Evidence for palindromic sequences near the termini of adenovirus 2 DNA

When the kinetics of $\text{Escherichia coli}$ exonuclease III digestion of adenovirus 2 DNA were studied by DNA polymerase I-catalyzed repair synthesis at 5°C, there was an indication of the formation of hairpin structure in the single-stranded template, exposed by exonuclease III. The hairpin structure results from a sequence with an inverted repetition of the type, a b c d···d′ c′ b′ a′. The location of these sequences was determined to be about 180 nucleotides from each terminus of adenovirus 2 DNA with the use of specific restriction endonucleases. The possible role of this region in the replication of the adenovirus 2 genome is discussed.     

Characteristics of palindromic sequences in DNA of the sea urchin Strongylocentrotus intermedius

Some properties of the palindromic sequences in the sea urchin Strongylocentrotus intermedius nuclear DNA have been studied. It was shown that the amount of "foldback HAP bound DNA" and the S1 nuclease resistant DNA depends on renaturation temperature and Na+ concentration in solution. The authentic fraction of inverted repeats comprises 10-15% of the total DNA. The complexity of the palindromic fraction is approximately 8,2 X 10(7) nucleotide pairs and the average number of inverted repeats approximates 5 X 10(5) per haploid genome. The renaturation kinetics of inverted repeats with excess of total homologous DNA indicates that these sequences are enriched with unique DNA. The possible function of palindromic sequences is discussed.     

DNA profiling of Stenotrophomonas maltophilia by PCR targeted to its species-specific repetitive palindromic sequences

Aims: The aim of this study was to develop a simple protocol for a PCR‐based fingerprinting of Stenotrophomonas maltophilia (SmrepPCR) that utilizes primers complementary to repetitive extragenic palindromic elements (REPs) of this micro‐organism. Methods and Results: The relatedness of 34 isolates of environmental and clinical origin was investigated by two SmrepPCRs with two different primers, gyrB sequencing and XbaI macrorestriction followed by pulsed‐field gel electrophoresis. While SmrepPCR (with primer DIR) results matched data obtained from the analysis of gyrB nucleotide sequences and identified several clonal complexes, XbaI macrorestriction showed high level of heterogeneity between isolates. The macrorestriction‐based clustering of isolates did not correspond to both gyrB and DIR‐SmrepPCR grouping. Conclusions: Our results show that SmrepPCR‐inferred relationship of isolates is in a good agreement with sequence‐based methods. The combined information from all methods used suggests that rapid evolution of S. maltophilia genomes might be predominantly due to high rate of rearrangements caused by mobile genetic elements. Significance and Impact of the Study: The presented method is an inexpensive and easy to perform alternative to genotype S. maltophilia isolates and to study their population genetics. SmrepPCR demonstrates the usefulness of species‐specific repetitive elements in genomic analyses.     

The role of palindromic and non-palindromic sequences in arresting DNA synthesis in vitro and in vivo

The nature of specific DNA sequences that arrest synthesis by mammalian DNA polymerase alpha in vitro was analyzed using circular, single-stranded M13 or phi X174 virion DNA templates annealed to a unique, terminally labeled, DNA primer. This method rigorously defined both the starting nucleotide position and the direction of synthesis, as well as making the amount of radioactivity proportional to the number rather than the length of nascent DNA chains. The precise nucleotide locations of arrest sites were determined over templates with complementary sequences by cloning unique DNA restriction fragments into M13 DNA and isolating virions containing either the Watson or Crick strand. Results were correlated with the locations of palindromic (self-complementary) sequences, repeated sequences, and repeated sequences with mirror-image orientation. Two classes of DNA synthesis arrest sites were identified, distinct in structure but equivalent in activity. Class I sites consisted of palindromic sequences that formed a stable hairpin structure in solution and arrested DNA polymerase on both complementary templates. The polymerase stopped precisely at the base of the duplex DNA stem, regardless of the direction from which the enzyme approached. Class II sites consisted of non-palindromic sequences that could not be explained by either secondary structure or sequence symmetry elements, and whose complementary sequence was not an arrest site. Size limits, orientation and some sequence specificity for arrest sites were suggested by the data. Arrest sites were also observed in vivo by mapping the locations of 3'-end-labeled nascent simian virus 40 DNA strands throughout the genome. Arrest sites closest to the region where termination of replication occurs were most pronounced, and the locations of 80% of the most prominent sites appeared to be recognized by alpha-polymerase on the same template in vitro. However, class I sites were not identified in vivo, suggesting that palindromic sequences do not form hairpin structures at replication forks.     

Microsatellite discovery from BAC end sequences and genetic mapping to anchor the soybean physical and genetic maps.

Whole-genome sequencing of the soybean (Glycine max (L.) Merr. 'Williams 82') has made it important to integrate its physical and genetic maps. To facilitate this integration of maps, we screened 3290 microsatellites (SSRs) identified from BAC end sequences of clones comprising the 'Williams 82' physical map. SSRs were screened against 3 mapping populations. We found the AAT and ACT motifs produced the greatest frequency of length polymorphisms, ranging from 17.2% to 32.3% and from 11.8% to 33.3%, respectively. Other useful motifs include the dinucleotide repeats AG, AT, and AG, with frequency of length polymorphisms ranging from 11.2% to 18.4% (AT), 12.4% to 20.6% (AG), and 11.3% to 16.4% (GT). Repeat lengths less than 16 bp were generally less useful than repeat lengths of 40-60 bp. Two hundred and sixty-five SSRs were genetically mapped in at least one population. Of the 265 mapped SSRs, 60 came from BAC singletons not yet placed into contigs of the physical map. One hundred and ten originated in BACs located in contigs for which no genetic map location was previously known. Ninety-five SSRs came from BACs within contigs for which one or more other BACs had already been mapped. For these fingerprinted contigs (FPC) a high percentage of the mapped markers showed inconsistent map locations. A strategy is introduced by which physical and genetic map inconsistencies can be resolved using the preliminary 4x assembly of the whole genome sequence of soybean.     

A family of repetitive palindromic sequences found in Neurospora mitochondrial DNA is also found in a mitochondrial plasmid DNA

Neurospora mtDNA contains a repetitive, 18 nucleotide palindromic sequence (5'-CCCTGCAGTACTGCAGGG-3') that contains two closely spaced PstI sites (CTGCAG) in the arms of the palindrome (Yin, S., Heckman, J., and RajBhandary, U. L. (1981) Cell 26, 325-332). In the present study, DNA sequence analysis was carried out to determine whether PstI palindromes are present in an apparently distinct genetic element, the 3.6-kilobase mitochondrial plasmid from Neurospora crassa strain Mauriceville-1c (FGSC 2225). The plasmid contains a cluster of closely spaced PstI sites extending over a 0.4-kilobase region (Collins, R. A., Stohl, L. L., Cole, M. D., and Lambowitz, A. M. (1981) Cell 24, 443-452). The DNA sequence shows that the cluster consists of eight PstI sites organized in five palindromic elements. Two of the elements are identical with the canonical sequence found in mtDNA, whereas the remaining three elements differ from the canonical sequence by a few nucleotides. The occurrence of the PstI palindromes in two otherwise unrelated DNA species is consistent with the hypothesis that they are related to mobile DNA sequences that either propagate or were once capable of propagating within mitochondria.     

Formation of large palindromic DNA by homologous recombination of short inverted repeat sequences in Saccharomyces cerevisiae

Large DNA palindromes form sporadically in many eukaryotic and prokaryotic genomes and are often associated with amplified genes. The presence of a short inverted repeat sequence near a DNA double-strand break has been implicated in the formation of large palindromes in a variety of organisms. Previously we have established that in Saccharomyces cerevisiae a linear DNA palindrome is efficiently formed from a single-copy circular plasmid when a DNA double-strand break is introduced next to a short inverted repeat sequence. In this study we address whether the linear palindromes form by an intermolecular reaction (that is, a reaction between two identical fragments in a head-to-head arrangement) or by an unusual intramolecular reaction, as it apparently does in other examples of palindrome formation. Our evidence supports a model in which palindromes are primarily formed by an intermolecular reaction involving homologous recombination of short inverted repeat sequences. We have also extended our investigation into the requirement for DNA double-strand break repair genes in palindrome formation. We have found that a deletion of the RAD52 gene significantly reduces palindrome formation by intermolecular recombination and that deletions of two other genes in the RAD52-epistasis group (RAD51 and MRE11) have little or no effect on palindrome formation. In addition, palindrome formation is dramatically reduced by a deletion of the nucleotide excision repair gene RAD1.     

Tomato protoplast DNA transformation: physical linkage and recombination of exogenous DNA sequences

Tomato protoplasts have been transformed with plasmid DNA's, containing a chimeric kanamycin resistance gene and putative tomato origins of replication. A calcium phosphate-DNA mediated transformation procedure was employed in combination with either polyethylene glycol or polyvinyl alcohol. There were no indications that the tomato DNA inserts conferred autonomous replication on the plasmids. Instead, Southern blot hybridization analysis of seven kanamycin resistant calli revealed the presence of at least one kanamycin resistance locus per transformant integrated in the tomato nuclear DNA. Generally one to three truncated plasmid copies were found integrated into the tomato nuclear DNA, often physically linked to each other. For one transformant we have been able to use the bacterial ampicillin resistance marker of the vector plasmid pUC9 to rescue a recombinant plasmid from the tomato genome. Analysis of the foreign sequences included in the rescued plasmid showed that integration had occurred in a non-repetitive DNA region. Calf-thymus DNA, used as a carrier in transformation procedure, was found to be covalently linked to plasmid DNA sequences in the genomic DNA of one transformant. A model is presented describing the fate of exogenously added DNA during the transformation of a plant cell. The results are discussed in reference to the possibility of isolating DNA sequences responsible for autonomous replication in tomato.     

Excision of amplified viral DNA at palindromic sequences from the adenovirus type 12-transformed hamster cell line T637.

In the DNA of the adenovirus type 12 (Ad12)-transformed hamster cell line T637 approximately 20-22 viral DNA molecules per cell are covalently linked to cellular DNA. Spontaneously arising morphological revertants of T637 cells have lost the bulk of the viral DNA. We have been able to mimic the excision event of viral DNA, as it occurs during reversion, by autoincubation of isolated nuclei from T637 cells. The same Ad12 DNA sequences, which had been deleted in morphological revertants, proved highly sensitive to endogenous nucleases in isolated nuclei of T637 cells. Viral DNA sequences, which persisted in the revertants, are resistant to endogenous nucleases in isolated T637 nuclei. All attempts to clone the nuclease-sensitive sites of Ad12 DNA in cell line T637 have so far failed. After denaturation and renaturation of T637 DNA followed by treatment with S1 nuclease, large fold-back structures of DNA have been found. These snap-back structures were derived from precisely those viral DNA restriction fragments which were uncloneable. The fragments containing palindromic sequences were both highly sensitive to endogenous nucleases in isolated T637 nuclei and were absent from the DNA of all revertant cell lines. Moreover, the palindromic sequences are susceptible to the phage T4-specific endonuclease VII which specifically attacks cruciform structures in DNA. The peculiar structures at the termini of integrated Ad12 DNA molecules are highly sensitive to endogenous nucleases in isolated nuclei. These nucleases may be related to the reversion event.     

Characterization of the Pseudomonas putida mobile genetic element ISPpu10: an occupant of repetitive extragenic palindromic sequences

We have characterized the Pseudomonas putida KT2440 insertion element ISPpu10. This insertion sequence encodes a transposase which exhibits homology to the transposases and specific recombinases of the Piv/Moov family, and no inverted repeats are present at the borders of its left and right ends, thus constituting a new member of the atypical IS110/IS492 family. ISPpu10 was found in at least seven identical loci in the KT2440 genome, and variants were identified having an extra insertion at distinct loci. ISPpu10 always appeared within the core of specific repetitive extragenic palindromic (REP) sequences TCGCGGGTAAACCCGCTCCTAC, exhibiting high target stringency. One intragenic target was found associated with the truncation of a GGDEF/EAL domain protein. After active in vitro transposition to a plasmid-borne target, a duplication of the CT (underlined above) at the junction as a consequence of the ISPpu10 insertion was experimentally demonstrated for the first time in the IS110/IS492 family. The same duplication was observed after transposition of ISPpu10 from a plasmid to the chromosome of P. putida DOT-T1E, an ISPpu10-free strain with REPs similar to those of strain KT2440. Plasmid ISPpu10-mediated rearrangements were observed in vivo under laboratory conditions and in the plant rhizosphere.     

Assessment of genetic relatedness among commercial and wild strains of Agaricus bisporus using repetitive extragenic palindromic sequences and polymerase chain reaction

The genetic relatedness among 18 strains of Agaricus bisporus was assessed based on the fragment pattern analysis obtained by the amplification of genomic DNA by BOX, ERIC (ERICIR-I/ERIC2) and REP (REP1RI/REP2I) gene sequences. Based on the banding patterns of PCR-amplified products, eight putative groups among the 18 commercial and wild strains were recognized. REP-PCR generated multiple distinct products showing considerable variability among the strains with ERIC and REP elements successfully enabled detection of wild and commercial A. bisporus. Strains originating from the same geographical location were not always genetically related. To our knowledge, this was the first relevance study of biodiversity in commercial and native populations of A. bisporus by using the REP-PCR technique. The results confirmed the usefulness REP-PCR typing in intraspecific genetic variation assessments of the button mushroom. High level of Iranian wild strains distance with the commercial cultivars approves their importance as a promising new source of diversity in A. bisporus breeding program.     

Comparison of Helicobacter spp. genetic sequences in wild and captive seals, and gulls

Helicobacter species are widely distributed in the gastrointestinal system of humans and many animal taxa. Investigations of natural infections are essential to elucidating their role within the host. The feces of fur seals Arctocephalus pusillus doriferus and sea lions Neophoca cinerea from 3 separate captive populations, as well as a wild colony from Kangaroo Island, Australia, were examined for the occurrence of Helicobacter spp. The feces from several wild silver gulls Larus novahollandiae were also investigated. As detected by PCR, 18 of 21 samples from captive and 12 of 16 samples from wild seals were positive for Helicobacter spp. Three species were identified in these animals. Whilst one possibly novel type was identified from wild fur seals, the majority of wild and captive individuals had the same species. This species also occurred in more than 1 seal type and in silver gulls, and shared a 98.1 to 100% identity to other Helicobacter spp. from harp seals and sea otters. A similar sequence type to species identified from cetaceans was also detected in several captive seals. This study reports for the first time the presence of Helicobacter spp. in wild and captive seals and demonstrates the diversity and broad-host range of these organisms in the marine host.     

Improved error bounds for genetic distances from DNA sequences

The genetic distance between two DNA sequences may be measured by the average number of nucleotide substitutions per position that has occurred since the two sequences diverged from a common ancestor. Estimates of this quantity can be derived from Markov models for the substitution process, while the variances are estimated using the delta method and confidence intervals calculated assuming normality. However, when the sampling distribution of the estimator deviates from normality, such intervals will not be accurate. For simple one-parameter models of nucleotide substitution, we propose a transformation of normal confidence intervals, which yields an almost exact approximation to the true confidence intervals of the distance estimators. To calculate confidence intervals for more complicated models, we propose the saddlepoint approximation. A simulation study shows that the saddlepoint-derived confidence intervals are a real improvement over existing methods.