Internal dynamics in a DNA triple helix probed by (1)H-(15)N-NMR spectroscopy

The amino group of adenine plays a key role in maintaining DNA triple helical structures, being the only functional group in DNA that is involved in both Watson-Crick and Hoogsteen hydrogen bonds. In the present work we have probed the internal dynamics of the adenine amino group in the intramolecular YRY triple helix formed by the 31-mer DNA oligonucleotide d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT). The DNA triple helix was specifically labeled with (15)N at the amino group of the adenine in the fifth position. The rotation rate of the labeled amino group was measured as a function of temperature using (1)H-(15)N heteronuclear NMR spectroscopy. The results indicate that, in the DNA triple helix, the rotation of the adenine amino group is greatly slowed relative to that in a DNA double helix. The temperature dependence of the rotation rate suggests a large entropic contribution to this effect, which may originate from different hydration patterns of the adenine amino group in the two structures.     

15N labeling of oligodeoxynucleotides for NMR studies of DNA-ligand interactions.

The amino protons of 15N-labeled DNA were studied as a possible structural probe in NMR investigations of the interaction of DNA with various ligands. Since the imino protons are located in the center of the double helix, and variations of their chemical shift values are difficult to interpret in terms of structural changes, these probes are not very useful. Instead, amino protons are located in the major or minor groove of the DNA and are often directly involved in the binding of a ligand. For a selective probing 4-15NH2-2'-deoxycytidine and 6-15NH2-2'-deoxyadenosine were obtained by chemical synthesis. The labeled nucleosides were introduced in distinct positions of oligodeoxynucleotides by large-scale DNA synthesis. Direct 15N NMR and 1H-15N multiple quantum NMR were applied to detect the corresponding 15N labels or protons attached to the 15N labels. Chemical shift values for the cytidine and the adenosine amino nitrogen and proton resonances of a symmetric 18 base pair lac operator sequence are reported.     

Hydration of the RNA duplex r(CGCAAAUUUGCG)2 determined by NMR.

The so-called spine of hydration in the minor groove of AnTn tracts in DNA is thought to stabilise the structure, and kinetically bound water detected in the minor groove of such DNA species by NMR has been attributed to a narrow minor groove [Liepinsh, E., Leupin, W. and Otting, G. (1994) Nucleic Acids Res. 22, 2249-2254]. We report here an NMR study of hydration of an RNA dodecamer which has a wide, shallow minor groove. Complete assignments of exchangeable protons, and a large number of non-exchangeable protons in r(CGCAAAUUUGCG)2 have been obtained. In addition, ribose C2'-OH resonances have been detected, which are probably involved in hydrogen bonds. Hydration at different sites in the dodecamer has been measured using ROESY and NOESY experiments at 11.75 and 14.1 T. Base protons in both the major and minor grooves are in contact with water, with effective correlation times for the interaction of approximately 0.5 ns, indicating weak hydration, in contrast to the hydration of adenine C2H in the homologous DNA sequence. NOEs to H1' in the minor groove are consistent with hydration water present that is not observed in the analogous DNA sequence. Hydration kinetics in nucleic acids may be determined by chemical factors such as hydrogen-bonding more than by simple conformational factors such as groove width.     

1H NMR studies on the interaction between distamycin A and a symmetrical DNA dodecamer

High-resolution NMR techniques have been used to examine the structural and dynamical features of the interaction between distamycin A and the self-complementary DNA dodecamer duplex d-(CGCGAATTCGCG)2. The proton resonances of d(CGCGAATTCGCG)2 have been completely assigned by previous two-dimensional NMR studies [Hare, D. R., Wemmer, D. E., Chou, S. H., Drobny, G., & Reid, B. R. (1983) J. Mol. Biol. 171, 319-336]. Addition of the asymmetric drug molecule to the symmetric dodecamer leads to the formation of an asymmetric complex as evidenced by a doubling of DNA resonances over much of the spectrum. In two-dimensional exchange experiments, strong cross-peaks were observed between uncomplexed DNA and drug-bound DNA resonances, permitting direct assignment of many drug-bound DNA resonances from previously assigned free DNA resonances. Weaker exchange cross-peaks between formerly symmetry related DNA resonances indicate that the drug molecule flips head-to-tail on one duplex with half the frequency at which it leaves the DNA molecule completely. In experiments performed in H2O, nuclear Overhauser effects (NOEs) were observed from each drug amide proton to an adenine C2H and a pyrrole H3 ring proton. In two-dimensional nuclear Overhauser experiments performed on D2O solutions, strong intermolecular NOEs were observed between each of the three pyrrole H3 resonances of the drug and an adenine C2H resonance, with weaker NOEs observed between the drug H3 resonances and C1'H resonances. The combined NOE data allow us to position the distamycin A unambiguously on the DNA dodecamer, with the drug spanning the central AATT segment in the minor groove.     

High-resolution NMR study of a synthetic DNA-RNA hybrid dodecamer containing the consensus pribnow promoter sequence: d(CGTTATAATGCG).r(CGCAUUAUAACG)

The nonsymmetrical double-helical hybrid dodecamer d(CGTTATAATGCG).r(CGCAUUAUAACG) was synthesized with solid-phase phosphoramidite methods and studied by high-resolution 2D NMR. The imino protons were assigned by one-dimensional nuclear Overhauser methods. All the base protons and H1', H2', H2", H3', and H4' sugar protons of the DNA strand and the base protons, H1', H2', and most of the H3'-H4' protons of the RNA strand were assigned by 2D NMR techniques. The well-resolved spectra allowed a qualitative analysis of relative proton-proton distances in both strands of the dodecamer. The chemical shifts of the hybrid duplex were compared to those of the pure DNA double helix with the same sequence (Wemmer et al., 1984). The intrastrand and cross-strand NOEs from adenine H2 to H1' resonances of neighboring base pairs exhibited characteristic patterns that were very useful for checking the spectral assignments, and their highly nonsymmetric nature reveals that the conformations of the two strands are quite different. Detailed analysis of the NOESY and COSY spectra, as well as the chemical shift data, indicate that the RNA strand assumes a normal A-type conformation (C3'-endo) whereas the DNA strand is in the general S domain but not exactly in the normal C2'-endo conformation. The overall structure of this RNA-DNA duplex is different from that reported for hybrid duplexes in solution by other groups (Reid et al., 1983a; Gupta et al., 1985) and is closer to the C3'-endo-C2'-endo hybrid found in poly(dA).poly(dT) and poly(rU).poly(dA) in the fiber state (Arnott et al., 1983, 1986).     

NMR studies on oligodeoxyribonucleotides containing the dam methylation site GATC. Comparison between d(GGATCC) and d(GGm6ATCC)

The conformation of two hexanucleotides, d(GGATCC) and d(GGm6ATCC), has been studied by proton nuclear magnetic resonance. Nuclear Overhauser effect (NOE) measurements on d(GGATCC) are in agreement with a normal B form right-handed helical structure. The single- and double-strand resonances are in fast exchange on a proton NMR time scale. The exchange is observed to be slow for d(GGm6ATCC); up to the Tm, separate resonances are observed for each state, though above the Tm exchange becomes more rapid. The preferred orientation of the adenosine methylamino group (methyl cis to N1) hinders base-pair formation. At 0 degree C irradiation of the m6A-T imino proton gives an NOE to AH2, showing that base pairing is Watson-Crick. Intra- and interresidue NOEs show that the helix is right handed and in the B form. Comparing results on the two oligomers demonstrates that adenosine methylation induces little or no change in the conformation of the helix but reduces the Tm from 45 to 32 degrees C. All of the amino proton resonances, as well as the imino resonances, have been assigned. From NOE experiments on the unmethylated oligomer we have located the Watson-Crick and non-Watson-Crick adenosine amino protons. At 0 degree C these resonances show broadening due to rotation of the amino group, and their rotation is slightly slower than for the adjacent guanosine amino group, though both these amino groups have lifetimes of less than 10 ms at 0 degree C. The imino protons show normal behavior, disappearing from the spectra ca. 20 degrees C below the Tm.(ABSTRACT TRUNCATED AT 250 WORDS)     

NMR investigations of duplex stability of phosphorothioate and phosphorodithioate DNA analogues modified in both strands.

Duplex formation from the self-complementary 12mer d(CGCGAATTCGCG) (Dickerson dodecamer) in which all phosphodiester linkages were replaced by phosphorothioate or phosphorodithioate linkages was studied using variable-temperature 1H and 31P NMR spectroscopy. Melting temperatures of the dodecamer, measured spectrophotometrically, showed significant decrease upon sulfur substitution (Tm 49 degrees C for the phosphorothioate and 21 degrees C for the phosphorodithioate, compared with 68 degrees C for the unmodified oligomer, in 1 M salt). Hyperchromicity observed upon melting of the dithioate was surprisingly low. NOESY spectra of the monothioate showed a cross-peak pattern characteristic for a right-handed duplex. Imino proton resonances of the duplex, shown by the mono- and the dithioate, were similar to those of the parent compound. In spite of monophasic melting curves, temperature dependence of the imino proton resonances and phosphorus resonances of the phosphorodithioate indicated heterogeneity with respect to base-pairing, compatible with the presence of a hairpin loop. Relaxation times (T1) of the imino protons in the phosphorothioate, determined by the saturation recovery method, were considerably shorter than in the unmodified oligomer. Base-pair lifetimes in the unmodified Dickerson dodecamer, determined by catalyst-dependent changes in relaxation rates of imino protons, were in the range of 2-30 ms at 20 degrees C. Strongly reduced base-pair lifetimes were found in the phosphorothioate analogue.     

Determination of the major tautomeric form of the covalently modified adenine in the (+)-CC-1065-DNA adduct by 1H and 15N NMR studies

(+)-CC-1065 is an extremely potent antitumor antibiotic produced by Streptomyces zelensis. The potent cytotoxic effects of the drug are thought to be due to the formation of a covalent adduct with DNA through N3 of adenine. Although the covalent linkage sites between (+)-CC-1065 and DNA have been determined, the tautomeric form of the covalently modified adenine in the (+)-CC-1065-DNA duplex adduct was not defined. A [6-15N]deoxyadenosine-labeled 12 base pair non-self-complementary oligomer, d(GGCGGAGTT*AGG).d(CCTAACTCCGCC) (asterisk indicates 15N-labeled base), containing the (+)-CC-1065 most preferred binding sequence 5'AGTTA, was synthesized and modified with (+)-CC-1065. This [6-15N]deoxyadenosine-labeled 12-mer duplex adduct was then studied by 1H and 15N NMR. One-dimensional NOE difference and two-dimensional NOESY 1H NMR experiments on the nonisotopically labeled 12-mer duplex adduct demonstrate that the 6-amino protons of the covalently modified adenine exhibit two signals at 9.19 and 9.08 ppm. Proton NMR experiments on the [6-15N]deoxyadenosine-labeled 12-mer duplex adduct show that the two resonance signals for adenine H6 observed on the nonisotopically labeled duplex adduct were split into doublets by the 15N nucleus with coupling constants of 91.3 Hz for non-hydrogen-bonded and 86.8 Hz for hydrogen-bonded amino protons. Parallel 15N NMR experiments on the [6-15N]deoxyadenosine-labeled (+)-CC-1065-12-mer duplex adduct show a triplet-like signal around -276.9 ppm and coupling constants of 91.5 and 85.6 Hz.(ABSTRACT TRUNCATED AT 250 WORDS)     

Assignment of the backbone 1H and 15N NMR resonances of bacteriophage T4 lysozyme

The proton and nitrogen (15NH-H alpha-H beta) resonances of bacteriophage T4 lysozyme were assigned by 15N-aided 1H NMR. The assignments were directed from the backbone amide 1H-15N nuclei, with the heteronuclear single-multiple-quantum coherence (HSMQC) spectrum of uniformly 15N enriched protein serving as the master template for this work. The main-chain amide 1H-15N resonances and H alpha resonances were resolved and classified into 18 amino acid types by using HMQC and 15N-edited COSY measurements, respectively, of T4 lysozymes selectively enriched with one or more of alpha-15N-labeled Ala, Arg, Asn, Asp, Gly, Gln, Glu, Ile, Leu, Lys, Met, Phe, Ser, Thr, Trp, Tyr, or Val. The heteronuclear spectra were complemented by proton DQF-COSY and TOCSY spectra of unlabeled protein in H2O and D2O buffers, from which the H beta resonances of many residues were identified. The NOE cross peaks to almost every amide proton were resolved in 15N-edited NOESY spectra of the selectively 15N enriched protein samples. Residue specific assignments were determined by using NOE connectivities between protons in the 15NH-H alpha-H beta spin systems of known amino acid type. Additional assignments of the aromatic proton resonances were obtained from 1H NMR spectra of unlabeled and selectively deuterated protein samples. The secondary structure of T4 lysozyme indicated from a qualitative analysis of the NOESY data is consistent with the crystallographic model of the protein.     

Dynamic behavior of the imino protons of the gamma OR3 17mer in H2O solution studied by high-resolution NMR

The imino proton resonances of gamma OR3 17mer in water were observed at 500 MHz with the time-shared Redfield pulse train. All of the 17 imino proton resonances could be assigned specifically to individual base pairs by utilizing the trace of NOE connectivities between the imino and adenine C2H protons and between imino protons themselves. AT1 and 17 showed abnormally high chemical shifts in comparison with the other AT pairs. On raising the temperature, broadening of the signal occurred in a sequential manner from the terminals except for AT10 and AT11, which were broadened at a lower temperature than GC12. The relaxation rates of the imino protons were measured by the inversion recovery method. The rates at higher temperatures represent the exchange rates of the imino protons. From the temperature dependences, activation energies of about 15 kcal/mol for the AT imino protons and 23-26 kcal/mol for the GC imino protons were obtained.     

Sequence-dependence of the energetics of opening of at basepairs in DNA

Proton exchange and nuclear magnetic resonance spectroscopy are being used to characterize the energetics of opening of AT/TA basepairs in the DNA dodecamer 5'-d(GCTATAAAAGGG)-3'/5'-d(CCCTTTTATAGC)-3'. The dodecamer contains the TATA box of the adenovirus major late promoter. The equilibrium constants for opening of each basepair are measured from the dependence of the exchange rates of imino protons on ammonia concentration. The enthalpy, entropy, and free energy changes in the opening reaction of each basepair are determined from the temperature dependence of the exchange rates. The results reveal that the opening enthalpy changes encompass a wide range of values, namely, from 17 to 29 kcal/mol. The largest values are observed for the AT basepairs in 7th and 8th positions. These values, and the exchange rates of the corresponding imino protons, suggest that these two basepairs open in a single concerted reaction. The enthalpy changes for opening of the central six basepairs are correlated to the opening entropy changes. This enthalpy-entropy compensation minimizes the variations in the opening free energies among these central basepairs. Deviations from the enthalpy-entropy compensation pattern are observed for basepairs located close to the ends of the duplex structure, suggesting a different mode of opening for these basepairs.     

Multinuclear magnetic resonance studies of the 2Fe.2S* ferredoxin from Anabaena species strain PCC 7120. 3. Detection and characterization of hyperfine-shifted nitrogen-15 and hydrogen-1 resonances of the oxidized form

All the nitrogen signals from the amino acid side chains and 80 of the total of 98 backbone nitrogen signals of the oxidized form of the 2Fe.2S* ferredoxin from Anabaena sp. strain PCC 7120 were assigned by means of a series of heteronuclear two-dimensional experiments [Oh, B.-H. Mooberry, E. S., & Markley, J. L. (1990) Biochemistry (second paper of three in this issue )]. Two additional nitrogen signals were observed in the one-dimensional 15N NMR spectrum and classified as backbone amide resonances from residues whose proton resonances experience paramagnetic broadening. The one-dimensional 15N NMR spectrum shows nine resonances that are hyperfine shifted and broadened. From this inventory of diamagnetic nitrogen signals and the available X-ray coordinates of a related ferredoxin [Tsukihara, T., Fukuyama, K., Nakamura, M., Katsube, Y., Tanaka, N., Kakudo, M., Wada, K., Hase, T., & Matsubara, H. (1981) J. Biochem. 90, 1763-1773], the resolved hyperfine-shifted 15N peaks were attributed to backbone amide nitrogens of the nine amino acids that share electrons with the 2Fe.2S* center or to backbone amide nitrogens of two other amino acids that are close to the 2Fe.2S* center. The seven 15N signals that are missing and unaccounted for probably are buried under the envelope of amide signals. 1H NMR signals from all the amide protons directly bonded to the seven missing and nine hyperfine-shifted nitrogens were too broad to be resolved in conventional 2D NMR spectra.(ABSTRACT TRUNCATED AT 250 WORDS)     

The propeller DNA conformation of poly(dA).poly(dT).

Physical properties of the DNA duplex, poly(dA).poly(dT) differ considerably from the alternating copolymer poly(dAT). A number of molecular models have been used to describe these structures obtained from fiber X-ray diffraction data. The recent solutions of single crystal DNA dodecamer structures with segments of oligo-A.oligo-T have revealed the presence of a high propeller twist in the AT regions which is stabilized by the formation of bifurcated (three-center) hydrogen bonds on the floor of the major groove, involving the N6 amino group of adenine hydrogen bonding to two O4 atoms of adjacent thymine residues on the opposite strand. Here we show that it is possible to incorporate the features of the single crystal analysis, specifically high propeller twist, bifurcated hydrogen bonds, and a narrow minor groove, as well as the close interstrand NMR signal between adenine HC2 and ribose HC1' of the opposite strand, into a model that is fully compatible with the diffraction data obtained from poly(dA).poly(dT).     

Decreased imino proton exchange and base-pair opening in the IHF-DNA complex measured by NMR.

Integration Host Factor, IHF, is an E. coli DNA binding protein that imposes a substantial bend on DNA. Previous footprinting studies and bending assays have characterized several recognition sequences in the bacterial and lambda phage genome as unique in the way they are bound by IHF. We have chosen one of the lambda phage sites, H1, for study because it presents a small yet sequence-specific substrate for NMR analysis of the complex. A 19 base-pair duplex, H19, corresponding to the recognition sequence at the H1 site was constructed by isotopically labeling one of the strands with 15N. (1H, 15N) heteronuclear NMR experiments aided in assigning the imino proton resonances of the DNA alone and in complex with IHF. The NMR results are consistent with a mode of binding observed in the recent crystal structure of IHF bound to another of its sites from the lambda phage genome. Additionally, the dramatic change that IHF imposes on the imino proton chemical shifts is indicative of a severe deviation from canonical B-DNA structure. In order to understand the dynamic properties of the DNA in the complex with IHF, the exchange rates of the imino protons with the solvent have been measured for H19 with and without IHF bound. A drastic reduction in exchange is observed for the imino protons in the IHF bound DNA. In the DNA-protein complex, groups of adjacent base-pair exchange at the same rate, and appear to close more slowly than the rate of imino proton exchange with bulk water, since their exchange rate is independent of catalyst concentration. We infer that segments of the double helix as large as 6 bp open in a cooperative process, and remain open much longer than is typical for opening fluctuations in naked duplex DNA. We discuss these results in terms of the specific protein-DNA contacts observed in the crystal structure.     

Sequence-specific interaction of Hoechst 33258 with the minor groove of an adenine-tract DNA duplex studied in solution by 1H NMR spectroscopy.

The interaction of Hoechst 33258 with the minor groove of the adenine-tract DNA duplex d(CTTTTGCAAAAG)2 has been studied in both D2O and H2O solutions by 1D and 2D 1H NMR spectroscopy. Thirty-one nuclear Overhauser effects between drug and nucleotide protons within the minor groove of the duplex, together with ring-current induced perturbations to the chemical shifts of basepair and deoxyribose protons, define the position and orientation of the bound dye molecules. Two drug molecules bind cooperatively and in symmetry related orientations at the centre of the 5'-TTTT and 5'-AAAA sequences with the binding interactions spanning only the four A-T basepairs. The positively charged N-methylpiperazine moieties point towards the centre of the duplex while the phenol groups are disposed towards the 3'-ends of the sequence. Resonance averaging is apparent for both the D2/D6 and D3/D5 phenol protons and D2"'/D6"' and D3"'/D5"' of the N-methylpiperazine ring and is consistent with these groups being involved in rapid rotation or ring-flipping motions in the bound state. Interstrand NOEs between adenine H2s and deoxyribose H1' are consistent with a high degree of propeller twisting of the A-T basepairs at the binding site of the aromatic benzimidazole and phenol rings of Hoechst. The data imply that the minor groove is particularly narrow with many contacts between the complementary curved surfaces of the drug and DNA indicating that strong van der Waals interactions, involving the floor and the walls of the minor groove, stabilize the complex. In our model the NH groups of the benzimidazole rings are positioned to make a pair of bifurcated hydrogen bonds with the adenine N3 and thymine O2 on the floor of the minor groove.     

Proton nuclear magnetic resonance investigation of the conformation and dynamics in the synthetic deoxyribonucleic acid decamers d(ATATCGATAT) and d(ATATGCATAT)

A variety of one-dimensional proton NMR methods have been used to investigate the properties of two synthetic DNA decamers, d(ATATCGATAT) and d(ATATGCATAT). These results, in conjunction with the results of two-dimensional NMR experiments, permit complete assignment of the base proton resonances. Low-field resonances were assigned by sequential "melting" of the A . T base pairs and by comparison of the spectra of the two decamers. Below 20 degree C spin-lattice relaxation is dominated by through-space dipolar interactions. A substantial isotope effect on the G imino proton relaxation is observed in 75% D2O, confirming the importance of the exchangeable amino protons in the relaxation process. A somewhat smaller isotope effect is observed on the T imino proton relaxation. At elevated temperatures spin-lattice relaxation of the imino protons is due to proton exchange with solvent. Apparent activation energies for exchange vary from 36 kcal/base pair for base pairs (3,8) to 64 kcal/mol for the most interior base pairs (5,6), indicating that disruption of part, or all, of the double helix contributes significantly to the exchange of the imino protons in these decamers. By contrast, single base pair opening events are the major low-temperature pathways for exchange from A X T and G X C base pairs in the more stable higher molecular weight DNA examined in other studies. The temperature dependence of the chemical shifts and line widths of certain aromatic resonances indicates that the interconversion between the helix and coil states is not in fast exchange below the melting temperature, Tm. Within experimental error, no differential melting of base pairs was found in either molecule, and both exhibited melting points Tm = 50-52 degrees C. Spin-spin and spin-lattice relaxation rates of the nonexchangeable protons (TH6, AH8, and AH2) are consistent with values calculated by using an isotropic rotor model with a rotational correlation time of 6 ns and interproton distances appropriate for B-family DNA. The faster decay of AH8 compared with GH8 is attributed to an interaction between the thymine methyl protons and the AH8 protons in adjacent adenines (5'ApT3'). The base protons (AH8, GH8, and TH6) appear to be located close (1.9-2.3 A) to sugar H2',2" protons.(ABSTRACT TRUNCATED AT 400 WORDS)     

High-resolution NMR of exchangeable protons in arginine,oligoarginines, and the arginine-rich histone tetramer

High-resolution nmr of exchangeable protons in the side chain of arginine reveals two distinct resonances arising from restricted rotation about the N(1)–C(ε) bond. Spectral assignments based upon pH-dependent proton-exchange behaviour identified each resonance as arising from one of the magnetically distinct guanidinium amino groups in the molecule. Computer simulation of the temperature-dependent coalescence of these peaks defines an activation energy of 14.3 kcal/mol for internal rotation about this bond. Similar results to those observed in monoarginine are reported for diarginine, triarginine, and the arginine-rich histone tetramer. Based on these findings, a nonsymmetric mode of arginine–ligand interaction is suggested, and the molecular dynamics of proton exchange in the arginine side chain is discussed.     

1H NMR studies of selective interactions of norfloxacin with double-stranded DNA

The interaction of the antibiotic drug norfloxacin with double-stranded DNA containing interior 5'-CpG-3', 5'-GpC-3', and 5'-GpG-3' steps was studied by 1H NMR. The drug is in fast exchange on the NMR timescale. A highly selective broadening of the imino proton resonances assigned to central CpG steps was observed after addition of drug, indicating an intercalation-like interaction. DNA sequences with central CpG steps also displayed broadening of non-hydrogen-bonded cytosine amino protons in the major groove upon addition of norfloxacin. Furthermore, a sequence-independent selective broadening of the adenine H2 resonance and an upfield shift of the guanine amino proton resonance, both protons located in the minor groove, was observed. Two-dimensional-NOESY spectra showed that no significant structural changes were induced in the DNA by the drug. The results suggest that the planar two-ring system of norfloxacin partially intercalates into CpG steps and that the drug also exhibits non-specific groove binding.     

On the mechanism of DNA-adenine methylase

Experiments were performed to determine whether EcoRI methylase catalyzes the transfer of the methyl group of S-adenosylmethionine (a) directly to the N6 of adenine in DNA or (b) initially to N1 to give N1-methyladenine followed by isomerization of the N1-methylamino and 6-NH2 to give N6-methyladenine (Dimroth rearrangement). A facile synthesis of highly enriched [6-15N]deoxyadenosine and a dodecamer substrate of EcoRI methylase with [6-15N]adenine in the methylation site are reported. In the product of EcoRI enzymatic methylation, all of the isotope remains at the N6 position of the N6-methyladenine product. It is concluded that, contrary to existing chemical precedent, the methylation occurs by direct transfer from S-adenosylmethionine to the N6 of adenine in DNA.