Essential structure in the cloned transforming DNA that induces gene amplification of the Bacillus subtilis amyE-tmrB region.

Bacillus subtilis B7, a mutant which acquired gene amplification of the amyE-tmrB region, showed, as a result, hyperproductivity (about a 5- to 10-fold increase) of alpha-amylase and tunicamycin resistance. The mutational character was transferred to recipient cells by competence transformation. A 14-kilobase (kb) EcoRI chromosomal DNA fragment of strain B7 was found to have the transforming activity. We cloned a 6.4-kb EcoRI fragment on a phage vector lambda Charon 4A through a spontaneous deletion of 7.6 kb from the 14-kb fragment and subcloned a 1.6-kb HindIII fragment on pGR71. The cloned 6.4-kb EcoRI and 1.6-kb HindIII fragments retained the transforming activity of inducing gene amplification of the amyE-tmrB region. At the junction point (J) of the repeating units (16 kb), the tmrB gene was linked to a DNA region (M) located 4 kb upstream of amyE. The essential structure of the cloned, transforming (gene amplification-inducing) DNA was deduced to be that around J. The subcloned 1.6-kb HindIII fragment that retained the transforming activity was shown to be almost solely composed of the tmrB-J-M region. In addition, the DNA sequence around J was determined.     

Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences.

amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems.