Use of EDTA derivatization to characterize interactions between oligodeoxyribonucleoside methylphosphonates and nucleic acids

EDTA-derivatized oligonucleoside methylphosphonates were prepared and used to characterize hybridization between the oligomers and single-stranded DNA or RNA. The melting temperatures of duplexes formed between an oligodeoxyribonucleotide 35-mer and complementary methylphosphonate 12-mers were 4-12 degrees C higher than those of duplexes formed by oligodeoxyribonucleotide 12-mers as determined by spectrophotometric measurements. Derivatization of the methylphosphonate oligomers with EDTA reduced the melting temperature by 5 degrees C. Methylphosphonate oligomer-nucleic acid complexes were stabilized by base stacking interactions between the terminal bases of the two oligomers binding to adjacent binding sites on the target. In the presence of Fe2+ and DTT, the EDTA-derivatized oligomers produce hydroxyl radicals that cause degradation of the sugar-phosphate backbone of both targeted DNA and RNA. Degradation occurs specifically in the region of the oligomer binding site and is approximately 20-fold more efficient for single-stranded DNA than for RNA. In comparison to the presence of one oligomer, the extent of target degradation was increased considerably by additions of two oligomers that bind at adjacent sites on the target. For example, the extent of degradation of a single-stranded DNA 35-mer caused by two contiguously binding oligomers, one of which was derivatized by EDTA, was approximately 2 times greater than that caused by the EDTA-derivatized oligomer alone. Although EDTA-derivatized oligomers are stable for long periods of time in aqueous solution, they undergo rapid autodegradation in the presence of Fe2+ and DTT with half-lives of approximately 30 min. This autodegradation reaction renders the EDTA-derivatized oligomers unable to cause degradation of their complementary target nucleic acids.(ABSTRACT TRUNCATED AT 250 WORDS)     

Interactions of oligonucleotide analogs containing methylphosphonate internucleotide linkages and 2'-O-methylribonucleosides.

The interactions of oligonucleotide analogs, 12-mers, which contain deoxyribo- or 2'-O-methylribose sugars and methylphosphonate internucleotide linkages with complementary 12-mer DNA and RNA targets and the effect of chirality of the methylphosphonate linkage on oligomer-target interactions was studied. Oligomers containing a single Rp or Sp methylphosphonate linkage (type 1) or oligomers containing a single phosphodiester linkage at the 5'-end followed by 10 contiguous methylphosphonate linkages of random chirality (type 2) were prepared. The deoxyribo- and 2'-O-methylribo- type 1 12-mers formed stable duplexes with both the RNA and DNA as determined by UV melting experiments. The melting temperatures, Tms, of the 2'-O-methylribo-12-mer/RNA duplexes (49-53 degrees C) were higher than those of the deoxyribo-12mer/RNA duplexes (31-36 degrees C). The Tms of the duplexes formed by the Rp isomers of these oligomers were approximately 3-5 degrees C higher than those formed by the corresponding Sp isomers. The deoxyribo type 2 12-mer formed a stable duplex, Tm 34 degrees C, with the DNA target and a much less stable duplex with the RNA target, Tm < 5 degrees C. In contrast, the 2'-O-methylribo type 2 12-mer formed a stable duplex with the RNA target, Tm 20 degrees C, and a duplex of lower stability with the DNA target, Tm < 5 degrees C. These results show that the previously observed greater stability of oligo-2'-O-methylribonucleotide/RNA duplexes versus oligodeoxyribonucleotide/RNA duplexes extends to oligomers containing methylphosphonate linkages and that the configuration of the methylphosphonate linkage strongly influences the stability of the duplexes.     

Triplex formation by a psoralen-conjugated oligodeoxyribonucleotide containing the base analog 8-oxo-adenine.

Oligodeoxyribonucleotides containing thymidine and 8-oxo-2'-deoxyadenosine can form pyr.pur.pyr type triplexes with double-stranded DNA. Unlike triplexes whose third strands contain thymidine and deoxycytidine, the stability of these triplexes is independent of pH. We have prepared d-ps-TAAATAAATTTTTAT-L [I(A)], where A is 8-oxo-2'-deoxyadenosine, ps is 4'-hydroxymethyl-4,5',8- trimethylpsoralen and L is a 6-amino-2-(hydroxymethyl)hexyl linker. The oligomer is designed to interact with a homopurine sequence in the promoter region of the human gene coding for the 92 kDa form of collagenase type IV. Oligomer I(A) and oligomer I(C), which contains 2'-deoxycytidine in place of 8-oxo-2'-deoxycytidine, both form stable triplexes at pH 6.2, but only I(A) forms a stable triplex with a model duplex DNA target at pH 7.5, as determined by UV melting experiments. Triplex formation is stabilized by the presence of the psoralen group. Upon irradiation both I(A) and I(C) form photoadducts with the DNA target at pH 6.2, but only I(A) forms a photoadduct at pH 7.5. In these photoreactions oligomer I(A) appears to selectively form a photoadduct with a C in the purine-rich strand of the duplex target. Although a T residue is present in the pyrimidine-rich strand of the target at the duplex/triplex junction, essentially no adduct formation takes place with this strand, nor is interstrand cross-linking observed. The extent of photoadduct formation decreases with increasing temperature, behavior which is consistent with the UV melting curve of the triplex. A tetramethylrhodamine derivative of I(A) was prepared and found to cross-link less extensively than I(A) itself. Oligomer I(A) is completely resistant to hydrolysis when incubated for 24h in the presence of 10% fetal bovine serum at 37 degree C, although it is hydrolyzed by S1 nuclease. The properties of oligomer I(A) suggest that 8-oxo- containing oligomers may find utility as antigene oligonucleotide reagents.     

Hybridization of synthetic oligodeoxyribonucleotides to phi chi 174 DNA: the effect of single base pair mismatch.

Oligodeoxyribonucleotides complementary to the DNA of the wild type (wt) bacteriophage phi chi 174 have been synthesized by the phosphotriester method. The oligomers, 11, 14, and 17 bases long, are complementary to the region of the DNA which accounts for the am-3 point mutation. When hybridized to am-3 DNA, the oligonucleotides form duplexes with a single base pair mismatch. The thermal stability of the duplexes formed between wt and am-3 DNAs has been measured. The am-3 DNA:oligomer duplexes dissociate at a temperature about 10 degrees C lower than the corresponding wt DNA:oligomer duplexes. This dramatic decrease in thermal stability due to a single mismatch makes it possible to eliminate the formation of the mismatched duplexes by the appropriate choice of hybridization temperature. These results are discussed with respect to the use of oligonucleotides as probes for the isolation of specific cloned DNA sequences.     

Synthesis and properties of oligodeoxynucleotides containing 5-carboxy-2'-deoxycytidines

5-Carboxy-2'-deoxycytidine (dC(COO-)) was synthesized as an anion-carrier to seek a new possibility of modified oligodeoxynucleotides capable of stabilization of duplexes and triplexes. The base pairing properties of this compound were evaluated by use of ab initio calculations. These calculations suggest that the Hoogsteen-type base pair of dC(COO-)-G is less stable than that of the canonical C+-G pair and the Watson-Crick-type base pair of dC(COO-)-G is slightly more stable than the natural G-C base pair. The modified cytosine base showed a basicity similar to that of cytosine (pKa 4.2). It turned out that oligodeoxynucleotides 13mer and 14mer incorporating dC(COO-) could form duplexes with the complementary DNA oligomer, which were more stable than the unmodified duplex. In contrast, it formed a relatively unstable triplex with the target ds DNA.     

DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)     

Recognition of Double-Stranded Dna by Peptide Nucleic Acid

Abstract

Peptide nucleic acid (PNA) is an oligonucleotide mimic in which the backbone of DNA has been replaced by a pseudopeptide. We here show that there are distinct variations as to how PNA oligomers interact with double-stranded DNA depending on choice of nucleobases. Thymine-rich homopyrimidine PNA oligomers recognise double-stranded polynucleotides by forming PNA₂-DNA triplexes with the DNA purine strand. By contrast, cytosine-rich homopyrimidine PNAs add to double-stranded polynucleotides as Hoogsteen strands, forming PNA-DNA₂ triplexes, while homopurine, or alternating thymine-guanine, PNA oligomers invade DNA to form PNA-DNA duplexes.     

"Paper-clip" type triple helix formation by 5'-d-(TC)3Ta(CT)3Cb(AG)3 (a and b = 0-4) as a function of loop size with and without the pseudoisocytosine base in the Hoogsteen strand

The formation of a DNA "paper-clip" type triple helix (triplex) with a common sequence 5'-d-(TC)(3)T(a)()(CT)(3)C(b)()(AG)(3) (a and b = 0-4) was studied by UV thermal melting experiments and CD spectra. These DNA oligomers form triplexes and duplexes under slightly acidic and neutral conditions, respectively. The stability of the formed triplexes (at pH 4.5) or duplexes (at pH 7.0 or 8.0) does not vary significantly with the size of the loops (a and b = 1-4). At pH 6.0, the triplex stability is, however, a function of a and b. It is also interesting to note that the oligomer 5'-d-(TC)(3)(CT)(3)(AG)(3) (a and b = 0) forms a stable triplex at pH 4.5 with a slightly lower T(m) value, due to dissociation of a base triad at one end and a distorted base triad at the other, observed by (1)H NMR. Thus, we have here a model system, 5'-d-(TC)(3)T(a)(CT)(3)C(b)(AG)(3), that could form a triplex effectively with (a and b = 1-4) and without (a and b = 0) loops under acidic conditions. In addition, the triplex formation of oligomers with replacement of one, two, or three 2'-deoxycytidine in the Hoogsteen strand by either 2'-deoxypseudoisocytidine (D) or 2'-O-methylpseudoisocytidine (M) was also studied in the sequence 5'-d-(TX)(3)T(2)(CT)(3)C(2)(AG)(3) (where X is C, D, or M). Both CD spectra and UV melting results showed that only D3 [(TX)(3) = (TD)(3)] and M3 [(TX)(3) = (TM)(3)] were able to form the paper-clip structure under both neutral and acidic conditions. This is because the N(3)H of a pseudoisocytosine base can serve as a proton donor without protonation. We hereby proved that the 2'-deoxypseudoisocytidine, similar to 2'-O-methylpseudoisocytidine, could replace 2'-deoxycytidine in the Hoogsteen strand to provide triplex formation at neutral pH.     

A psoralen-conjugated triplex-forming oligodeoxyribonucleotide containing alternating methylphosphonate-phosphodiester linkages: synthesis and interactions with DNA.

A psoralen-conjugated oligodeoxyribopyrimidine (1443), PS-pTTTTCTTTTCTTCTT, where PS is trimethylpsoralen and C is 5-methyl-2'-deoxycytidine, that contains alternating methylphosphonate-phosphodiester internucleotide linkages was synthesized. The ability of 1443 to form triple-stranded complexes with a purine tract in a synthetic DNA duplex was studied. Irradiation of solutions containing the DNA target and 10 microM 1443 or 0.25 microM of a similar psoralen-conjugated oligodeoxyribonucleotide that contained all phosphodiester linkages, (1193), with long-wavelength UV light resulted in approximately 80% formation of interstrand cross-links at pH 7.0, 37 degrees C, in the presence of 20 mM magnesium chloride. The extent of triplex formation as monitored by photo-cross-linking decreased over the pH range 5.5-8.0, and the apparent pK of the 5-methylcytosines (C) in 1443 was approximately one-half of a pH unit less than that of the 5-methylcytosines in 1193. Oligomer 1443 formed triplexes in the absence of magnesium, and maximum triplex formation was observed in solutions containing 2.5 mM magnesium, whereas maximal triplex formation by the fully charged 1193 was not observed until the magnesium concentration was 10 mM or higher. Unlike the all-phosphodiester backbone of 1193, the alternating methylphosphonate-phosphodiester backbone of 1193 is resistant to hydrolysis by exonucleases in fetal calf serum. The nuclease resistance of 1443 and its ability to form triplexes at very low magnesium concentrations suggests that triplex-forming oligomers with alternating methylphosphonate-phosphodiester backbones may be good candidates for use as antigene reagents in cell culture.     

Zwitterionic oligodeoxyribonucleotide N3'-->P5' phosphoramidates: synthesis and properties.

Zwitterionic, net neutral oligonucleotides containing alternating negatively charged N3'-->P5' phosphoramidate monoester and positively charged phosphoramidate diester groups were synthesized. The ability of zwitterionic phosphoramidates to form complexes with complementary DNA and RNA was evaluated. Stoichiometry and salt dependency of these complexes were determined as a function of the nature of the heterocyclic bases of the zwitterionic compounds. Unlike the melting temperatures of the natural phosphodiester-containing oligomers, the T m of the duplexes formed with the zwitterionic oligothymidylates was salt concentration independent. The thermal stability of these duplexes was much higher with Delta T m values of 20-35 degrees C relatively to phosphodiester counterparts at low salt concentrations. The zwitterionic oligoadenylate formed only 2Py:1Pu triplexes with complementary poly(U) or poly(dT) strands. The thermal stability of these complexes was dependent on salt concentration. Also, the T m values of the complexes formed by the zwitterionic oligoadenylate with poly(U) were 6-41 degrees C higher than for the natural phosphodiester counterpart. Triplexes of this compound with poly(dT) were also more stable with a Delta T m value of 22 degrees C at low salt concentrations. Complexes formed by the zwitterionic oligonucleotides with complementary RNAs were not substrates for RNase H. Surprisingly, the duplex formed by the all anionic alternating N3'-->P5'phosphoramidate-phosphodiester oligothymidylate and poly(A) was a good substrate for RNase H.     

Evidence from CD spectra and melting temperatures for stable Hoogsteen-paired oligomer duplexes derived from DNA and hybrid triplexes.

The pyr*pur.pyr type of nucleic acid triplex has a purine strand that is Hoogsteen-paired with a parallel pyrimidine strand (pyr*pur pair) and that is Watson-Crick-paired with an antiparallel pyrimidine strand (pur.pyr pair). In most cases, the Watson-Crick pair is more stable than the Hoogsteen pair, although stable formation of DNA Hoogsteen-paired duplexes has been reported. Using oligomer triplexes of repeating d(AG)12 and d(CT)12 or r(CU)12 sequences that were 24 nt long, we found that hybrid RNA*DNA as well as DNA*DNA Hoogsteen-paired strands of triplexes can be more stable than the Watson-Crick-paired strands at low pH. The structures and relative stabilities of these duplexes and triplexes were evaluated by circular dichroism (CD) spectroscopy and UV absorption melting studies of triplexes as a function of pH. The CD contributions of Hoogsteen-paired RNA*DNA and DNA*DNA duplexes were found to dominate the CD spectra of the corresponding pyr*pur.pyr triplexes.     

Triplex formation by psoralen-conjugated chimeric oligonucleoside methylphosphonates

Interactions between nuclease-resistant, 5'-psoralen-conjugated, chimeric methylphosphonate oligodeoxyribo- or oligo-2'-O-methylribo-triplex-forming oligomers (TFOs) and a purine tract found in the envelope gene of HIV proviral DNA (env-DNA) were investigated by gel mobility shift assays or by photo-cross-linking experiments. These chimeric TFOs contain mixtures of methylphosphonate and phosphodiester internucleotide bonds. A pyrimidine chimeric TFO composed of thymidine and 5-methyl-2'-deoxycytidine (C), d-PS-TpCpTpCpTpCpTpTpTpTpTpTpCpTpC (1mp) where PS is trimethylpsoralen and p is methylphosphonate, forms a stable triplex with env-DNA whose dissociation constant is 1. 3 microM at 22 degrees C and pH 7.0. The dissociation constant of chimeric TFO 2mp, d-PS-UpCpTpCpTpCpTpUpTpUpTpUpCpTpC, decreased to 400 nM when four of the thymidines in 1mp were replaced by 5-propynyl-2'-deoxyuridines (U), a result consistent with the increased stacking interactions and hydrophobic nature of 5-propynyl-U. An even greater decrease, 470 -50 nM, was observed for the all-phosphodiester versions of 1mp and 2mp. The differences in behavior of the chimeric versus the all-phosphodiester oligomers may be related to differences in the conformations between the propynyl-U-substituted versus the nonsubstituted TFOs. Thus, in the chimeric oligomer, the stabilizing effect of the propynyl-U's may be offset by the reduced ability of the methylphosphonate backbone to assume an A-type conformation, a conformation that appears to be preferred by propynyl-U-containing TFOs. A chimeric oligo-2'-O-methylribopyrimidine with the same sequence as 1mp also formed a stable triplex, K(d) = 1.4 microM, with env-DNA. In contrast to the behavior of the pyrimidine TFOs, antiparallel A/G oligomers and parallel or antiparallel T/G oligomers did not form triplexes with env-DNA, even at oligomer concentrations of 10 microM. This lack of binding may be a consequence of the low G content (33%) of the triplex binding site. Irradiation of triplexes formed between the pyrimidine TFOs and env-DNA resulted in formation of photoadducts with either the upper-strand C or the lower-strand T at the 5'-CpA-3' duplex/triplex junction. No interstrand cross-links were observed. The presence of a 5-propynyl-U at the 5'-end of the oligomer caused a reduction in the amount of upper-strand photoadduct but had no effect on photoadduct formation with the lower strand, suggesting that increased stacking interactions caused by the presence of the 5-propynyl-U change the orientation of psoralen with respect to the upper-strand C. The ability of chimeric methylphosphonate TFOs to bind to DNA, combined with their resistance to degradation by serum 3'-exonucleases, suggests that they may have utility in biological experiments.     

Synthesis and properties of cationic oligopeptides with different side chain lengths that bind to RNA duplexes

A series of artificial peptides bearing cationic functional groups with different side chain lengths were designed, and their ability to increase the thermal stability of nucleic acid duplexes was investigated. The peptides with amino groups selectively increased the stability of RNA/RNA duplexes, and a relationship between the side chain length and the melting temperature (T_m) of the peptide–RNA complexes was observed. On the other hand, while peptides with guanidino groups exhibited a similar tendency with respect to the peptide structure and thermal stability of RNA/RNA duplexes, those with longer side chain lengths, such as l-2-amino-4-guanidinobutyric acid (Agb) or l-arginine (Arg) oligomers, stabilized both RNA/RNA and DNA/DNA duplexes, and those with shorter side chain lengths exhibited a higher ability to selectively stabilize RNA/RNA duplexes. In addition, peptides were designed with different levels of flexibility by introducing glycine (Gly) residues into the l-2-amino-3-guanidinopropionic acid (Agp) oligomers. It was found that insertion of Gly did not affect the thermal stability of the peptide–RNA complexes, but an alternate arrangement of Gly and Agp apparently decreased the thermal stability. Therefore, in the Agp oligomer, consecutive Agp sequences are essential for increasing the stability of RNA/RNA duplexes.     

Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.

The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 formed base triplets, and nucleotides G7*C13formed a Watson-Crick base pair. The oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT), designated '1G', also formed a triplex in which nucleotides C24*G3*C24 formed a triplet. Reaction of the two oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide revealed that only the 3G sequence formed an adduct, as determined by UV absorbance and piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis. This site was identified as G7by comparison to the guanine-specific cleavage pattern. The chemistry was extended to a series of nicked bimolecular triple helices, constructed from d(AAAGGGGGAA) and d(CnTTCTTTTTCCCCCTTTATTTTTTC5-n) (n = 1-5). Each oligomer in the series differed only in the placement of the nick. Reaction of the nicked triplexes with AFB1- exo -8,9-epoxide, piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis, revealed cleavage corresponding to the guanine closest to the pyrimidine strand nick. By using the appropriate pyrimidine sequence the lesion was positioned within the purine strand.     

Phosphoramidate analogues of DNA: synthesis and thermal stability of heteroduplexes

The deoxyoligonucleotide 5' AATCGGGCATGGATT (15-mer) was synthesized containing 12 phosphoramidate linkages derived from 2 primary and 2 secondary amines. The oligonucleotides were purified by reverse phase HPLC and characterized by PAGE. The thermal stability of the duplexes derived from these compounds, when hybridized to the complementary diester linked oligomer, were determined and compared to the diester and methanephosphonate oligomer. The results indicated that all analogue oligomers form less stable duplexes then the diester oligomer. A large difference was observed between primary and secondary amine derived phosphoramidates.     

Increased DNA binding and sequence discrimination of PNA oligomers containing 2,6-diaminopurine.

The synthesis of a diaminopurine PNA monomer, N-[N6-(benzyloxycarbonyl)-2,6-diaminopurine-9-yl] acetyl-N-(2-t-butyloxycarbonylaminoethyl)glycine, and the incorporation of this monomer into PNA oligomers are described. Substitution of adenine by diaminopurine in PNA oligomers increased the T m of duplexes formed with complementary DNA, RNA or PNA by 2.5-6.5 degrees C per diaminopurine. Furthermore, discrimination against mismatches facing the diaminopurine in the hybridizing oligomer is improved. Finally, a homopurine decamer PNA containing six diaminopurines is shown to form a (gel shift) stable strand displacement complex with a target in a 246 bp double-stranded DNA fragment.     

Nucleosides and nucleotides. 208. Alternate-strand triple-helix formation by the 3'-3'-linked oligodeoxynucleotides with the anthraquinonyl group at the junction point.

The synthesis of 3'-3'-linked oligodeoxynucleotides (ODNs) with the anthraquinonyl group at the junction point is described. The ODNs were synthesized on a DNA synthesizer using a controlled pore glass (CPG) carrying pentaerythritol that has an intercalator at one of the four hydroxymethyl groups. Stability of the triplexes with the target duplexes was studied by thermal denaturation. The 3'-3'-linked ODNs with the anthraquinonyl group enhanced the thermal stability of the triplexes when compared with those without the intercalator and the unmodified nonamer 10. It was found that the ODNs 12 and 13 carrying the anthraquinonyl groups can form thermally stable triplexes by skipping two or three extra base pairs between two binding domains of the target duplexes. The ability of the 3'-3'-linked ODNs to inhibit cleavage of the target DNA 22 by the restriction enzyme Hind III was tested. It was found that the 3'-3'-linked ODN 16 with the anthraquinonyl group at the junction point inhibited the cleavage by the enzyme more effectively than the nonamer 14 and the 3'-3'-linked ODN 15 without the intercalator.     

The thermal stability of RNA duplexes containing modified base pairs placed at internal and terminal positions of the oligoribonucleotides

The presence of various modifications within oligomers changes their thermodynamic stability. To get more systematic data, we measured effects of 5- and 6-substituted uridine on thermal stability of (AUCU(Mod.)AGAU)2 and (AUCUAGAU(Mod.))2. Collected results lead to the following conclusions: (i) 5-halogenated and 5-alkylated substituents of the uridine affect thermal stability of the RNA duplexes differently. Moreover, the 5-fluorouridine changes stability of the RNA duplexes opposite to remaining 5-halogenouridines; (ii) for oligomers containing 5-chloro, 5-bromo or 5-iodouridine stronger hydrogen bond formed between oxygen-4 of the 5-halogenated uracil and 6-amino group of the adenine is presumably responsible for stabilizing effect; (iii) placing of A-U(5R) base pairs closer to the end of the duplex enhance thermal stability relatively to oligomer with central position of this base pair; (iv) the effects of 5-substituents are additive, particularly for substituents which stabilize RNA duplexes; (v) 6-methyluridines (N1 and N3 isomers) as well as 3N-methyluridine present at internal position of A-U(Mod.) inhibit duplexes formation; (vi) 6-methyluridines (N1 and N3 isomers) as well as 3N-methyluridine placed as terminal base pairs stabilize the duplexes mostly via 3'-dangling end effect.     

Peptide-induced parallel DNA duplexes for oligopyrimidines. Stereospecificity in complexation for oligo(L-lysine) and oligo(L-ornithine)

It is shown that the cationic oligopeptides octadeca(L-lysine) (Lys18) and octadeca(L-ornithine) (Orn18) can induce a parallel duplex for the natural DNA oligomer dT10 with thymine-thymine base pairs. Complexation of the ammonium groups in the peptide side chains with the DNA phosphates leads to diminished electrostatic phosphate-phosphate repulsions, which allows this T-T base pair formation. From combined NOESY 1H NMR and molecular mechanics studies, it follows that the parallel duplex is right-handed, with the peptide located in the groove of the duplex. For the natural DNA oligomers dC10, d(C6T6), and d(T6C2T2), only Lys18 is able to induce the formation of parallel duplexes with C-C and T-T base pairs. It is shown that, for Orn18, a complexation must occur with one of the nonbonded oxygen atoms in the phosphate groups (OR) in such a way that unfavorable steric interactions are present with the C-C base pairs, which have a larger propellor twist angle than T-T base pairs. An analogy is presented between peptide complexation with the phosphates and the neutralization of the phosphate groups by methylation, which is known to lead to parallel duplexes with T-T base pairs (for both the Sp and Rp configurations) and C-C base pairs (only for the Sp configuration).