Sorghum chlorotic spot virus binds to potyvirus cylindrical inclusions in tobacco leaf cells

Nicotiana benthamiana can be doubly infected with either potato virus Y or tobacco etch virus and sorghum chlorotic spot virus (SCSV). Immunogold labeling showed that cylindrical inclusions of either potyvirus bind virions of the unrelated rod-shaped furovirus SCSV. Not all cells in doubly infected N. benthamiana plants contained both viruses. In cells infected by the potyviruses but not by SCSV, cylindrical inclusions did not label with the antiserum to SCSV. Numbers of cells infected with SCSV did not increase in doubly infected plants compared to those in plants infected with SCSV alone. Systemic infection of N. benthamiana by either potyvirus was not prevented by SCSV infections. This provides further evidence that unrelated rod-shaped viruses can bind to potyvirus cylindrical inclusion bodies, and that this phenomenon is not limited to graminaceous hosts.     

Pathology and properties of tulip virus X, a new potexvirus

Tulip virus X (TVX), a previously undescribed mechanically transmissible virus, causes chlorotic and necrotic lesions in leaves and streaks of intensified pigmentation in tepals of tulip plants. The virus infected 22 of 42 other plant species in 10 of 14 families, but most host species were infected only erratically. TVX is best propagated in Chenopodium quinoa and assayed in C. amaranticolor. Spindleshaped inclusions were observed in epidermal cells of C. amaranticolor leaves. Leaf extracts from C. quinoa contained flexuous filamentous particles measuring c. 495 ×13 nm. The extracts were infective after dilution to 10^-9, after heating for 10 min at 60 °C but not at 65 °C, and after storage at c. 20 °C for 30 days or at -20 °C for 6 months. TVX particles were purified (500 μg/g C. quinoa leaf) from tissue extracts in 0.067 M phosphate buffer containing 10 mM EDTA at pH 7, by twice precipitating the virus with 8% polyethylene glycol in 0.2 M NaCl followed by differential centrifugation. The virus particles have a sedimentation coefficient (s_{20, w}) of 102 S. They contain a protein of mol. wt c. 22 500 and a nucleic acid that, when glyoxalated, migrates in agarose gel like single-stranded RNA of mol. wt 2.05 × 10⁶. TVX particles tend to aggregate, and evidence was obtained that a 118 S component which was consistently observed in purified preparations and in infective sap is an end-to-end dimer. A distant serological relationship was found between particles of TVX and those of viola mottle and hydrangea ringspot viruses, but no serological relationship was detected to nine other potexviruses. TVX is considered to be a distinct and definitive member of the potexvirus group.     

Groundnut eyespot virus, a new member of the potyvirus group

A virus causing ‘eyespot’ leaf symptoms in groundnut plants was transmitted by sap-inoculation and by Aphis craccivora in the non-persistent manner. It infected 16 of 72 species from five of 12 families and was easily propagated in Arachis hypogaea and Physalis floridana. The virus has particles c. 13 × 755 nm and is serologically closely related to soybean mosaic and pepper veinal mottle viruses, and more distantly to four other potyviruses. The virus differs in host range, in vitro properties and serological properties from previously described strains of soybean mosaic and pepper veinal mottle viruses. It seems to be a distinct member of the potyvirus group and we propose the name groundnut eyespot virus.     

Garlic yellow streak virus, a potyvirus infecting garlic in New Zealand

In New Zealand, all garlic (Allium sativum) plants tested were infected by a virus with flexuous filamentous particles 700–800 nm long. This virus, called garlic yellow streak virus (GYSV), infected only two of 12 species tested and was transmitted to garlic by the aphid Myzus persicae in a non-persistent manner. In garlic sap, GYSV was infective at a dilution of 10^-4 but not 10^-3, after heating for 10 min at 60°C but not 65°C, and after 2 days but not 3 days at 25°C. The yield of virus, purified from naturally infected garlic, was 3–4 mg/kg fresh leaf. Preparations had A₂₆₀/A₂₈₀= 1.28 and A_man/A_min= 1.08. The virus particles had a sedimentation coefficient of 149S and a buoyant density in CsCl of 1.334 g/cm³. Mol. wt estimates for the virus nucleic acid were 2.95 × 10⁶ by electrophoresis in polyacrylamide gels and 3.46 × 10⁶ from the sedimentation coefficient (41.4S) in linear-log sucrose density gradients. Two polypeptides were detected in virus preparations; one (mol. wt 30 500) was possibly a breakdown product of the other (mol. wt 33 000). GYSV was serologically distantly related to onion yellow dwarf and leek yellow stripe viruses but was considered to be a separate virus because it differed from them in host range.     

Characterisation of a variant of zucchini yellow fleck virus (ZYFV), a potyvirus causing a wilt disease of melons in Israel*

A flexuous filamentous virus 750 nm in length was isolated from field-grown melons (Cucumis melo L.) and squirting cucumber (Ecballium elaterium L.). Infection of melon seedlings of most commercial varieties resulted in a lethal wilting, but late infections gave dieback. The virus infected systemically all economically important cucurbit crops. Its coat protein consists of a single polypeptide, 34 500 D in size, encapsidating a single stranded RNA genome of 10.1 kb. Antiserum against the Italian zucchini yellow fleck virus (ZYFV) reacted specifically with the Israeli isolate in both ISEM and Western blot. The virus was aphid transmissible in a non-persistent manner. Based on host range, host reaction and serological data, it is suggested that the virus described is an Israeli variant of ZYFV.     

Stabilization, culture and some properties of tulip halo necrosis virus

Tulip halo necrosis virus, obtained from tulips with leaf necrosis, is very labile in crude sap but can be transmitted consistently by inoculating Nicotiana clevelandii plants with extracts made in pH 8 phosphate buffer containing a stabilizing agent such as 0.2M 2-mercaptoethanol or 0.01M dithiothreitol. Of the fifteen species in five families of Angiosperms infected by inoculation with sap, few are suitable as sources of inoculum. Cultures of the virus can be maintained in Nicotiana clevelandii kept at 14 or 18d?C but not at 21d?C. Infectivity can be assayed in Chenopodium quinoa, in which necrotic local lesions are produced. Stabilized extracts of leaves were infective at a dilution of 1/16 but rarely at 1/32, and infectivity decreased disproportionately with dilution. Infectivity of all extracts was abolished in 10 min at 50d?C and of some at 45d?C, but survived when extracts were clarified using diethyl ether or trichlorotrifluoroethane. The virus was not transmitted by the aphid Myzus persicae.     

Chickpea chlorotic dwarf virus,a new leafhopper-transmitted geminivirus of chickpea in India1

A disease of chickpea in India, characterised by chlorosis, severe stunting and phloem browning, was shown to be caused by a geminivirus. This virus was transmitted by the leafhopper Orosius orientalis from chickpea to chickpea and several other plant species. A method for purification of this virus was devised and a polyclonal antiserum produced. The majority of the purified particles were geminate. The size of the coat protein was shown to be 32 kD and the nucleic acid was shown to be circular ssDNA of 2900 nucleotides. By immunosorbent electron microscopy this virus was shown to be unrelated to the leafhopper-transmitted geminiviruses known to infect dicotyledons such as beet curly top, bean summer death and tobacco yellow dwarf viruses. On the basis of particle morphology, leafhopper transmission, host range and serology this virus was considered to be a new, hitherto undescribed, geminivirus and was named chickpea chlorotic dwarf virus.     

The occurrence, hosts and properties of lilac chlorotic leafspot virus, a newly recognised virus from Syringa vulgaris

Lilac chlorotic leafspot virus (LCLV), a hitherto undescribed virus, was isolated from three of 65 lilacs (Syringa vulgaris) with chlorotic leafspotting symptoms growing in S.E. England. The virus was transmitted readily by sap-inoculation to 21 of 52 species from eight of 20 families, but it was not seed-borne in four hosts or transmitted in the semi-persistent manner by any of four aphid species. The virus was moderately stable in vitro; sap from Chenopodium quinoa was infective after 10 min at 60 but not 65 ^oC, after 8–16 days at 20 ^oC or 25–30 wk at 2 ^oC, and after dilution to 10^-3 but not 10^-4. Up to 180 mg of purified virus per kg leaf tissue were obtained from C. quinoa by clarification of buffered leaf extracts with 8% (v/v) n-butanol, followed by one cycle of differential centrifugation and molecular permeation chromatography on controlled pore glass beads (700 Å, 120–200 mesh). LCLV has fragile flexuous filamentous particles which, when intact, mostly measured c. 12-5 times 1500–1600 nm; the helical substructure (pitch c. 3–7 nm) was clearly visible on some particles mounted in uranyl acetate. The particles sedimented as a single component (sedimentation coefficient 96 S; buoyant density 1–302 g cm^-3) and contained c. 5% nucleic acid and a single polypeptide of mol. wt 27 times 10³. Although these properties place LCLV in the closterovirus group, the virus showed no serological relationship to any of six closteroviruses (beet yellows, beet yellow stunt, carnation necrotic fleck, apple chlorotic leafspot, apple stem grooving and potato virus T) and differed from other recognised or possible members of this group in host range and/or symptoms induced in indicator species. The infrequent occurrence of LCLV in lilac in S.E. England indicates that the virus could probably be eradicated by selecting only virus-free plant material for propagation.     

Insights into the selective pressures restricting Pelargonium flower break virus genome variability: Evidence for host adaptation

The molecular diversity of Pelargonium flower break virus (PFBV) was assessed using a collection of isolates from different geographical origins, hosts, and collecting times. The genomic region examined was 1,828 nucleotides (nt) long and comprised the coding sequences for the movement (p7 and p12) and the coat (CP) proteins, as well as flanking segments including the entire 3' untranslated region (3' UTR). Some constraints limiting viral heterogeneity could be inferred from sequence analyses, such as the conservation of the amino acid sequences of p7 and of the shell domain of the CP, the maintenance of a leucine zipper motif in p12, and the preservation of a particular folding in the 3' UTR. A remarkable covariation, involving five specific amino acid sites, was found in the CP of isolates largely propagated in the local lesion host Chenopodium quinoa and in the progeny of a PFBV variant subjected to serial passages in this host. Concomitant with this covariation, up to 30 nucleotide substitutions in a 1,428-nt region of the viral RNA could be attributable to C. quinoa-specific adaptation, representing one of the most outstanding cases of host-driven genome variation for a plant virus. Globally, the results indicate that the selective pressures exerted by the host play a critical role in shaping PFBV populations and that these populations are likely being selected for at both protein and RNA levels.     

Development of a SCAR marker for detection of Bipolaris sorokiniana causing spot blotch of wheat

Spot blotch of wheat caused by Bipolaris sorokiniana is an important disease of wheat, especially in slightly warm (25 ± 1 °C) and humid weather conditions. A quick and reliable PCR-based diagnostic assay has been developed to detect B. sorokiniana using a pathogen-specific marker derived from genomic DNA. A PCR-amplified band of 650 bp obtained in B. sorokiniana isolates using universal rice primer (URP 1F) was cloned in pGEMT easy vector and sequenced. Based on sequences, six primers were designed, out of which a primer pair RABSF1 (GGTCCGAGACAACCAACAA) and RABSR2 (AAAGAAAGCGGTCGACGTAA) amplified a sequence of 600 bp in B. sorokiniana isolates. The specificity of the marker when tested against 40 isolates of B. sorokiniana, seven isolates of other species of Bipolaris, and 27 isolates of other pathogens infecting wheat and other crops showed a specific band of 600 bp only in B. sorokiniana. The detection limit was 50 pg of genomic DNA. The marker could detect the pathogen in soil and wheat leaves at presymptomatic stage. This sequence characterized amplified region (SCAR) marker designated as SCRABS(600) could clearly distinguish B. sorokiniana from other fungal plant pathogens, including Bipolaris spp. The utilization of this diagnostic PCR assay in analysis of field soil and wheat leaves will play a key role in effective management of the disease.     

Sri Lankan passion fruit mottle virus, a potyvirus infecting golden passion fruit in Sri Lanka

A sap-transmissible virus, provisionally named Sri Lankan passion fruit mottle virus (SLPFMV), was isolated from Passiflora edulis f. flavicarpa and shown to induce leaf mottling and distortion in that host. The virus infected 23 species in five plant families with systemic infection being common in the Passifloraceae. Chenopodium amaranticolor was a good local lesion host and Passiflora foetida was a useful systemic host for purification. In P. foetida extracts, SLPFMV lost infectivity after 10 min between 70–75°C, 6–7 days at 20–23°C and at dilutions of 10^--⁵ -W^-6. The virus had flexuous, filamentous particles with a normal length of c. 841 nm. Two polypeptides of mol. wt c. 33 200 and 28 700 were detected in purified virus preparations, and a major species of double-stranded RNA (mol. wt 7.0 × 10⁶), was detected in infected plants. Pinwheels, tubular and laminated inclusions were found in ultrathin sections of infected P. edulis f. plavicurpa and cylindrical inclusions were observed in epidermal strips. SLPFMV was transmitted by the aphids Myzus persicae, Aphis spiraecola, A. gossypü and A. cruccivora after brief acquisition feeds. SLPFMV reacted with antisera to several potyviruses including passion fruit woodiness virus, passion fruit ringspot virus, potato virus Y and watermelon mosaic virus 2 and thus, apparently, is a member of the potyvirus group.     

Carotenoids in floral parts of a narcissus, a daffodil and a tulip

1. The qualitative and quantitative distribution of carotenoids of the floral parts of three monocotyledons, the narcissus Scarlet Elegance, the daffodil King Alfred and the tulip Golden Harvest, were studied. β-Carotene, lutein or epoxy-β-carotenes were usually the main pigments, depending on the floral part and on the flower. When β-carotene was the major pigment there were only small amounts of, or sometimes no, epoxycarotenes. 2. Anthers, stigmas and styles of the three flowers did not possess any specific carotenoids but in some cases contained appreciable amounts of epoxycarotenoids. The possibility that these take part in reproduction is discussed. 3. The generalization that yellow flowers contained large amounts of xanthophylls and only traces of carotenes, whereas deep-orange flowers seemed to be characterized by the presence of large amounts of one carotene, was not always the correct one. It is suggested that the floral parts are yellow or orange depending on what carotenoids are present, which is the major one and the amount of total carotenoids, and also on the presence of other non-carotenoid pigments. 4. Two new probable isomers of 5,6:5′,6′-diepoxy-β-carotene were isolated and found together in various floral parts of the tulip Golden Harvest.     

Actinidia chlorotic ringspot‐associated virus: a novel emaravirus infecting kiwifruit plants

By integrating next‐generation sequencing (NGS), bioinformatics, electron microscopy and conventional molecular biology tools, a new virus infecting kiwifruit vines has been identified and characterized. Being associated with double‐membrane‐bound bodies in infected tissues and having a genome composed of RNA segments, each one containing a single open reading frame in negative polarity, this virus shows the typical features of members of the genus Emaravirus. Five genomic RNA segments were identified. Additional molecular signatures in the viral RNAs and in the proteins they encode, together with data from phylogenetic analyses, support the proposal of creating a new species in the genus Emaravirus to classify the novel virus, which is tentatively named Actinidia chlorotic ringspot‐associated virus (AcCRaV). Bioassays showed that AcCRaV is mechanically transmissible to Nicotiana benthamiana plants which, in turn, may develop chlorotic spots and ringspots. Field surveys disclosed the presence of AcCRaV in four different species of kiwifruit vines in five different provinces of central and western China, and support the association of the novel virus with symptoms of leaf chlorotic ringspots in Actinidia. Data on the molecular features of small RNAs of 21–24 nucleotides, derived from AcCRaV RNAs targeted by host RNA silencing mechanisms, are also reported, and possible molecular pathways involved in their biogenesis are discussed.     

An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity

Pelargonium flower break virus (PFBV, genus Carmovirus) has a single-stranded positive-sense genomic RNA (gRNA) which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37) which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES). Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.     

Identification and characterisation of a newly described potyvirus in West Africa: Asystasia mottle virus

Asystasia mottle virus (AsMV) was detected serologically in samples of Asystasia gangetica with mottle symptoms, from several areas of tropical West Africa. It infected 12 species systemically and induced local lesions in a further four. The virus lost infectivity after dilution to 10^-4, after 10 min at 75 °C and after 3 days at 27°C. Purified virus had an A₂₆₀/A₂₈₀ ratio of c. 1·2 and a protein subunit mol. wt of c. 33 000. Particles were c. 750 nm long and cytoplasmic inclusions typical of potyviruses were seen in ultrathin sections of infected leaves. The antiserum prepared had a titre of 1/1024 in microprecipitin tests but purified virus failed to react with 31 antisera to known potyviruses. The virus was transmitted in the non-persistent manner by Aphis spiraecola but only very infrequently. On the basis of these properties, AsMV is considered to be a new member of the potyvirus group.     

Isolation and characterization of a lectin from tulip bulbs, Tulipa gesneriana

A lectin, which agglutinated specifically the yeast cells of the Saccharomyces genus, was isolated from tulip bulbs (Tulipa gesneriana) using affinity chromatography on mannan-Sepharose 4B. Its relative molecular mass was determined by gel filtration to be approximately 67,000. On polyacrylamide gel electrophoresis in sodium dodecyl sulfate, a relative molecular mass of 17,000 was obtained, suggesting that the lectin is a tetramer. Binding studies performed with iodinated lectin indicated that Saccharomyces cerevisiae cells contained approximately 5.7 X 10(6) binding sites per cell, whereas little binding was observed with yeasts other than the Saccharomyces genus, bacteria and animal erythrocytes. D-Mannose, D-mannose 6-phosphate, L-fucose and L-fucosylamine were potent inhibitors of the lectin binding to S. cerevisiae cells, while, D-glucose, D-galactose and D-mannosamine were inactive, indicating that hydroxyl group at C-2 of D-mannose was essential for the lectin binding. Furthermore, inhibition experiments, using various manno-oligosaccharides, suggested that the lectin recognized (1----6)-linked manno-oligosaccharide units larger than mannobiose.