Molecular cloning, nucleotide sequence and expression of the tufB gene encoding elongation factor Tu from Thermus thermophilus HB8

The tufB gene encoding elongation factor Tu (EF-Tu) of Thermus thermophilus HB8 was cloned and expressed. Compared with the known tufA gene of T. thermophilus, nucleotide differences were found at 10 positions out of 1221 nucleotides, and amino acid substitutions were found at 4 positions out of 406 amino acids. The tufB product was 70.9% homologous to the corresponding sequence of the tufB product of E. coli. The G+C content of the third base of the codon in the tufB gene was 84.8% and G was especially preferred in this position.     

Molecular cloning and nucleotide sequence of Thermus thermophilus HB8 trpE and trpG

The trpE gene of Thermus thermophilus HB8 was cloned by complementation of an Escherichia coli tryptophan auxotroph. The E. coli harboring the cloned gene produced the anthranilate synthase I, which was heat-stable and enzymatically active at higher temperature. The nucleotide sequence of the trpE gene and its flanking regions was determined. The trpE gene was preceded by an attenuator-like structure and followed by the trpG gene, with a short gap between them. No other gene essential for tryptophan biosynthesis was observed after the trpG gene. The amino-acid sequences of the T. themophilus anthranilate synthase I and II deduced from the nucleotide sequence were compared with those of other organisms.     

Cytochrome oxidase from an extreme thermophile. Thermus thermophilus HB8

The cytochrome oxidase (EC 1.9.3.1) of $\text{Thermus}\text{thermophilus}$ HB8 was isolated from the membrane fraction, and was highly purified. The oxidase contained heme $\text{a}$ and heme $\text{c}$ as the prosthetic groups. The purified preparation showed a single band in polyacrylamide gel electrophoresis, and three major polypeptides with apparent molecular weights of 52,000, 37,000 and 29,000 were observed in the presence of sodium dodecyl sulfate. The enzyme reacted rapidly with $\text{T}\text{.}\text{thermophilus}$ cytochrome c-552. The oxidation of $\text{T}\text{.}\text{thermophilus}$ cytochrome $\text{c}$-555,549 by the enzyme was very slow, and was stimulated by the addition of cytochrome $\text{c}$-552. The enzyme was highly stable to heat.     

Molecular cloning and sequence analysis of the lysR gene from the extremely thermophilic eubacterium, Thermus thermophilus HB27

We have isolated a lysine-auxotrophic and kanamycin-resistant mutant from an extreme thermophile, Thermus thermophilus HB27. This mutant showed the lysA⁻ or lysR⁻ genotype since it could not grow on the minimal plate which contained diaminopimelic acid. Sequence analysis of the clones which could rescue the Lys⁻ mutant indicated the lysR gene. The lysR gene overlapped with the rimK gene for the modification enzyme of ribosomal protein S6. In the Lys⁻ mutant, the lysR gene was disrupted and the C-terminus region of the RimK protein was different from that of the wild-type, which contributed to the Lys⁻ and kanamycin-resistant phenotype. The deduced amino acid sequence of the lysR gene showed 20.9% identity with the LysR protein of Escherichia coli. The percentage of use of cytosine or guanine in the third letter of the codons in the lysR gene was only 67.4%. We also determined that the argC gene encoding N-acetyl-γ-glutamyl phosphate reductase and the argB gene encoding acetylglutamate kinase were located immediately upstream of the lysR gene.     

Molecular cloning of the isocitrate dehydrogenase gene of an extreme thermophile, Thermus thermophilus HB8.

The gene coding for isocitrate dehydrogenase of an extreme thermophile, Thermus thermophilus HB8, was cloned and sequenced. This gene consists of a single open reading frame of 1,485 bp preceded by a Shine-Dalgarno ribosome binding site. Promoter- and terminatorlike sequences were detected upstream and downstream of the open reading frame, respectively. The G + C content of the coding region was 65.6%, and that of the third nucleotide of the codons was 90.3%. On the basis of the deduced amino acid sequence, the Mr of the monomeric enzyme was calculated as 54,189, an Mr which is similar to that of the purified protein determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. A comparison of the amino acid sequence of the T. thermophilus enzyme with that of the Escherichia coli enzyme showed (i) a 37% overall similarity; (ii) the conservation of the Ser residue, which is known to be phosphorylated in the E. coli enzyme, and of the surrounding sequence; and (iii) the presence of 141 extra residues at the C terminus of the T. thermophilus enzyme. T. thermophilus isocitrate dehydrogenase showed a high sequence homology (33% of the amino acid sequence is identical) to isopropylmalate dehydrogenase from the same organism and was suggested to have evolved from a common ancestral enzyme.     

Molecular cloning of the isocitrate dehydrogenase gene of an extreme thermophile, Thermus thermophilus HB8.

The gene coding for isocitrate dehydrogenase of an extreme thermophile, Thermus thermophilus HB8, was cloned and sequenced. This gene consists of a single open reading frame of 1,485 bp preceded by a Shine-Dalgarno ribosome binding site. Promoter- and terminatorlike sequences were detected upstream and downstream of the open reading frame, respectively. The G + C content of the coding region was 65.6%, and that of the third nucleotide of the codons was 90.3%. On the basis of the deduced amino acid sequence, the Mr of the monomeric enzyme was calculated as 54,189, an Mr which is similar to that of the purified protein determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. A comparison of the amino acid sequence of the T. thermophilus enzyme with that of the Escherichia coli enzyme showed (i) a 37% overall similarity; (ii) the conservation of the Ser residue, which is known to be phosphorylated in the E. coli enzyme, and of the surrounding sequence; and (iii) the presence of 141 extra residues at the C terminus of the T. thermophilus enzyme. T. thermophilus isocitrate dehydrogenase showed a high sequence homology (33% of the amino acid sequence is identical) to isopropylmalate dehydrogenase from the same organism and was suggested to have evolved from a common ancestral enzyme.     

The nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8

Using 3'- and 5'-end labelling sequencing techniques, the following primary structure for Thermusthermophilus HB8 5S RNA could be determined: pAA (U) CCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCC GAUGGUACUGGCGGACGACCGCUGGGAGAGUAGGUCGGUGCGGGGGA (OH). This sequence is most similar to Thermusaquaticus 5S RNA with which it shows 85% homology.     

Molecular cloning of the Lon protease gene from Thermus thermophilus HB8 and characterization of its gene product.

The gene encoding Lon protease was isolated from an extreme thermophile, Thermus thermophilus HB8. Sequence analysis demonstrated that the T. thermophilus Lon protease gene (TT-lon) contains a protein-coding sequence consisting of 2385 bp which is approximately 56% homologous to the Escherichia coli counterpart. As expected, the G/C content of TT-lon was 68%, which is significantly higher than that of the E. coli lon gene (52% G/C). The amino acid sequence of T. thermophilus Lon protease (TT-Lon) predicted from the nucleotide sequence contained several unique sequences conserved in other Lon proteases: (a) a cysteine residue at the position just before the putative ATP-binding domain; (b) motif A and B sequences required for composition of the ATP-binding domain; and (c) a serine residue at the proteolytic active site. Expression of TT-lon under the control of the T7 promoter in E. coli produced an 89-kDa protein with a yield of approximately 5 mg.L-1. Recombinant TT-Lon (rTT-Lon) was purified to homogeneity by sequential column chromatography. The peptidase activity of rTT-Lon was activated by ATP and alpha-casein. rTT-Lon cleaved succinyl-phenylalanyl-leucyl-phenylalanyl-methoxynaphthylamide much more efficiently than succinyl-alanyl-alanyl-phenylalanyl-methoxynaphthylamide, whereas both peptides were cleaved with comparable efficiencies by E. coli Lon. These results suggest that there is a difference between TT-Lon and E. coli Lon in substrate specificity. rTT-Lon most effectively cleaved substrate peptides at 70 degrees C, which was significantly higher than the optimal temperature (37 degrees C) for E. coli Lon. Together, these results indicate that the TT-lon gene isolated from T. thermophilus HB8 actually encodes an ATP-dependent thermostable protease Lon.     

Cloning and nucleotide sequence of the pullulanase gene of Thermus thermophilus HB8 and production of the enzyme in Escherichia coli.

A 3.4-kb SphI fragment carrying the pullulanase gene of Thermus thermophilus HB8 was cloned. Based on the nucleotide sequence of it and the flanking region analyzed by direct sequencing of the inverse PCR product, an expression vector was constructed. The E. coli cells harboring the plasmid produced an about 80-kDa protein having pullulanase activity, the optimum temperature of which was 70 degrees C.     

A temperature‐dependent conformational change of NADH oxidase from Thermus thermophilus HB8

Using molecular dynamics simulations and steady‐state fluorescence spectroscopy, we have identified a conformational change in the active site of a thermophilic flavoenzyme, NADH oxidase from Thermus thermophilus HB8 (NOX). The enzyme's far‐UV circular dichroism spectrum, intrinsic tryptophan fluorescence, and apparent molecular weight measured by dynamic light scattering varied little between 25 and 75°C. However, the fluorescence of the tightly bound FAD cofactor increased approximately fourfold over this temperature range. This effect appears not to be due to aggregation, unfolding, cofactor dissociation, or changes in quaternary structure. We therefore attribute the change in flavin fluorescence to a temperature‐dependent conformational change involving the NOX active site. Molecular dynamics simulations and the effects of mutating aromatic residues near the flavin suggest that the change in fluorescence results from a decrease in quenching by electron transfer from tyrosine 137 to the flavin. Proteins 2012. © 2011 Wiley Periodicals, Inc.     

Molecular cloning of a ribonuclease H (RNase HI) gene from an extreme thermophile Thermus thermophilus HB8: a thermostable RNase H can functionally replace the Escherichia coli enzyme in vivo.

A DNA fragment encoding Ribonuclease H (EC 3. 1.26.4) was isolated from an extreme thermophilic bacterium, Thermus thermophilus HB8, by its ability to complement the temperature-sensitive growth of an Escherichia coli rnhA deficient mutant. The primary amino acid sequence showed 56% similarity to that of E. coli RNase HI but little or no homology to E. coli RNase HII. Enzymes derived from thermophilic organisms tend to have fewer cysteines than their bacterial counterparts. However, T. thermophilus RNase H has one more cysteine than its E. coli homologue. Stability of the RNase H in extracts of T. thermophilus to elevated temperatures was the same for the protein expressed in E. coli. T. thermophilus RNase H should, therefore, be a useful tool for editing RNA-DNA hybrid molecules at higher temperatures and may also be stable enough to be used in a cyclical process. It was suggested that regulation of expression of the RNase H may be different from that of E. coli. RNase HI.     

Molecular cloning and sequence determination of the tuf gene coding for the elongation factor Tu of Thermus thermophilus HB8

The tuf gene, which encodes the elongation factor Tu (EF-Tu) of Thermus thermophilus HB8, and its flanking regions were cloned and sequenced. The gene encoding EF-G was found upstream of the 5' end of the tuf gene. The tuf gene of T. thermophilus HB8 had a very high G + C content and 84.5% of the third base in codon usage was either G or C. The deduced primary structure of the EF-Tu was composed of 405 amino acid residues with a Mr = 44658. A comparison of the amino acid sequence of EF-Tu from T. thermophilus HB8 with those of Escherichia coli and Saccharomyces cerevisiae mitochondria showed a very high sequence homology (65-70%). Two Cys residues out of the three found in E. coli EF-Tu had been replaced with Val in T. thermophilus HB8 EF-Tu. An extra amino acid sequence of ten residues, consisting predominantly of basic amino acids (Met-182-Gly-191), which does not occur in EF-Tu of E. coli, was found in T. thermophilus HB8.     

Terminal heterogeneity and corrections of the nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8

The nucleotide sequence of 5S rRNA from an extreme thermophile Thermusthermophilus HB8 has been re-examined and determined as [Formula: see text] The present study could resolve previously ambiguous residues and find two additional residues (G(8 3), C(9 7)), G at position 89 and two terminal heterogeneities which are exactly the same as reported with Thermusaquaticus 5S rRNA.Images     

Cloning,sequencing and expression of the uvrA gene from an extremely thermophilic bacterium,Thermus thermophilus HB8

One of the most important DNA repair systems is the nucleotide (nt) excision repair system. The uvrA gene, which plays an essential role in the prokaryotic excision repair system, was cloned from an extremely thermophilic eubacterium, Thermus thermophilus (Tt) HB8, and its nt sequence was determined. In the amino acid (aa) sequence of Tt UvrA, a characteristic duplicated structure, two nt-binding consensus sequences (Walker's A-type motif) and two zinc finger DNA-binding motifs were found. The aa sequence showed 73% homology with that of Escherichia coli (Ec). These features suggest that Tt has the same excision repair system as Ec. Upon comparison of the Tt and Ec UvrA, some characteristic aa substitutions were found. The numbers of Arg and Pro residues were increased (from 66 to 81 and from 47 to 55, respectively), and the numbers of Asn and Met residues were decreased (from 33 to 18 and from 18 to 11, respectively) in Tt. The Tt uvrA gene was expressed in Ec under control of the lac promoter. Purified UvrA was stable up to 80°C (at neutral pH) and at pH 2–11 (at 25°C)     

Nucleotide sequence of formylmethionine tRNA from an extreme thermophile, Thermus thermophilus HB8.

The nucleotide sequence of formylmethionine tRNA from an extreme thermophile, Thermus thermophilus HB8, was determined by a combination of classical methods using unlabeled samples to determine the sequences of the oligonucleotides of RNase T1 and RNase A digests and a rapid sequencing gel technique using 5'-32P labeled samples to determine overlapping sequences. Formylmethionine tRNA from T. thermophilus is composed of two species, tRNAf1Met and tRNAf2Met. Their nucleotide sequences are almost identical, and are also almost identical with that of E. coli tRNAfMet, except for slight modifications and replacements. Both species have modifications at three points which do not exist in E. coli tRNAfMet: 2'-O-methylation at G19, N-1-methylation at A59 and 2-thiolation at T55. Moreover U51 in E. coli tRNAfMet is replaced by C51 in both species, so that a G-C pair is formed between this C51 and G65. tRNAf2Met has a reversed G-C pair at positions 52 and 64 compared with those in tRNAf1Met and E. coli tRNAfMet. Other regions are mostly the same as those in all prokaryotic initiator tRNAs so far reported. The thermostability of these thermophile initiator tRNAs is discussed in relation to their unique modifications.     

Molecular cloning and sequence analysis of the crtB gene of Thermus thermophilus HB27, an extreme thermophile producing carotenoid pigments.

We have cloned and sequenced a 1.5-kb chromosomal fragment of Thermus thermophilus which promoted the overproduction of carotenoids in T. thermophilus. An open reading frame (ORF-A) coding for a polypeptide with 289 amino acids was responsible for carotenoid overproduction. The putative ORF-A protein showed significant homology with the amino acid sequences of crtB gene products (phytoene syntheses) of other microorganisms. The clone containing the ORF-A on a multicopy plasmid produced about three times as much carotenoid as that produced by the host strain, suggesting that the crtB gene product is a rate-limiting enzyme for carotenoid biosynthesis in T. thermophilus.