Deletions of the long arm of chromosome 10 in progression of follicular thyroid tumors

Previous studies of follicular thyroid tumors have shown loss of heterozygosity (LOH) on the short arm of chromosome 3 in carcinomas, and on chromosome 10 in atypical adenomas and carcinomas, but not in common adenomas. We studied LOH on these chromosomal arms in 15 follicular thyroid carcinomas, 19 atypical follicular adenomas and 6 anaplastic (undifferentiated) carcinomas. Deletion mapping of chromosome 10 using 15 polymorphic markers showed that 15 (37.5%) of the tumors displayed LOH somewhere along the long arm. Thirteen of these tumors showed deletions involving the telomeric part of chromosome 10q, distal to D1OS 187. LOH on chromosome 3p was found in 8 (20%) cases. Seven of these also showed LOH on chromosome 10q. In eight cases LOH was seen on chromosome 10q but not 3p. In comparison, the retinoblastoma gene locus at chromosome 13q showed LOH in 22% of the tumors. Most of these also had deletions on chromosome 10q. The results indicate that a region at the telomeric part of 10q may be involved in progression of follicular thyroid tumors.     

Loss of heterozygosity and K-ras gene mutations in gastric cancer

In order to identify relevant genetic lesions in gastric carcinoma, we searched for tumor suppressor gene inactivation and K-ras gene mutations by analyzing tumor and control DNAs from 34 patients. These were from an epidemiologically defined area of Italy characterized by one of the world's highest incidences of stomach cancer. Allele losses were investigated by the Southern blotting procedure at 16 polymorphic loci on 11 different chromosomes. Our data demonstrate that chromosomal regions 5q, 11p, 17p and 18q are frequently deleted, and that 7q and 13q chromosome arms are also involved, although at a lower frequency. Loss of heterozygosity (LOH) at region 11p was not found during other surveys carried out on patients of different geographic origins. No specific combination of allelic losses could be recognized in the samples analyzed, the only exception being that tumors with 17p allelic loss also showed LOH on the 18q region. When matching frequent LOH events and the stage of progression of the tumors, we observed a trend of association between advanced stages and allelic losses on 17p and 18q chromosome arms. The analysis of K-ras, carried out by the polymerase chain reaction and denaturing gradient gel electrophoresis, demonstrated transforming mutations in only 3 out of 32 cases. Colorectal tumorigenesis proceeds by the accumulation of genetic alterations, including K-ras mutations and inactivation of tumor suppressor genes on the 5q, 17p and 18q regions. Our data indicate that, although gastric and colorectal neoplasias share common genetic alterations, they probably progress through different pathways.     

Differential loss of heterozygosity in familial, sporadic, and uremic hyperparathyroidism

Various genetic loci harboring oncogenes, tumor suppressor genes, and genes for calcium receptors have been implicated in the development of parathyroid tumors. We have carried out loss of heterozygosity (LOH) studies in chromosomes 1p, 1q, 3q, 6q, 11q, 13q, 15q, and X in a total of 89 benign parathyroid tumors. Of these, 28 were sporadic parathyroid adenomas from patients with no family history of the disease, 41 were secondary parathyroid tumors, 5 were from patients with a history of previous irradiation to the neck, 12 were from patients with a family history of hyperparathyroidism, and 3 were parathyroid tumors related to multiple endocrine neoplasia type 1 (MEN1). In addition, we determined the chromosomal localization of a second putative calcium-sensing receptor, CaS, for inclusion in the LOH studies. Based on analysis of somatic cell hybrids and fluorescent in situ hybridization to metaphase chromsomes, the gene for CaS was mapped to chromosomal region 2q21-q22. The following results were obtained from the LOH studies: (1) out of the 24 tumors that showed LOH, only 4 had more than one chromosomal region involved, (2) in the tumours from uremic patients, LOH of chromosome 3q was detected in a subset of the tumors, (3) LOH of the MEN1 region at 11q13 was the most common abnormality found in both MEN1-related and sporadic parathyroid tumours but was not a feature of the other forms of parathyroid tumors, (4) LOH in 1p and 6q was not as frequent as previously reported, and (5) tumor suppressor genes in 1q and X might have played a role, particularly on the X chromosome, in the case of familial parathyroid adenomas. We therefore conclude that the tumorigenesis of familial, sporadic, and uremic hyperparathyroidism involves different genetic triggers in a non-progressive pattern. Received: 28 October 1996 / Revised: 16 November 1996     

Allelotype of human thyroid tumors: loss of chromosome 11q13 sequences in follicular neoplasms.

Two classes of genes are the targets of mutations involved in human tumorigenesis: oncogenes, the activation of which leads to growth stimulation, and tumor suppressor genes, which become tumorigenic through loss of function, often through allelic deletion. To obtain evidence for a role for tumor suppressor genes in thyroid tumorigenesis, we examined DNA from 80 thyroid neoplasms for loss of heterozygosity in multiple chromosomal loci using 19 polymorphic genomic probes. None of the informative thyroid tumors studied had allelic loss detected with probes for chromosome 2q (D2S44), 3p (D3F15S2, D3S32), 3q (D3S46), 4p (D4S125), 6p (D6S40), 8q (D8S39), 9q (D9S7), 12p (D12S14), 13q (D13S52), 17p (D17S30), or 18q (D18S10). One of eight of the follicular adenomas had a 10q deletion detected with marker D10S15, and one of 26 had a 10q deletion detected with D10S25. One of two of the follicular carcinomas had an 11p deletion in the H-ras locus. The most significant findings were on chromosome 11q13, the site containing the putative gene predisposing to multiple endocrine neoplasia type I. Four of 27 follicular adenomas had loss of heterozygosity for probes in this region. Allelic deletions were detected with the following probes: D11S149, PYGM, D11S146, and INT2. None of 13 informative papillary carcinomas and none of two follicular carcinomas had loss of heterozygosity detectable with these 11q13 markers. Allelic loss is a relatively infrequent event in human thyroid tumors. Deletions of chromosome 11q13 are present in about 14% of follicular, but not papillary, neoplasms.(ABSTRACT TRUNCATED AT 250 WORDS)     

Loss of heterozygosity on chromosome 11 in sporadic gastrinomas

Summary Gastrinomas are pancreatic endocrine neoplasms that arise either sporadically or are inherited as part of the multiple endocrine neoplasia type I syndrome (MEN I). Loss of heterozygosity (LOH) in the region flanking the MEN I gene at chromosome 11q13 has been documented in a few sporadic and familial pancreatic endocrine tumors, but not previously in sporadic gastrinomas. It has therefore been suggested that gastrinomas develop by a mechanism different from other tumors associated with the MENI syndsrome. We report LOH on chromosome 11 in 5 of 11 sporadic gastrinomas. Four of these tumors have LOH for markers flanking the MEN I region. Molecular evaluation of segments of chromosomes 3, 13, and 17 known to contain cloned or putative tumor suppressor genes fail to show LOH except at one locus in one tumor. These data suggest that a tumor suppressor DNA segment exists at 11q13 that may be involved in the development of sporadic gastrinomas.     

Concurrent analysis of loss of heterozygosity (LOH) and copy number abnormality (CNA) for oral premalignancy progression using the Affymetrix 10K SNP mapping array

Like most human cancers, oral squamous cell carcinoma (SCC) is characterized by genetic instabilities. In this study, a single platform (Affymetrix 10K SNP mapping array) was used to generate both loss of heterozygosity (LOH) and DNA copy number abnormality (CNA) read-outs for precise and high-resolution genetic alteration profiles. As a proof of principle, we performed this concordant analysis on a panel of deletion and trisomy cell lines with known chromosomal alterations and the precise LOH and CNA regions were detected as expected. Using a previously described oral SCC progression model system, we identified a set of genomic regions that may be associated with the malignancy progression, including chromosome regions 3pter–3p35.3, 3p14.1–3p13, 11p, 11q14.3–11q22.2, and 11q13.5–11q14.1. These data show that it is feasible to utilize high-density SNP arrays to generate concordant LOH and CNA profiles at high resolution.     

Genomic profiling maps loss of heterozygosity and defines the timing and stage dependence of epigenetic and genetic events in Wilms' tumors

To understand genetic and epigenetic pathways in Wilms' tumors, we carried out a genome scan for loss of heterozygosity (LOH) using Affymetrix 10K single nucleotide polymorphism (SNP) chips and supplemented the data with karyotype information. To score loss of imprinting (LOI) of the IGF2 gene, we assessed DNA methylation of the H19 5' differentially methylated region (DMR). Few chromosomal regions other than band 11p13 (WT1) were lost in Wilms' tumors from Denys-Drash and Wilms' tumor-aniridia syndromes, whereas sporadic Wilms' tumors showed LOH of several regions, most frequently 11p15 but also 1p, 4q, 7p, 11q, 14q, 16q, and 17p. LOI was common in the sporadic Wilms' tumors but absent in the syndromic cases. The SNP chips identified novel centers of LOH in the sporadic tumors, including a 2.4-Mb minimal region on chromosome 4q24-q25. Losses of chromosomes 1p, 14q, 16q, and 17p were more common in tumors presenting at an advanced stage; 11p15 LOH was seen at all stages, whereas LOI was associated with early-stage presentation. Wilms' tumors with LOI often completely lacked LOH in the genome-wide analysis, and in some tumors with concomitant 16q LOH and LOI, the loss of chromosome 16q was mosaic, whereas the H19 DMR methylation was complete. These findings confirm molecular differences between sporadic and syndromic Wilms' tumors, define regions of recurrent LOH, and indicate that gain of methylation at the H19 DMR is an early event in Wilms' tumorigenesis that is independent of chromosomal losses. The data further suggest a biological difference between sporadic Wilms' tumors with and without LOI.     

Deletion mapping of gliomas suggest the presence of two small regions for candidate tumor-suppressor genes in a 17-cM interval on chromosome 10q.

The loss of genetic material on chromosome 10q is frequent in different tumors and particularly in malignant gliomas. We analyzed 90 of these tumors and found loss of heterozygosity (LOH) in >90% of the informative loci in glioblastoma multiforme (GBM). Initial studies restricted the common LOH region to 10q24-qter. Subsequently, the study of a pediatric GBM suggested D10S221 and D10S209, respectively, as centromeric and telomeric markers of a 4-cM LOH region. It is interesting to note that, in one subset of cells from this tumor, locus D10S209 seems involved in the allelic imbalance of a larger region, with D10S214 as telomeric marker. This 17-cM region contains the D10S587-D10S216 interval of common deletion recently defined on another set of gliomas.     

Genome-wide detection of LOH in prostate cancer using human SNP microarray technology

Loss of heterozygosity (LOH) of chromosomal regions is crucial in tumor progression. In this study we assessed the potential of the Affymetrix GeneChip HuSNP mapping assay for detecting genome-wide LOH in prostate tumors. We analyzed two human prostate cell lines, P69SV40Tag (P69) and its tumorigenic subline, M12, and 11 prostate cancer cases. The M12 cells showed LOH in chromosomes 3p12.1-p22.1, 11q22.1-q24.2, 19p13.12, and 19q13.42. All of the prostate cases with informative single-nucleotide polymorphism (SNP) markers showed LOH in 1p31.2, 10q11.21, 12p13.1, 16q23.1-q23.2, 17p13.3, 17q21.31, and 21q21.2. Additionally, a high percentage of cases showed LOH at 6p25.1-p25.3 (75%), 8p22-p23.2, and 10q22.1 (70%). Several tumor suppressor genes (TSGs) have been mapped in these loci. These results demonstrate that the HuSNP mapping assay can serve as an alternative to comparative genomic hybridization for assessing genome-wide LOH and can identify chromosomal regions harboring candidate TSGs implicated in prostate cancer.     

At least four different chromosomal regions are involved in loss of heterozygosity in human breast carcinoma

Three chromosome regions, i.e., 11p15, 13q, and 17p, were previously reported by three independent groups to be specifically reduced to hemizygosity in human primary breast cancer. We examined the DNA of 64 mammary tumors for loss of heterozygosity (LOH) with 28 polymorphic DNA markers dispersed on 10 arms of 8 different chromosomes. Complete or near-complete absence of LOH was observed on 5 arms (5 chromosomes). LOH at all three previously invoked regions was confirmed, and the highest frequency was found on 17p (67% of heterozygous patients). Allele loss of a marker from chromosome 3 (region p14-p21) was found in 7 of 15 informative cases. Concurrent LOH at 2 to 4 loci was noted in 20 of the 43 tumors showing LOH. Allele losses did not correlate with any of the six clinico-histopathological variables investigated, but in a group of patients in which we were unable to demonstrate LOH, the absence of distant metastases was statistically significant (P less than 0.05). These results suggest that some of the observed allele losses reflect random events, possibly as a result of genetic instability, but are not without biological significance for the progression of particular subclasses of breast tumors.     

Linkage disequilibrium of three polymorphic RFLP markers in the apolipoprotein AI-CIII gene cluster on chromosome 11

A panel of glial tumors consisting of 11 low grade gliomas, 9 anaplastic gliomas, and 29 glioblastomas were analyzed for loss of heterozygosity by examining at least one locus for each chromosome. The frequency of allele loss was highest among the glioblastomas, suggesting that genetic alterations accumulate during glial tumor development. The most common genetic alteration detected involved allele losses of chromosome 10 loci; these losses were observed in all glioblastomas and in three of the anaplastic gliomas. In order to delineate which chromosome 10 region or regions were deleted in association with glial tumor development, a deletion mapping analysis was performed, and this revealed the partial loss of chromosome 10 in eight glioblastomas and two of the anaplastic gliomas. Among these cases, three distinct regions of chromosome 10 were indicated as being targeted for deletion: one telomeric region on 10p and both telomeric and centromeric locations on 10q. These data suggest the existence of multiple chromosome 10 tumor suppressor gene loci whose inactivation is involved in the malignant progression of glioma.     

Hereditary multiple exostoses (EXT): mutational studies of familial EXT1 cases and EXT-associated malignancies.

Hereditary multiple exostoses (EXT) is an autosomal dominant disorder characterized by the formation of cartilage-capped prominences that develop from the growth centers of the long bones. EXT is genetically heterogeneous, with three loci, currently identified on chromosomes 8q24.1, 11p13, and 19q. The EXT1 gene, located on chromosome 8q24.1, has been cloned and is encoded by a 3.4-kb cDNA. Five mutations in the EXT1 gene have been identified--four germ-line mutations, including two unrelated families with the same mutation, and one somatic mutation in a patient with chondrosarcoma. Four of the mutations identified resulted in frameshifts and premature termination codons, while the fifth mutation resulted in a substitution of leucine for arginine. Loss of heterozygosity (LOH) analysis of chondrosarcomas and chondroblastomas revealed multiple LOH events at loci on chromosomes 3q, 8q, 10q, and 19q. One sporadic chondrosarcoma demonstrated LOH for EXT1 and EXT3, while a second underwent LOH for EXT2 and chromosome 10. A third chondrosarcoma underwent LOH for EXT1 and chromosome 3q. These results agree with previous findings that mutations at EXT1 and multiple genetic events that include LOH at other loci may be required for the development of chondrosarcoma.     

Loss of heterozygosity in chondrosarcomas for markers linked to hereditary multiple exostoses loci on chromosomes 8 and 11.

Hereditary multiple exostoses (EXT; MIM 133700) is an autosomal dominant condition characterized by growth of multiple benign cartilage-capped tumors. EXT greatly increases the relative risk to develop chondrosarcoma, although most chondrosarcomas are sporadic. This observation suggests that, like the genes responsible for retinoblastoma and other dominantly inherited cancer susceptibility disorders, the genes that cause EXT may have tumor-suppressor function and may play a role in the pathogenesis of the related sporadic tumors. To investigate this hypothesis, we evaluated chondrosarcomas for loss of constitutional heterozygosity (LOH) at polymorphic loci linked to three recently identified genomic regions containing genes involved in EXT. LOH for markers linked to EXT1 on chromosome 8 was detected in a chondrosarcoma that arose in a man with EXT. Four of 17 sporadic tumors showed LOH for markers linked to EXT1, and 7 showed LOH for markers linked to EXT2 on chromosome 11. In all, LOH was observed for markers linked to EXT1 or EXT2 in 44% of the 18 tumors, whereas heterozygosity was retained for markers on 19p linked to EXT3. These findings support the hypothesis that genes on 8q and the pericentromeric region of 11 have tumor-suppressor function and play a role in the development of chondrosarcomas.     

A common region of loss of heterozygosity in Wilms' tumor and embryonal rhabdomyosarcoma distal to the D11S988 locus on chromosome 11p15.5

The development of Wilms' tumor has been associated with two genetic loci on chromosome 11: WTI in 11p13 and WT2 in 11p15.5. Here, we have used loss of heterozygosity (LOH) in Wilms' tumors to narrow the WT2 locus distal to the D11S988 locus. A similar region was apparent for the clinically associated tumor, embryonal rhabdomyosarcoma. We have also demonstrated that a constitutional chromosome translocation breakpoint associated with Beckwith-Wiedemann syndrome and an acquired somatic chromosome translocation breakpoint in a rhabdoid tumor each occur in the same chromosomal interval as the smallest region of LOH in Wilms' tumors and embryonal rhabdomyosarcoma. Finally, we report the first Wilms' tumor without a cytogenetic deletion that shows targeted LOH for 11p15 and 11p13 while maintaining germline status for 11p14.     

A Common Region of Deletion on Chromosome 17q in Both Sporadic and Familial Epithelial Ovarian Tumors Distal to BRCA1

Linkage analysis in familial breast and ovarian cancer and studies of allelic deletion in sporadic ovarian tumors have identified a region on chromosome 17q containing a candidate tumor-suppressor gene (referred to as BRCA1) of likely importance in ovarian carcinogenesis. We have examined normal and tumor DNA samples from 32 patients with sporadic and 8 patients with familial forms of the disease, for loss of heterozygosity (LOH) at 21 loci on chromosome 17 (7 on 17p and 14 on 17q). LOH on 17p was 55% (22/40) for informative 17pl3.1 and 17pl3.3 markers. When six polymorphic markers flanking the familial breast/ovarian cancer susceptibility locus on 17ql2-q21 were used, LOH was 58% (23/40), with one tumor showing telomeric retention. Evaluation of a set of markers positioned telomeric to BRCA1 resulted in the highest degree of LOH, 73% (29/40), indicating that a candidate locus involved in ovarian cancer may reside distal to BRCA1. Five of the tumors demonstrating allelic loss for 17q markers were from individuals with a strong family history of breast and ovarian cancer. More important, two of these tumors (unique patient number [UPN] 57 and UPN 79) retained heterozygosity for all informative markers spanning the BRCA1 locus but showed LOH at loci distal to but not including the anonymous markers CMM86 (D17S74) and 42D6 (D17S588), respectively. Deletion mapping of seven cases (two familial and five sporadic) showing limited LOH on 17q revealed a common region of deletion, distal to GH and proximal to D17S4, that spans −25 cM. These results suggest that a potential tumor-suppressor gene involved in both sporadic and familial ovarian cancer may reside on the distal portion of chromosome 17q and is distinct from the BRCA1 gene.     

Analysis of wilms tumors using SNP mapping array-based comparative genomic hybridization

Wilms tumor (WT) has been a model to study kidney embryogenesis and tumorigenesis and, although associated with hereditary, cancer predisposition syndromes, the majority of tumors occur sporadically. To analyze genetic changes in WT we have defined copy number changes and loss of heterozygosity in 56 Wilms tumors using high resolution oligonucleotide arrays at a average resolution of ~12 Kb. Consistent deletions were seen on chromosomes 1p, 4q, 7p, 9q, 11p, 11q, 14q, 16q, and 21q. High frequency gains were seen for 1q and lower frequency gains were seen on 7q and chromosomes 8, 12 and 18. The high resolution provided by the SNP mapping arrays has defined minimal regions of deletion for many of these LOH events. Analysis of CNAs by tumor stage show relatively stable karyotypes in stage 1 tumors and more complex aCGH profiles in tumors from stages 3-5.     

Sites of genetic instability in mitosis and cancer

Certain chromosomal regions called common fragile sites are prone to difficulty during replication. Many tumors have been shown to contain alterations at fragile sites. Several models have been proposed to explain why these sites are unstable. Here we describe work to investigate models of fragile site instability using a yeast artificial chromosome carrying human DNA from a common fragile site region. In addition, we describe a yeast system to investigate whether repair of breaks at a naturally occurring fragile site in yeast, FS2, involves mitotic recombination between homologous chromosomes, leading to loss of heterozygosity (LOH). Our initial evidence is that repair of yeast fragile site breaks does lead to LOH, suggesting that human fragile site breaks may similarly contribute to LOH in cancer. This work is focused on gaining understanding that may enable us to predict and prevent the situations and environments that promote genetic changes that contribute to tumor progression.     

Isolation of genes from the rhabdoid tumor deletion region in chromosome band 22q11.2

We employed exon trapping and large-scale genomic sequence analysis of two bacterial artificial chromosome clones to isolate genes from the region between the IGLC and BCR in chromosome 22q11.2. At the time these studies were initiated, one previously identified gene, GNAZ, was known to map to this region. Two genes, RTDR1 and RAB36, were cloned from this portion of 22q11, which is heterozygously or homozygously deleted in pediatric rhabdoid tumors of the brain, kidney and soft tissues. RTDR1 is a novel gene with a slight homology to a yeast vacuolar protein. RAB36 is a member of the Rab family of proteins. A series of primary rhabdoid tumors with chromosome 22q11 deletions were screened for mutations in the coding sequences of RTDR1, GNAZ and RAB36, but did not demonstrate any disease-specific alterations. Recently, INI1, which maps to the distal portion of the deletion region in 22q11, was identified as the candidate rhabdoid tumor suppressor gene. Further studies of RTDR1 and RAB36 are required to determine whether their absence contributes to the progression of rhabdoid tumors. Alternatively, these genes may be candidates for other diseases that map to human chromosome 22.     

Marked differences in unilateral isolated retinoblastomas from young and older children studied by comparative genomic hybridization

Although it is established that the loss of function of both alleles of the RB1 gene is a prerequisite for the development of retinoblastoma, little is known about the genetic events that are required for tumor progression. We used comparative genomic hybridization (CGH) to search for DNA copy number changes in isolated unilateral retinoblastomas. From a series of 66 patients with retinoblastomas with somatic mutations in both RB1 alleles, tumor samples from 13 children with the youngest (2.0-9.8 months) and 13 with the oldest (36.2-84.1 months) age at operation were studied. Loss at 13q14, the location of RB1, was demonstrated in two tumors only. Recurring chromosome imbalances included gains at 6p (11/26), 1q (10/26), 2p (4/26), and 17q (4/26), gains of the entire chromosome 19 (3/26), and losses at 16q (9/26). A commonly gained region at 1q32 was identified. Increased dosage of GAC1, a candidate oncogene located in 1q32, was found in two of four tumors by Southern blot analysis. Comparison of the CGH findings revealed that retinoblastomas from children with an older age at operation showed significantly more frequent (13/13 cases vs 4/13 cases; P = 0.0005) and more complex genetic abnormalities (median, 5 changes/abnormal tumor vs median, 1.5 changes/abnormal tumor; P = 0.003) than retinoblastomas from children with a young age at operation. Gains at 1q, 2p, 17q, of the entire chromosome 19 and losses of 16q were restricted to the older age group. Our results suggest that the progression of retinoblastomas from older patients follows mutational pathways different from those of younger patients.     

Status of the DPC4 tumor suppressor gene in sporadic colon adenocarcinoma of Croatian patients: identification of a novel somatic mutation

Loss of heterozygosity (LOH) of loci on chromosome 18q occurs in a majority of colorectal cancers. The DPC4 (Smad4) tumor suppressor gene, located at 18q21.1, may be a predisposing gene for Juvenile Polyposis Syndrome. To investigate alterations of the DPC4 gene in sporadic colon adenocarcinoma, a panel of 60 tumor specimens from Croatian patients was surveyed for evidence of LOH and also for mutations within the entire DPC4 coding region (exons 1-11). Using three pairs of specific primers for the three DPC4 microsatellite repetitive sequences, we investigated the frequency of LOH. The presence of single nucleotide change at restriction sites of specific codons in exons 2, 8, 10, and 11 (which belong to the conserved region of the gene) was examined by RFLP analysis. The investigation was extended to search for any other mutation within the entire coding region of the DPC4 gene by single strand conformation polymorphism (SSCP) analysis. Our results show a high frequency of heterozygosity in 58 of 60 (97%) colon adenocarcinoma samples. LOH at any one of the three flanking markers was observed in 26 (45%) of the 58 informative cases. The loss of one allele of the DPC4 gene was negatively correlated with tumor size; more frequent in smaller tumors (<5 cm) than in larger ones. A mutation was found in exon 11 in only one tumor sample (T18), and the mutation was verified by sequencing. Sequencing demonstrated a novel mutation-a deletion in exon 11 (134-153 del TAGACGAAGTACTTCATACC) of the DPC4 gene in the MH2 domain. These data suggest that inactivation of the DPC4 gene contributes to the genesis of colorectal carcinoma through allelic loss whereas mutation in the coding region of the DPC4 gene is infrequently detected in Croatian patients with A, B or C stages of colorectal cancers.