Features of the adeno-associated virus origin involved in substrate recognition by the viral Rep protein.

We previously demonstrated that the adeno-associated virus (AAV) Rep68 and Rep78 proteins are able to nick the AAV origin of DNA replication at the terminal resolution site (trs) in an ATP-dependent manner. Using four types of modified or mutant substrates, we now have investigated the substrate requirements of Rep68 in the trs endonuclease reaction. In the first kind of substrate, portions of the hairpinned AAV terminal repeat were deleted. Only deletions that retained virtually all of the small internal palindromes of the AAV terminal repeat were active in the endonuclease reaction. This result confirmed previous genetic and biochemical evidence that the secondary structure of the terminal repeat was an important feature for substrate recognition. In the second type of substrate, the trs was moved eight bases further away from the end of the genome. The mutant was nicked at a 50-fold-lower frequency relative to a wild-type origin, and the nick occurred at the correct trs sequence despite its new position. This finding indicated that the endonuclease reaction required a specific sequence at the trs in addition to the correct secondary structure. It also suggested that the minimum trs recognition sequence extended three bases from the cut site in the 3' direction. The third type of substrate harbored mismatched base pairs at the trs. The mismatch substrates contained a wild-type sequence on the strand normally cut but an incorrect sequence on the complementary strand. All of the mismatch mutants were capable of being nicked in the presence of ATP. However, there was substantial variation in the level of activity, suggesting that the sequence on the opposite strand may also be recognized during nicking. Analysis of the mismatch mutants also suggested that a single-stranded trs was a viable substrate for the enzyme. This interpretation was confirmed by analysis of the fourth type of substrate tested, which contained a single-stranded trs. This substrate was also cleaved efficiently by the enzyme provided that the correct strand was present in the substrate. In addition, the single-stranded substrate no longer required ATP as a cofactor for nicking. Finally, all of the substrates with mutant trss bound the Rep protein as efficiently as the wild-type did. This finding indicated that the sequence at the cut site was not involved in recognition of the terminal repeat for specific binding by the enzyme. We concluded that substrate recognition by the AAV Rep protein involves at least two and possibly as many as four features of the AAV terminal repeat.(ABSTRACT TRUNCATED AT 400 WORDS)     

The Rep protein of adeno-associated virus type 2 interacts with single-stranded DNA-binding proteins that enhance viral replication

Adeno-associated virus (AAV) type 2 is a human parvovirus whose replication is dependent upon cellular proteins as well as functions supplied by helper viruses. The minimal herpes simplex virus type 1 (HSV-1) proteins that support AAV replication in cell culture are the helicase-primase complex of UL5, UL8, and UL52, together with the UL29 gene product ICP8. We show that AAV and HSV-1 replication proteins colocalize at discrete intranuclear sites. Transfections with mutant genes demonstrate that enzymatic functions of the helicase-primase are not essential. The ICP8 protein alone enhances AAV replication in an in vitro assay. We also show localization of the cellular replication protein A (RPA) at AAV centers under a variety of conditions that support replication. In vitro assays demonstrate that the AAV Rep68 and Rep78 proteins interact with the single-stranded DNA-binding proteins (ssDBPs) of Ad (Ad-DBP), HSV-1 (ICP8), and the cell (RPA) and that these proteins enhance binding and nicking of Rep proteins at the origin. These results highlight the importance of intranuclear localization and suggest that Rep interaction with multiple ssDBPs allows AAV to replicate under a diverse set of conditions.     

Coupled ATP and DNA binding of adeno-associated virus Rep40 helicase

Adeno-associated virus 2 Rep40 helicase is involved in packaging single-stranded genomic DNA into virions. ATPase activity was stimulated 5-10-fold by DNA, depending upon assay conditions. The concentration dependence of Rep40 ATPase activity in the absence and presence of DNA indicates that the monomer is inactive and that the active enzyme is at least a dimer. Binding to oligonucleotides, examined by fluorescence anisotropy, was positively cooperative and required ATP or ATPgammaS; ADP and AMPPCP did not promote binding. The cooperativity and the nucleotide requirement were also demonstrated by surface plasmon resonance. Although the Rep40 behaves as a monomer in solution, it binds to DNA as an oligomer. The requirement of a nucleotide for DNA binding and the stimulation of ATPase activity by DNA indicate that the two processes are linked. Glutaraldehyde cross-linking generated a species that migrates as a trimer on sodium dodecyl sulfate (SDS) gel electrophoresis; ATPS promoted the formation of this species and higher order oligomers. The predominant cross-linked species was a trimer in the absence of ATPgammaS, regardless of whether duplex or single-stranded DNA was present. In the presence of duplex or single-stranded DNA and ATPgammaS, glutaraldehyde cross-linking generated a species that behaved as a dimer on SDS gel elctrophoresis. Sucrose-gradient velocity sedimentation of Rep40 gave an S20,w of 3 in the absence of ligands or in the presence of a 26 bp duplex DNA. The S20,w was 3.5 in the presence of ATPgammaS and 7 and 7.6 in the presence of DNA and ATPgammaS.     

Determination of adeno-associated virus Rep68 and Rep78 binding sites by random sequence oligonucleotide selection.

To further define the canonical binding site for the P5-promoted Rep proteins of the adeno-associated virus, a modified random oligonucleotide selection procedure was performed, using purified recombinant Rep protein. These results may explain the effects of Rep on cellular gene expression.     

Stable secondary structure near the nicking site for adeno-associated virus type 2 Rep proteins on human chromosome 19

Adeno-associated virus serotype 2 (AAV-2) can preferentially integrate its DNA into a 4-kb region of human chromosome 19, designated AAVS1. The nicking activity of AAV-2's Rep68 or Rep78 proteins is essential for preferential integration. These proteins nick at the viral origin of DNA replication and at a similar site within AAVS1. The current nicking model suggests that the strand containing the nicking site is separated from its complementary strand prior to nicking. In AAV serotypes 1 through 6, the nicking site is flanked by a sequence that is predicted to form a stem-loop with standard Watson-Crick base pairing. The region flanking the nicking site in AAVS1 (5'-GGCGGCGGT/TGGGGCTCG-3' [the slash indicates the nicking site]) lacks extensive potential for Watson-Crick base pairing. We therefore performed an empirical search for a stable secondary structure. By comparing the migration of radiolabeled oligonucleotides containing wild-type or mutated sequences from the AAVS1 nicking site to appropriate standards, on native and denaturing polyacrylamide gels, we have found evidence that this region forms a stable secondary structure. Further confirmation was provided by circular dichroism analyses. We identified six bases that appear to be important in forming this putative secondary structure. Mutation of five of these bases, within the context of a double-stranded nicking substrate, reduces the ability of the substrate to be nicked by Rep78 in vitro. Four of these five bases are outside the previously recognized GTTGG nicking site motif and include parts of the CTC motif that has been demonstrated to be important for integration targeting.     

Sequence requirements for binding of Rep68 to the adeno-associated virus terminal repeats.

We have used reciprocal competition binding experiments with mutant substrates and chemical modification interference assays to precisely define the sequences within the adeno-associated virus (AAV) terminal repeat (TR) that are involved in site-specific binding to the AAV Rep protein. Mutagenesis experiments were done with a 43-bp oligonucleotide which contained the Rep binding element (RBE) within the A stem of the TR. Experiments in which two adjacent base pairs of the RBE were substituted simultaneously with nucleotides that produced transversions identified a 22-bp sequence (CAGTGAGCGAGCGAGCGCGCAG) in which substitutions measurably affected the binding affinity. Although the 22-bp RBE contains the GAGC motifs that have been found in all known Rep binding sites, our results suggest that the GAGC motifs alone are not the only sequences specifically recognized by Rep. The effects of substitutions within the 22-bp sequence were relatively symmetrical, with nucleotides at the periphery of the RBE having the least effect on binding affinity and those in the middle having the greatest effect. Dinucleotide mutations within 18 (GTGAGCGAGCGAGC) of the 22 bp were found to decrease the binding affinity by at least threefold. Dinucleotide mutations within a 10-bp core sequence (GCGAGCGAGC) were found to decrease binding affinity by more than 10-fold. Single-base substitutions within the 10-bp core sequence lowered the binding affinity by variable amounts (up to fivefold). The results of the mutagenesis analysis suggested that the A-stem RBE contains only a single Rep binding site rather than two or more independent sites. To confirm the results of the mutant analysis and to determine the relative contribution of each base to binding, chemical modification experiments using dimethyl sulfate and hydrazine were performed on both the linear A-stem sequence and the entire AAV TR in both the flip and flop hairpinned configurations. Interference assays on the linear A stem identified the 18-bp sequence described above as essential for binding. G, C, and T residues on both strands contributed to binding, and the interference pattern correlated well with the results of the mutagenesis experiments. Interference assays with complete hairpinned TR substrates also identified the 18-bp sequence as important for binding. However, the interference patterns on the two strands within the RBE and the relative contributions of the individual bases to binding were clearly different between the hairpinned substrates and the linear A-stem binding element. Interference assays also allowed us to search for residues within the small internal palindromes of the TR (B and C) that contribute to binding. The largest effect was seen by modification of two T residues within the sequence CTTTG. This sequence was present in the same position relative to the terminal resolution site (trs) in both the flip and flop orientations of the TR. In addition, the interference pattern suggested that the remaining bases within the CTTTG motif as well as other bases within the B and C palindromes make contacts with the Rep protein, albeit with lower affinities. Regardless of whether the TR was in the flip or flop orientation, most of the contact points were clustered in the small internal palindrome furthest away from the trs. We also determined the relative binding affinity of linear substrates containing a complete RBE with hairpinned substrates and found that linear substrates bound Rep less efficiently. Our results were consistent with our previous model that there are three distinct elements within the hairpinned AAV TR that contribute to binding affinity or to efficient nicking at the trs: the A-stem RBE, the secondary structure element which consists of the B and C palindromes, and the trs.     

Activation of the ATPase activity of adeno-associated virus Rep68 and Rep78

Rep68 and Rep78 DNA helicases, encoded by adeno-associated virus 2 (AAV2), are required for replication of AAV viral DNA in infected cells. They bind to imperfect palindromic elements in the inverted terminal repeat structures at the 3'- and 5'-ends of virion DNA. The ATPase activity of Rep68 and Rep78 is stimulated up to 10-fold by DNA containing the target sequence derived from the inverted terminal repeat; nontarget DNA stimulates ATPase activity at 50-fold higher concentrations. Activation of ATPase activity of Rep68 by DNA is cooperative with a Hill coefficient of 1.8 +/- 0.2. When examined by gel filtration at 0.5 M NaCl in the absence of DNA, Rep68 self-associates in a concentration-dependent manner. In the presence of DNA containing the binding element, Rep68 (and Rep78) forms protein-DNA complexes that exhibit concentration-dependent self-association in gel filtration analysis. The ATPase activity of the isolated Rep68-DNA and Rep78-DNA complexes is not activated by additional target DNA. Results of sedimentation velocity experiments in the presence of saturating target DNA are consistent with Rep68 forming a hexamer of the protein with two copies of the DNA element. Activation of the ATPase activity of Rep68 is associated with the formation of a protein-DNA oligomer.     

Determination of the origin cleavage and joining domain of geminivirus Rep proteins.

Replication of the single-stranded DNA genome of plant geminiviruses follows a rolling circle mechanism. It strictly depends on a 'rolling circle replication initiator protein', the M(r) 41 kDa viral Rep protein, encoded by the C1 or AC1 genes. Using wheat dwarf virus (WDV) and tomato yellow leaf curl virus (TYLCV) as examples, we show that not only the full-size Rep proteins, but also a putative 30 kDa translation product of WDV open reading frame C1-N as well as an artificially shortened 24 kDa Rep of TYLCV, cleave and join single-stranded origin DNA in vitro. Thus the pivotal origin recognition and processing activities of geminivirus Rep proteins must be mediated by the amino-terminal domain of Rep.     

Colocalization of adeno-associated virus Rep and capsid proteins in the nuclei of infected cells.

The mechanism of adeno-associated virus (AAV) DNA replication was characterized both genetically and biochemically. In this study, we used monoclonal and polyclonal antibodies to examine the AAV p5 (Rep78 and Rep68) and p19 (Rep52 and Rep40) proteins in infected cells. By overexpressing a truncated Rep78 protein in Escherichia coli, we obtained monoclonal antibody anti-78/68, which is specific for the p5 Rep proteins, and monoclonal antibody anti-52/40, which recognized both the p5 and p19 Rep proteins. In single-fluorochrome indirect immunofluorescence labeling experiments, the viral Rep proteins were localized in distinct intranuclear foci. Analysis of AAV proteins by double-fluorochrome indirect immunofluorescence experiments demonstrated that (i) all four AAV Rep proteins occupied the same intranuclear compartments and (ii) the Rep and capsid proteins colocalized in the nuclei of infected cells. These results suggest that replication centers similar to those established by other viruses exist for AAV. These reagents should provide a useful tool for further delineation of the mechanism of AAV replication in vitro.     

Biologically active Rep proteins of adeno-associated virus type 2 produced as fusion proteins in Escherichia coli.

Four Rep proteins are encoded by the human parvovirus adeno-associated virus type 2 (AAV). The two largest proteins, Rep68 and Rep78, have been shown in vitro to perform several activities related to AAV DNA replication. The Rep78 and Rep68 proteins are likely to be involved in the targeted integration of the AAV DNA into human chromosome 19, and the full characterization of these proteins is important for exploiting this phenomenon for the use of AAV as a vector for gene therapy. To obtain sufficient quantities for facilitating the characterization of the biochemical properties of the Rep proteins, the AAV rep open reading frame was cloned and expressed in Escherichia coli as a fusion protein with maltose-binding protein (MBP). Recombinant MBP-Rep68 and MBP-Rep78 proteins displayed the following activities reported for wild-type Rep proteins when assayed in vitro: (i) binding to the AAV inverted terminal repeat (ITR), (ii) helicase activity, (iii) site-specific (terminal resolution site) endonuclease activity, (iv) binding to a sequence within the integration locus for AAV DNA on human chromosome 19, and (v) stimulation of radiolabeling of DNA containing the AAV ITR in a cell extract. These five activities have been described for wild-type Rep produced from mammalian cell extracts. Furthermore, we recharacterized the sequence requirements for Rep binding to the ITR and found that only the A and A' regions are necessary, not the hairpin form of the ITR.     

Identification of the trans-acting Rep proteins of adeno-associated virus by antibodies to a synthetic oligopeptide.

Prior genetic analysis provided evidence for trans-acting regulatory proteins (Rep) coded by the left-hand open reading frame (orf-1) of adeno-associated virus (AAV). We have used immunoblotting analysis to identify four protein products of orf-1. Antibodies elicited against an oligopeptide encoded by orf-1 were reacted with extracts of cells that were infected with AAV or transfected with AAV recombinant vectors in the presence or absence of helper adenovirus. The antibody recognized four polypeptides with apparent molecular weights of 78,000, 68,000, 52,000, and 40,000. The 78,000-dalton (78K) (Rep78) and 68K (Rep68) proteins appear to be encoded by the unspliced 4.2-kilobase (kb) and spliced 3.9-kb mRNAs, respectively, transcribed from the p5 promoter. The 52K (Rep52) and 40K (Rep40) proteins appear to be the products of the unspliced 3.6-kb and the spliced 3.3-kb mRNAs, respectively, transcribed from the p19 promoter. Rigorous identification of Rep68 as an AAV-coded protein is compromised by a cross-reacting cellular protein of similar size. All four proteins were expressed in the human cell lines 293, HeLa, HT29, and A549 infected with AAV together with adenovirus. Rep78 and Rep52 were detected at lower levels in cells infected with AAV at high multiplicity in the absence of adenovirus. Human 293 cells transfected with a recombinant AAV vector (pAV2) also expressed Rep proteins in the presence or absence of adenovirus. Mutations introduced into the Rep region of pAV2 further identified the Rep proteins. The amount of each Rep protein varied between nuclear and cytoplasmic extracts, but all four proteins accumulated during the lytic cycle of the viral infection. Other studies have indicated that the Rep proteins have independent trans-acting functions in viral DNA replication and negative and positive regulation of gene expression. Correlation of each trans-acting function with individual Rep proteins will be facilitated with the antibodies described herein.     

A biochemical characterization of the adeno-associated virus Rep40 helicase

The human adeno-associated virus (AAV) has generated much enthusiasm as a transfer vector for human gene therapy. Although clinical gene therapy trials have been initiated using AAV vectors, much remains to be learned regarding the basic mechanisms of virus replication, gene expression, and virion assembly. AAV encodes four nonstructural, or replication (Rep), proteins. The Rep78 and Rep68 proteins regulate viral DNA replication, chromosomal integration, and gene expression. The Rep52 and Rep40 proteins mediate virus assembly. To better understand Rep protein function, we have expressed the Rep40 protein in Escherichia coli and purified it to near homogeneity. Like the other Rep proteins, Rep40 possesses helicase and ATPase activity. ATP is the best substrate, and Mg2+ is the most efficient divalent metal ion for helicase activity. A Lys to His mutation in the purine nucleotide-binding site results in a protein that inhibits helicase activity in a dominant negative manner. Rep40 unwinds double-stranded DNA containing a 3' single-stranded end, or blunt end, unlike the Rep68 and Rep52 enzymes, which have a strict requirement for DNA duplexes containing a 3' single-stranded end. Values for KATP in the ATPase assay are 1.1 +/- 0.2 mM and 1.2 +/- 0.2 mM in the absence and presence, respectively, of single-stranded DNA. Values for Vmax are 220 +/- 10 and 1,500 +/- 90 nmol/min/mg in the absence and presence, respectively, of single-stranded DNA. These studies provide the first enzymatic characterization of the AAV Rep40 protein and elucidate important functional differences between the AAV helicases.     

A Rep recognition sequence is necessary but not sufficient for nicking of DNA by adeno-associated virus type-2 Rep proteins

The strand-specific, site-specific endonuclease (nicking) activity of the Rep68 and Rep78 (Rep68/78) proteins of adeno-associated virus type 2 (AAV) is involved in AAV replication, and appears to be involved in AAV site-specific integration. Rep68/78 cuts within the inverted terminal repeats (ITRs) of the AAV genome and in the AAV preferred integration locus on human chromosome 19 (AAVS1). The known endonuclease cut sites are 11-16 bases away from the primary binding sites, known as Rep recognition sequences (RRSs). A linear, double-stranded segment of DNA, containing an RRS and a cut site, has previously been shown to function as a substrate for the Rep68/78 endonuclease activity. We show here that mutation of the Rep recognition sequence, within such a DNA segment derived from the AAV ITRs, eliminates the ability of this substrate to be cleaved detectably by Rep78. Rep78 nicks the RRS-containing site from AAVS1 about half as well as the linear ITR sequence. Eighteen other RRS-containing sequences found in the human genome, but outside AAVS1, are not cleaved by Rep78. These results may help to explain the specificity of AAV integration.     

The crystal structure of the SV40 T-antigen origin binding domain in complex with DNA

DNA replication is initiated upon binding of “initiators” to origins of replication. In simian virus 40 (SV40), the core origin contains four pentanucleotide binding sites organized as pairs of inverted repeats. Here we describe the crystal structures of the origin binding domain (obd) of the SV40 large T-antigen (T-ag) both with and without a subfragment of origin-containing DNA. In the co-structure, two T-ag obds are oriented in a head-to-head fashion on the same face of the DNA, and each T-ag obd engages the major groove. Although the obds are very close to each other when bound to this DNA target, they do not contact one another. These data provide a high-resolution structural model that explains site-specific binding to the origin and suggests how these interactions help direct the oligomerization events that culminate in assembly of the helicase-active dodecameric complex of T-ag.     

Identification of the galactose binding domain of the adeno-associated virus serotype 9 capsid

Adeno-associated virus serotype 9 (AAV9) vectors show promise for gene therapy of a variety of diseases due to their ability to transduce multiple tissues, including heart, skeletal muscle, and the alveolar epithelium of the lung. In addition, AAV9 is unique compared to other AAV serotypes in that it is capable of surpassing the blood-brain barrier and transducing neurons in the brain and spinal cord. It has recently been shown that AAV9 uses galactose as a receptor to transduce many different cell types in vitro, as well as cells of the mouse airway in vivo. In this study, we sought to identify the specific amino acids of the AAV9 capsid necessary for binding to galactose. By site-directed mutagenesis and cell binding assays, plus computational ligand docking studies, we discovered five amino acids, including N470, D271, N272, Y446, and W503, which are required for galactose binding that form a pocket at the base of the protrusions around the icosahedral 3-fold axes of symmetry. The importance of these amino acids for tissue tropism was also confirmed by in vivo studies in the mouse lung. Identifying the interactions necessary for AAV9 binding to galactose may lead to advances in vector engineering.