Probing site specificity of DNA binding metallointercalators by NMR spectroscopy and molecular modeling

The molecular recognition of oligonucleotides by chiral ruthenium complexes has been probed by NMR spectroscopy using the template Delta-cis-alpha- and Delta-cis-beta-[Ru(RR-picchxnMe(2)) (bidentate)](2+), where the bidentate ligand is one of phen (1,10-phenanthroline), dpq (dipyrido[3,2-f:2',3'-h]quinoxaline), or phi (9,10-phenanthrenequinone diimine) and picchxnMe(2)() is N,N'-dimethyl-N,N'-di(2-picolyl)-1,2-diaminocyclohexane. By varying only the bidentate ligand in a series of complexes, it was shown that the bidentate alone can alter binding modes. DNA binding studies of the Delta-cis-alpha-[Ru(RR-picchxnMe(2))(phen)](2+) complex indicate fast exchange kinetics on the chemical shift time scale and a "partial intercalation" mode of binding. This complex binds to [d(CGCGATCGCG)](2) and [d(ATATCGATAT)](2) at AT, TA, and GA sites from the minor groove, as well as to the ends of the oligonucleotide at low temperature. Studies of the Delta-cis-beta-[Ru(RR-picchxnMe(2))(phen)](2+) complex with [d(CGCGATCGCG)](2) showed that the complex binds only weakly to the ends of the oligonucleotide. The interaction of Delta-cis-alpha-[Ru(RR-picchxnMe(2))(dpq)](2+) with [d(CGCGATCGCG)](2) showed intermediate exchange kinetics and evidence of minor groove intercalation at the GA base step. In contrast to the phen and dpq complexes, Delta-cis-alpha- and Delta-cis-beta-[Ru(RR-picchxnMe(2))(phi)](2+) showed evidence of major groove binding independent of the metal ion configuration. DNA stabilization induced by complex binding to [d(CGCGATCGCG)](2) (measured as DeltaT(m)) increases in the order phen < dpq and DNA affinity in the order phen < dpq < phi. The groove binding preferences exhibited by the different bidentate ligands is explained with the aid of molecular modeling experiments.     

Detection of (2'-5')oligoadenylate binding proteins by nondenaturing polyacrylamide gel electrophoresis and affinity blotting onto nitrocellulose

A latent endoribonuclease, RNase L, binds to and is activated by (2'-5')oligoadenylates ((2'-5')(A)n, n = 2-15). Binding to a labeled derivative of (2'-5')(A)n, [32P](2'-5')(A)3pCp, is detected as a protein-ligand complex observed following nondenaturing polyacrylamide gel electrophoresis. One major binding complex and two minor binding complexes are readily seen in cytoplasmic extracts from Ehrlich ascites tumor cells, murine tissue extracts and rabbit liver tissue extracts. At least one of the more rapidly migrating complexes appears to be a proteolytic degradation product of the larger [32P](2'-5')(A)3pCp binding protein. Cell and tissue extracts containing [32P](2'-5')(A)3pCp binding activity can be immobilized onto nitrocellulose filters and [32P](2'-5')(A)3pCp binding activity detected using a simple, rapid, economical affinity blot assay. Detection of [32P](2'-5')(A)3pCp binding proteins following electrophoresis on nondenaturing polyacrylamide gels and the affinity blot assay significantly improve and simplify the analysis of (2'-5')(A)n binding proteins.     

Mechanism of action of Moloney murine leukemia virus RNA-directed DNA polymerase associated RNase H (RNase H I)

The mechanism of action of the ribonuclease H (RNase H) activity associated with Moloney murine leukemia virus RNA-directed DNA polymerase (RNase H I) and the two-subunit (alpha beta) form of avian myeloblastosis virus DNA polymerase were compared by utilizing the model substrate (A)n.(dT)n and polyacrylamide gel electrophoresis in 7 M urea to analyze digestion products. Examination on 25% polyacrylamide gels revealed that a larger proportion of the RNase H I oligonucleotide products generated by limited digestion of [3H](A)(1100).(dT)n were acid insoluble (15-26 nucleotides long) than acid soluble (less than 15 nucleotides long), while the opposite was true for products generated by alpha beta RNase H. RNase H I was capable of attacking RNA in RNA.DNA in the 5' to 3' and 3' to 5' directions, as demonstrated by the use of [3H,3'- or 5'-32P](A)(380).(dT)n and cellulose--[3H](A)n.(dT)n. Both RNase H I and alpha beta RNase H degraded [3H]-(A)n.(dT)n with a partially processive mechanism, based upon classical substrate competition experiments and analyses of the kinetics of degradation of [3H,3'- or 5'-32P](A)(380).(dT)n. That is, both enzymes remain bound to a RNA.DNA substrate through a finite number of hydrolytic events but dissociate before the RNA is completely degraded. Both RNase H I and alpha beta RNase H were capable of degrading [14C](A)n in [3H](C)n-[14C](A)n-[32P](dA)n.(dT)n, suggesting that retroviral RNase H is capable of removing the tRNA primer at the 5' terminus of minus strand DNA at the appropriate time during retroviral DNA synthesis in vitro.     

Cooperative effects in long-range 1,4 DNA-DNA interstrand cross-links formed by polynuclear platinum complexes: an unexpected syn orientation of adenine bases outside the binding sites

The novel phase II anticancer drug BBR3464 ([[ trans-PtCl(NH(3))(2)](2)- micro -[ trans-Pt(NH(3))(2)(NH(2)(CH(2))(6)NH(2))(2)]](NO(3))(4)) forms a 1,4-interstrand cross-link adduct with the self-complementary DNA octamer 5'-d(ATG*TACAT)(2)-3', with the two platinum atoms coordinated in the major groove at the N7 positions of guanines that are four base pairs apart on opposite DNA strands. The "central" tetraamine linker [ trans-H(2)N(CH(2))(6)NH(2)Pt(NH(3))(2)NH(2)(CH(2))(6)NH(2)] was located in or close to the minor groove. The adduct was characterized and analyzed by MS, UV and NMR spectroscopy. NMR analysis of the adduct shows strong H8/H1' intraresidue crosspeaks observed for the A1 and A7 resonances, consistent with a syn conformation for these bases which is usually not observed for adenine residues and bases not directly involved in the cross-link in oligonucleotides. The strong intraresidue H8/H1' crosspeak is also observed for G3. Examination of the structure thus reveals unusual cooperative effects unique to this class of anticancer drugs and is the first demonstration of cooperative effects in solution for an anticancer drug. The significant characteristic of the structure is the lack of severe DNA distortion such as a kink, directed bend or significant unwinding of the helices which are characteristic for DNA adducts of mononuclear complexes. This may contribute to the lack of protein recognition of the cross-link by HMG-domain proteins, a biological consequence significantly different from that of mononuclear complexes such as cisplatin. Since DNA is the principal target in vivo for these Pt cross-linking agents, the unique structural perturbations induced by BBR3464 cross-links are likely related to its increased cytotoxicity and antitumor activity as compared to cisplatin ( cis-DDP).     

Synthesis and DNA conformational changes of non-covalent polynuclear platinum complexes

Polynuclear platinum compounds demonstrate many novel phenomena in their interactions with DNA and proteins as well as novel anti-cancer activities. Previous studies indicated that the high positive charge and the non-coordinated "central linker" of the polynuclear compounds could have major contributions to these features. Therefore, a series of non-covalent polynuclear platinum complexes, [[Pt(NH(3))(3)](2)-mu-Y](n+) (Y=polyamine linker or [trans-Pt(NH(3))(2)(H(2)N(CH(2))(6)NH(2))(2)]) was synthesized and the DNA interactions of these platinum complexes were investigated. The conformational changes induced by these compounds in polymer DNA were studied by circular dichroism and the reversibility of the transition was tested by subsequent titration with the DNA intercalating agent ethidium bromide (EtBr). Fluorescent quenching was also used to assess the ability of EtBr to intercalate into A and Z-DNA induced by the compounds. The non-covalent polynuclear platinum complexes induced both B-->A and B-->Z conformational changes in polymer DNA. These conformational changes were partially irreversible. The platinum compound with the spermidine linker, [[Pt(NH(3))(3)](2)-mu-spermidine-N(1),N(8)]Cl(5).2H(2)O, is more efficient in inducing the conformational changes of DNA and it is less reversible than complexes with other linkers. The melting point study showed that the non-covalent polynuclear platinum complexes stabilized the duplex DNA and the higher the electrical charge of the complexes the greater the stabilization observed.     

Minor groove binding DNA ligands with expanded A/T sequence length recognition, selective binding to bent DNA regions and enhanced fluorescent properties

DNA minor groove ligands provide a paradigm for double-stranded DNA recognition, where common structural motifs provide a crescent shape that matches the helix turn. Since minor groove ligands are useful in medicine, new ligands with improved binding properties based on the structural information about DNA-ligand complexes could be useful in developing new drugs. Here, two new synthetic analogues of AT specific Hoechst 33258 5-(4-methylpiperazin-1-yl)-2-[2'-(3,4-dimethoxyphenyl)-5'-benzimidazolyl] benzimidazole (DMA) and 5-(4-methylpiperazin-1-yl)-2-[2'[2'-(4-hydroxy-3-methoxyphenyl)-5' '-benzimidazolyl]-5'-benzimidazolyl] benzimidazole (TBZ) were evaluated for their DNA binding properties. Both analogues are bisubstituted on the phenyl ring. DMA contains two ortho positioned methoxy groups, and TBZ contains a phenolic group at C-4 and a methoxy group at C-3. Fluorescence yield upon DNA binding increased 100-fold for TBZ and 16-fold for DMA. Like the parent compound, the new ligands showed low affinity to GC-rich (K approximately 4 x 10(7) M(-1)) relative to AT-rich sequences (K approximately 5 x 10(8) M(-1)), and fluorescence lifetime and anisotropy studies suggest two distinct DNA-ligand complexes. Binding studies indicate expanded sequence recognition for TBZ (8-10 AT base pairs) and tighter binding (DeltaT(m) of 23 degrees C for d (GA(5)T(5)C). Finally, EMSA and equilibrium binding titration studies indicate that TBZ preferentially binds highly hydrated duplex domains with altered A-tract conformations d (GA(4)T(4)C)(2) (K= 3.55 x 10(9) M(-1)) and alters its structure over d (GT(4)A(4)C)(2) (K = 3.3 x 10(8) M(-1)) sequences. Altered DNA structure and higher fluorescence output for the bound fluorophore are consistent with adaptive binding and a constrained final complex. Therefore, the new ligands provide increased sequence and structure selective recognition and enhanced fluorescence upon minor groove binding, features that can be useful for further development as probes for chromatin structure stability.     

Molecular structure of the core-modified siRNA duplexes containing diastereomeric pair of [C6'(R)-OH]- versus [C6'(S)-OH]-carba-LNAs suggests a model for RNAi action

Molecular structures of native and a pair of modified small interfering RNA-RNA duplexes containing carbocyclic [6?'-(R)-OH/7?'-(S)-methyl]- and [6?'-(S)-OH/7?'-(S)-methyl]-carba-LNA-thymine nucleotides, which are two diastereomeric analogs of the native T nucleotide, incorporated at position 13 in the antisense (AS) strand of siRNA, have been simulated using molecular mechanics/dynamics techniques. The main aim of the project has been to find a plausible structural explanation of why modification of siRNA at T(13) position by the [6?'(R)-O-(p-Toluoyl)-7?'(S)-methyl]-carba-LNA-Thymine [IC(50) of 3.32 ± 0.17 nM] is ca 24 times more active as an RNA silencing agent against the target HIV-1 TAR RNA than the [6?'(S)-O-(p-Toluoyl)-7?'(S)-methyl]-counterpart [IC(50) of 79.8 ± 17 nM] [1]. The simulations reveal that introduction of both C6?'(R)-OH and C6?'(S)-OH stereoisomers does not lead even to local perturbation of the siRNA-RNA duplex structures compared to the native, and the only significant difference between 6?'(S)- and 6?'(R)-diastereomers found is the exposure of the 6?'-OH group of the 6?'(R)-diastereoisomer toward the edge of the duplex while the 6?'-hydroxyl group of the 6?'(S)-diastereoisomer is somewhat buried in the minor groove of the duplex. This rules out a hypothesis about any possible local distortion by the nature of chemical modification of the siRNA-target the RNA duplex, which might have influenced the formation of the effective RNA silencing complex (RISC) and puts some weight on the hypothesis about the 6?'-hydroxy group being directly involved with most probably Ago protein, since it is known from exhaustive X-ray studies [2, 3] that the core residues are indeed involved with hydrogen bonding with the internucleotidyl phosphates. Further systematic investigation is in progress to map the position-dependent functional and nonfunctional interactions of the modified [6?'(R or S)-O-(p-Toluoyl)-7?'(S)-methyl]-carba-LNA-T with the Ago2 protein of the RISC.     

Differential nucleotide excision repair susceptibility of bulky DNA adducts in different sequence contexts: hierarchies of recognition signals

The structural origin underlying differential nucleotide excision repair (NER) susceptibilities of bulky DNA lesions remains a challenging problem. We investigated the 10S (+)-trans-anti-[BP]-N(2)-2'-deoxyguanosine (G*) adduct in double-stranded DNA. This adduct arises from the reaction, in vitro and in vivo, of a major genotoxic metabolite of benzo[a]pyrene (BP), (+)-(7R,8S,9S,10R)-7,8-dihydroxy-9,10-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene, with the exocyclic amino group of guanine. Removal of this lesion by the NER apparatus in cell-free extracts has been found to depend on the base sequence context in which the lesion is embedded, providing an excellent opportunity for elucidating the properties of the damaged DNA duplexes that favor NER. While the BP ring system is in the B-DNA minor groove, 5' directed along the modified strand, there are orientational distinctions that are sequence dependent and are governed by flanking amino groups [Nucleic Acids Res.35 (2007), 1555-1568]. To elucidate sequence-governed NER susceptibility, we conducted molecular dynamics simulations for the 5'-...CG*GC..., 5'-...CGG*C..., and 5'-...TCG*CT... adduct-containing duplexes. We also investigated the 5'-...CG*IC... and 5'-...CIG*C... sequences, which contain "I" (2'-deoxyinosine), with hydrogen replacing the amino group in 2'-deoxyguanosine, to further characterize the structural and dynamic roles of the flanking amino groups in the damaged duplexes. Our results pinpoint explicit roles for the amino groups in tandem GG sequences on the efficiency of NER and suggest a hierarchy of destabilizing structural features that differentially facilitate NER of the BP lesion in the sequence contexts investigated. Furthermore, combinations of several locally destabilizing features in the hierarchy, consistent with a multipartite model, may provide a relatively strong recognition signal.     

A demonstration of the intrinsic importance of stabilizing hydrophobic binding and non-covalent van der Waals contacts dominant in the non-covalent CC-1065/B-DNA binding

The comparative DNA binding properties and cytotoxic activity of CDPIn methyl esters (n = 1-5) vs. PDE-In methyl esters (n = 1-3) are detailed in studies which provide experimental evidence for the intrinsic importance of stabilizing hydrophobic binding and non-covalent van der Waals contacts dominant in the CC-1065/B-DNA minor groove binding. High affinity minor groove binding to DNA was established through: (1) the observation of CDPI3 binding (UV) but not unwinding of supercoiled DNA (phi 174 RFI DNA) thus excluding intercalative binding; (2) the observation of CDPI3 binding to T4 phage DNA (UV, delta Tm) in which the major groove is occluded by glycosylation thus excluding major groove binding; (3) the observation of salt (Na+) concentration independent high affinity CDPI3 binding to poly(dA . poly(dT) thus excluding simple electrostatic binding to the DNA phosphate backbone; and further inferred through (4) the observation of an intense induced dichroism (ICD, poly(dA) . poly(dT) and poly(dG) . poly(dC) [phi]23(358) = 24,000 and 23,500). This high affinity minor groove binding is sufficient to produce a potent cytotoxic effect.(ABSTRACT TRUNCATED AT 400 WORDS)     

Search for the optimal linker in tandem hairpin polyamides

In order to target specific DNA sequences >or=10 base pairs in size by minor groove binding ligands, a search for the optimal linker in dimers of hairpin polyamides was initiated. Two series of tandem polyamides ImPyIm-(R)[ImPyIm-(R)(H2N)gamma-PyPyPy-L](HN)gamma-PyPyPy-beta-Dp (1a-e), where L represents a series of 4-8 carbon long aliphatic amino acid linkers, and ImPyIm-(R)[ImPyIm-(R)(H2N)gamma-PyPyPyIm-L](HN)gamma-PyPyPy-beta-Dp (2a-e), where L represents a series of 2-6 carbon long aliphatic amino acid linkers, were synthesized and characterized by quantitative DNase I footprinting. beta, gamma and Dp represents beta-alanine, gamma-aminobutyric acid, and 3-(dimethylamino)propylamine, respectively. It was found that the five-carbon 5-aminovaleric acid (delta), is suitable to span one base-pair (bp) of DNA when incorporated into a tandem polyamide. ImPyIm-(R)[ImPyIm-(R)(H2N)gamma-PyPyPy-delta](HN)gamma-PyPyPy-beta-Dp (1b) binds the 10 bp binding-site 5'-AGTGAAGTGA-3' with equilibrium association constant K(a)=3.2 x 10(10) M(-1) and ImPyIm-(R)[ImPyIm-(R)(H2N)gamma-PyPyPyIm-delta](HN)gamma-PyPyPy-beta-Dp (2d) binds the 11 bp binding-site 5'-AGTGATAGTGA-3' with K(a)=9.7 x 10(9) M(-1). Tandem 1b also bind the 11 bp site but with lower affinity affording a 15-fold specificity for the shorter binding site. Replacing a methylene group in the amino acid linker with an oxygen atom to form tandem polyamide ImPyIm-(R)[ImPyIm-(R)(H2N)gamma-PyPyPy-E](HN)gamma-PyPyPy-beta-Dp (4) where E represents the ether linker, resulted in that an 80-fold specificity for the 10 bp binding site over the 11 bp site.     

DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)     

Oligonucleotide-minor groove binder conjugates and their complexes with complementary DNA: effect of conjugate structural factors on the thermal stability of duplexes

Synthetic polycarboxamide minor groove binders (MGB) consisting of N-methylpyrrole (Py), N-methylimidazole (Im), N-methyl-3-hydroxypyrrole (Hp) and beta-alanine (beta) show strong and sequence-specific interaction with the DNA minor groove in side-by-side antiparallel or parallel orientation. Two MGB moieties covalently linked to the same terminal phosphate of one DNA strand stabilize DNA duplexes formed by this strand with a complementary one in a sequence-specific manner, similarly to the corresponding mono-conjugated hairpin structures. The series of conjugates with the general formula Oligo-(L-MGB-R)m was synthesized, where m = 1 or 2, L = linker, R = terminal charged or neutral group, MGB = -(Py)n-, -(Im)n- or -[(Py/Im)n-(CH2)3CONH-(Py/Im)n-] and I < n < 5. Using thermal denaturation, we studied effects of structural factors such as m and n, linker L length, nature and orientation of the MGB monomers, the group R and the backbone (DNA or RNA), etc. on the stability of the duplexes. Structural factors are more important for linear and hairpin monophosphoroamidates than for parallel bis-phosphoroamidates. No more than two oligocarboxamide strands can be inserted into the duplex minor groove. Attachment of the second sequence-specific parallel ligand [-L(Py)4R] to monophosphoroamidate conjugate CGTTTATT-L(Py)4R leads to the increase of the duplex Tm, whereas attachment of [-L(Im)4R] leads to its decrease. The mode of interaction between oligonucleotide duplex and attached ligands could be different (stacking with the terminal A:T pair of the duplex or its insertion into the minor groove) depending on the length and structure of the MGB.     

Sequence-selective recognition of duplex DNA through covalent interstrand cross-linking: kinetic and molecular modeling studies with pyrrolobenzodiazepine dimers

Members of a homologous series of pyrrolo[2,1-c][1,4]benzodiazepine (PBD) dimers with C8-O-(CH(2))(n)-O-C8' diether linkages (n = 3-6 for 2a-d, respectively) have been studied for their ability to interact with oligonucleotide duplexes containing potential target binding sites. The results confirm earlier predictions that the n = 3 analogue (2a, DSB-120) will covalently bind to a 5'-Pu-GATC-Py sequence by cross-linking opposite-strand guanines separated by 2 bp. Preference for this DNA sequence is shown using oligonucleotides with altered bases between and/or flanking these guanines. The more extended PBD dimer 2c (n = 5) can span an extra base pair and cross-link the 5'-Pu-GA(T/A)TC-Py sequence. The ability of each homologue to cross-link linear plasmid DNA has been determined, with a rank order that correlates with the reported order of in vitro cytotoxicity: n = 3 (2a) > n = 5 (2c) > n = 6 (2d) > n = 4 (2b). The n = 3 homologue (2a) is >300-fold more efficient at cross-linking DNA than the clinically used cross-linking agent melphalan under the same conditions. Kinetic studies reveal that the n = 3 and 5 dimers achieve faster cross-linking to plasmid DNA (108 and 81% cross-linking h(-1) microM(-1) at 37 degrees C, respectively), whereas the n = 4 and 6 homologues are significantly less efficient at 10.3 and 23% cross-linking h(-1) microM(-1), respectively. Alternating activity for the odd n and even n dimers is probably due to configurational factors governed by the spatial separation of the PBD subunits and the flexible character of the tethering linkage. Molecular modeling confirms the order of cross-linking reactivity, and highlights the role of linker length in dictating sequence recognition for this class of DNA-reactive agent.     

The structure of DAPI bound to DNA

The structure of the DNA fluorochrome 4'-6-diamidine-2-phenyl indole (DAPI) bound to the synthetic B-DNA oligonucleotide C-G-C-G-A-A-T-T-C-G-C-G has been solved by single crystal x-ray diffraction methods, at a resolution of 2.4 A. The structure is nearly isomorphous with that of the native DNA molecule alone. With one DAPI and 25 waters per DNA double helix, the residual error is 21.5% for the 2428 reflections above the 2-sigma level. DAPI inserts itself edgewise into the narrow minor groove, displacing the ordered spine of hydration. DAPI and a single water molecule together span the four AT base pairs at the center of the duplex. The indole nitrogen forms a bifurcated hydrogen bond with the thymine O2 atoms of the two central base pairs, as with netropsin and Hoechst 33258. The preference of all three of these drugs for AT regions of B-DNA is a consequence of three factors: (1) The intrinsically narrower minor groove in AT regions than in GC regions of B-DNA, leading to a snug fit of the flat aromatic drug rings between the walls of the groove. (2) The more negative electrostatic potential within the minor groove in AT regions, attributable in part to the absence of electropositive-NH2 groups along the floor of the groove, and (3) The steric advantage of the absence of those same guanine-NH2 groups, thus permitting the drug molecule to sink deeper into the groove. Groove width and electrostatic factors are regional, and define the relative receptiveness of a section of DNA since they operate over several contiguous base pairs. The steric factor is local, varying from one base pair to the next, and hence is the means of fine-tuning sequence specificity.     

Structure of a beta-alanine-linked polyamide bound to a full helical turn of purine tract DNA in the 1:1 motif

Polyamides composed of N-methylpyrrole (Py), N-methylimidazole (Im) and N-methylhydroxypyrrole (Hp) amino acids linked by beta-alanine (beta) bind the minor groove of DNA in 1:1 and 2:1 ligand to DNA stoichiometries. Although the energetics and structure of the 2:1 complex has been explored extensively, there is remarkably less understood about 1:1 recognition beyond the initial studies on netropsin and distamycin. We present here the 1:1 solution structure of ImPy-beta-Im-beta-ImPy-beta-Dp bound in a single orientation to its match site within the DNA duplex 5'-CCAAAGAGAAGCG-3'.5'-CGCTTCTCTTTGG-3' (match site in bold), as determined by 2D (1)H NMR methods. The representative ensemble of 12 conformers has no distance constraint violations greater than 0.13 A and a pairwise RMSD over the binding site of 0.80 A. Intermolecular NOEs place the polyamide deep inside the minor groove, and oriented N-C with the 3'-5' direction of the purine-rich strand. Analysis of the high-resolution structure reveals the ligand bound 1:1 completely within the minor groove for a full turn of the DNA helix. The DNA is B-form (average rise=3.3 A, twist=38 degrees ) with a narrow minor groove closing down to 3.0-4.5 A in the binding site. The ligand and DNA are aligned in register, with each polyamide NH group forming bifurcated hydrogen bonds of similar length to purine N3 and pyrimidine O2 atoms on the floor of the minor groove. Each imidazole group is hydrogen bonded via its N3 atom to its proximal guanine's exocyclic amino group. The important roles of beta-alanine and imidazole for 1:1 binding are discussed.     

Fluorescence characteristics of DNA complexes with dyes of the bis-benzimidazole series

Fluorescence characteristics of DNA-specific dyes of bis-benzimidazole type in a wide range of pH and r = C/P were investigated. Fluorescence spectra of DNA complexes with bis-benzimidazoles have elements of a structure, which may result from a superposition of the spectra of dye molecules in different protonization group states that form different types of complexes with DNA. Experimental data do not contradict the idea of bis-benzimidazole dye binding into the minor groove of DNA. Bis-benzimide molecules in the deprotonization state have a major affinity to DNA.     

New sequential-assignment routes of nucleic acid NMR signals using a [5'-(13)C]-labeled DNA dodecamer

NMR signal assignments for DNA oligomers have been performed by the well-established sequential assignment procedures based on NOESY and COSY. The H4'/H5'/H5' resonance region is congested and difficult to analyze without the use of isotope-labeled DNA oligomers. Here a DNA dodecamer constructed with 2'-deoxy[5'-(13)C]ribonucleotides, 5'-d(*C*G*C*G*A*A*T*T*C*G*CG)-3' (*N = [5'-(13)C]Nucleotide), was prepared in an effort to analyze the H4'/H5'/H5' resonance region by 2D 1H-13C HMQC-NOESY. In the C5' and H1' resonance region, weak and strong cross peaks for C5'(i)-H1'(i) and C5'(i)-H1'(i-1), respectively, were found, thus enabling the sequential assignment within this region. A similar sequential assignment route was found between C5' and H2'. Proton pair distances evaluated from the canonical B-DNA as well as A-DNA indicated that these sequential-assignment routes on a 2D 1H-13C HMQC-NOESY spectrum work for most nucleic acid stem regions.     

Delivery of floxuridine derivatives to cancer cells by water-soluble organometallic cages

The self-assembly of 2,4,6-tris(pyridin-4-yl)-1,3,5-triazine (tpt) triangular panels with p-cymene (pPr(i)C(6)H(4)Me) ruthenium building blocks and 2,5-dioxydo-1,4-benzoquinonato (dobq) or 5,8-dioxydo-1,4-naphthoquinonato (donq) bridges, in the presence of a pyrenyl-nucleoside derivatives (pyreneR), affords the triangular prismatic host-guest compounds [(pyrene-R)?Ru(6)(pPr(i)C(6)H(4)Me)(6)(tpt)(2)(dobq)(3)](6+) ([(pyrene-R)?1](6+)) and [(pyrene-R)?Ru(6)(pPr(i)C(6)H(4)Me)(6)(tpt)(2)(donq)(3)](6+) ([(pyrene-R)?2](6+)), respectively. The inclusion of six monosubstitutedpyrenyl-nucleosides (pyrene-R1 = 5'-(1-pyrenyl butanoate)-2'-deoxyuridine, pyrene-R2 = 5-fluoro-5'-(1-pyrenyl butanoate)-2'-deoxyuridine, pyrene-R3 = 5'-{N-[1-oxo-4-(1-pyrenyl)butyl]-glycyl}-2'-deoxyuridine, pyrene-R4 = 5-fluoro-5'-{N-[1-oxo-4-(1-pyrenyl)butyl]-glycyl}-2'-deoxyuridine, pyrene-R5 = 5-fluoro-5'-{N-[1-oxo-4-(1-pyrenyl)butyl]-phenylalanyl}-2'-deoxyvuridine, pyrene-R6 = 5-fluoro-5'-{N-[1-oxo-4-(1-pyrenyl)butyl]-phenylalanyl}-2'-deoxyuridine) has been accomplished. The carceplex nature of [(pyrene-R)?1](6+) with the pyrenyl moiety firmly encapsulated in the hydrophobic cavity of the cage with the nucleoside groups pointing outward was confirmed by NMR spectroscopy and electrospray ionization mass spectrometry (ESI-MS), while the host-guest nature of [(pyrene-R)?2](6+) was studied in solution by NMR techniques. In contrast to the floxuridine compounds used in the clinic, the host-guest complexes are highly water-soluble. Consequently, the cytotoxicities of these water-soluble compounds have been established using human ovarian A2780 and A2780cisR cancer cells. All the host-guest systems are more cytotoxic than the empty cages alone [1][CF(3)SO(3)](6) (IC(50) = 23 μM) and [2][CF(3)SO(3)](6) (IC(50) = 10 μM), the most active compound [pyrene-R4?1][CF(3)SO(3)](6)being 2 orders of magnitude more cytotoxic (IC(50) = 0.3 μM) on these human ovarian cancer cell lines (A2780 and A2780cisR).     

Examination of the long-range effects of aminofluorene-induced conformational heterogeneity and its relevance to the mechanism of translesional DNA synthesis

Adduct-induced conformational heterogeneity complicates the understanding of how DNA adducts exert mutation. A case in point is the N-deacetylated AF lesion [N-(2'-deoxyguanosin-8-yl)-2-aminofluorene], the major adduct derived from the strong liver carcinogen N-acetyl-2-aminofluorene. Three conformational families have been previously characterized and are dependent on the positioning of the aminofluorene rings: B is in the "B-DNA" major groove, S is "stacked" into the helix with base-displacement, and W is "wedged" into the minor groove. Here, we conducted (19)F NMR, CD, T(m), and modeling experiments at various primer positions with respect to a template modified by a fluorine tagged AF-adduct (FAF). In the first set, the FAF-G was paired with C and in the second set it was paired with A. The FAF-G:C oligonucleotides were found to preferentially adopt the B or S-conformers while the FAF-G:A mismatch ones preferred the B and W-conformers. The conformational preferences of both series were dependent on temperature and complementary strand length; the largest differences in conformation were displayed at lower temperatures. The CD and T(m) results are in general agreement with the NMR data. Molecular modeling indicated that the aminofluorene moiety in the minor groove of the W-conformer would impose a steric clash with the tight-packing amino acid residues on the DNA binding area of the Bacillus fragment (BF), a replicative DNA polymerase. In the case of the B-type conformer, the carcinogenic moiety resides in the solvent-exposed major groove throughout the replication/translocation process. The present dynamic NMR results, combined with previous primer extension kinetic data by Miller & Grollman, support a model in which adduct-induced conformational heterogeneities at positions remote from the replication fork affect polymerase function through a long-range DNA-protein interaction.     

On the sequence selective bis-intercalation of a homodimeric thiazole orange dye in DNA.

The thiazole orange dye 1,1'-(4,4,8,8-tetramethyl-4, 8-diazaundecamethylene)-bis-4-[(3-methyl-2,3-dihydro(benzo-1, 3-thiazolyl)-2-methylidene]quinolinium tetraiodide (TOTO) binds sequence selectively to double-stranded DNA (dsDNA) by bis-intercalation. Each chromophore is sandwiched between two base pairs in a d(5'-py-p-py-3'):d(5'-pu-p-pu-3') site, and the linker spans over two base pairs in the minor groove. We have examined the binding of TOTO to various dsDNA oligonucleotides containing variations of the 5'-CTAG-3' binding motif by introducing inosine (I = inosine, 2-desaminoguanosine) and 5-methylcytosine ((me)C). A one- and two-dimensional NMR spectroscopy characterization yielded detailed structural information on the binding mode and for the well-defined TOTO-complexes competition experiments allowed determination of the relative binding strengths resulting from the various structural alterations. The experimentally observed base pair preference of TOTO in the palindromic sequences investigated is (me)CG > CG > CI > TA for the flanking base pair and (me)CI > CI > TA > CG > UA for the central base pair. The best binding site observed so far is the d(5-C(me)CIG-3')(2) site. This site is much more favorable than the d(5'-CTAG-3')(2) site formerly believed to be the best binding site. The present paper discusses these results in terms of different contributions to the binding affinity and offers some explanations for the site selectivity of TOTO.