chromatography and gel mobility shift assays to isolate GAP-43 mRNA binding proteins from neonatal bovine brain tissue. This resulted in the isolation of two proteins that bind specifically and competitively to a pyrimidine-rich sequence in the 3'-untranslated region of GAP-43 mRNA. Partial amino acid sequencing revealed that one of the RNA binding proteins coincides with FBP (far upstream element binding protein), previously characterized as a protein that resembles hnRNP K and which binds to a single-stranded, pyrimidine-rich DNA sequence upstream of the c -myc gene to activate its expression. The other binding protein shares sequence homology with PTB, a polypyrimidine tract binding protein implicated in RNA splicing and regulation of translation initiation. The two proteins bind to a 26 nt pyrimidine-rich sequence lying 300 nt downstream of the end of the coding region, in an area shown by others to confer instability on a reporter mRNA in transient transfection assays. We therefore propose that FBP and the PTB-like protein may compete for binding at the same site to influence the stability of GAP-43 mRNA.     

Identification and characterization of a novel RNA binding protein that associates with the 5'-untranslated region of the chloroplast psbA mRNA

Binding of proteins to chloroplast-encoded mRNAs has been shown to be an essential part of chloroplast gene expression. Four nuclear-encoded proteins (38, 47, 55, and 60 kDa) have been identified that bind to the 5'-untranslated region of the Chlamydomonas reinhardtii psbA mRNA with high affinity and specificity. We have cloned a cDNA that represents the 38 kDa protein (RB38) and show that it encodes a novel RNA binding protein that is primarily localized within the chloroplast stroma. RB38 contains four 70 amino acid repeats with a high percentage of basic amino acids, as well as an amino-terminal extension predicted to act as a chloroplast import sequence. We demonstrate that the 38 kDa precursor protein is imported into isolated chloroplasts and interacts with high specificity to uridine-rich regions within the 5'-untranslated region of the psbA mRNA. While database searches have identified hypothetical proteins from several other eukaryotic species with high sequence similarity to the deduced amino acid sequence of RB38, no proteins with homology to RB38 have been biochemically characterized. Bioinformatic analysis of the RB38 sequence, together with structure analysis using circular dichroism and protein modeling, suggests that the 70 amino acid repeats within RB38 are similar in fold to previously identified RNA binding motifs, despite limited sequence homology.     

Sequences of a hairpin structure in the 3'-untranslated region mediate regulation of human pulmonary surfactant protein B mRNA stability

The ability of pulmonary surfactant to reduce alveolar surface tension requires adequate expression of surfactant protein B (SP-B). Dexamethasone (DEX, 10(-7) M) increases human SP-B mRNA stability by a mechanism that requires a 126-nt-long segment (the 7.6S region) of the 3'-untranslated region (3'-UTR). The objective of this study was to identify sequences in the 7.6S region that mediate regulation of SP-B mRNA stability. The 7.6S region was found to be sufficient for DEX-mediated stabilization of mRNA. Sequential substitution mutagenesis of the 7.6S region indicates that a 90-nt region is required for DEX-mediated stabilization and maintenance of intrinsic stability. In this region, one 30-nt-long element (002), predicted to form a stem-loop structure, is sufficient for DEX-mediated stabilization of mRNA and intrinsic mRNA stability. Cytosolic proteins specifically bind element 002, and binding activity is unaffected whether proteins are isolated from cells incubated in the absence or presence of DEX. While loop sequences of element 002 have no role in regulation of SP-B mRNA stability, the proximal stem sequences are required for DEX-mediated stabilization and specific binding of proteins. Mutation of the sequences that comprise the proximal or distal arm of the stem negates the destabilizing activity of element 002 on intrinsic SP-B mRNA stability. These results indicate that cytosolic proteins bind a single hairpin structure that mediates intrinsic and hormonal regulation of SP-B mRNA stability via mechanisms that involve sequences of the stems of the hairpin structure.