Pathogenesis of mucosal disease: a cytopathogenic pestivirus generated by an internal deletion.

Cytopathogenic bovine viral diarrhea virus (BVDV) arises by RNA recombination in animals persistently infected with noncytopathogenic BVDV. Such animals develop fatal mucosal disease. In this report, the genome of a cytopathogenic BVDV isolate, termed CP9, is characterized. CP9-infected cells contained not only viral genomic RNA of 12.3 kb but also a BVDV-specific RNA of 8 kb. cDNA cloning and sequencing revealed that the 8-kb RNA is a BVDV genome with an internal deletion of 4.3 kb. The 8-kb RNA represents the genome of a typical defective interfering particle (DI), since its replication was strictly dependent on the presence of a helper virus and strongly interfered with the replication of the helper. Cell culture experiments demonstrated that the CP9 virus stock contains two viruses, namely, a helper virus and DI9. While the helper virus alone was noncytopathogenic, the presence of the DI conferred cytopathogenicity. Expression experiments demonstrated that p80, the marker protein of cytopathogenic BVDV, is translated from the defective genome. The occurrence of this cytopathogenic DI is linked to a fatal disease in cattle.     

The nucleotide sequence of the 5'' terminus of vesicular stomatitis virus RNA.

We have determined the nucleotide sequence for the first 50 nucleotides at the 5' terminus of vesicular stomatitis virus (VSV) genome RNA. This sequence is identical to that of the in vitro RNA polymerase product synthesized by defective interfering (DI) particles of VSV. These results confirm previous conclusions rengarding DI and standard viral terminal sequences based on hybridization studies and earlier sequencing of the DI polymerase product RNA.     

Sequence analysis of cDNA''s derived from the RNA of Sindbis virions and of defective interfering particles

Sindbis virus generates defective interfering (DI) particles during serial high-multiplicity passage in cultured cells. These DI particles inhibit the replication of infectious virus and can be an important factor in the establishment and maintenance of persistent infection in BHK cells. In an effort to understand how these DI particles are generated and how they interfere with the replication of standard virus, we performed a partial sequence analysis of the RNA obtained from two independently isolated populations of DI particles and from two Sindbis virus variants and compared these with the RNA of the parental wild-type virus. The 3'-terminal regions of the RNAs were sequenced by the dideoxy chain terminating method. Internal regions of the RNA were examined by restriction endonuclease digestion of cDNA's made to the various RNAs and by direct chemical sequencing of 5' end-labeled restriction fragments from cDNA made to the DI RNAs. One of the variant viruses examined was originally derived from cells persistently infected with Sindbis virus for 16 months and is resistant to interference by the DI strains used. In the 3'-terminal region of the RNA from this variant, only two base changes were found; one of these occurs in the 20-nucleotide 3'-terminal sequence which is highly conserved among alphaviruses. The DI RNA sequences were found to have been produced not by a single deletional event, but by multiple deletion steps combined with sequence rearrangements; all sequences examined are derived from the plus strand of Sindbis virion RNA. Both DI RNAs had at least 50 nucleotides of wild-type sequence conserved at the 3' terminus; in addition, they both contained conserved and perhaps amplified sequences derived from the non-26S region of the genome which may be of importance in their replication and interference ability.     

Structure and origin of a novel class of defective interfering particle of vesicular stomatitis virus

The genome structure and terminal sequences of a 'copyback' defective interfering (DI) particle ST1, and a novel complexly rearranged 'snapback' DI particle ST2 of vesicular stomatitis virus have been determined. The ST1 DI genome RNA possesses 54 base long inverted complementary termini, the 5' end of which is homologous to the standard virus genome 5' end. Following this region of inverted complementarity the DI RNA 5' end continues to be homologous to standard virus RNA 5' sequences, whereas the 3' end diverges into sequences within the virus L gene internal sequences. ST2 DI genome RNA does not contain colinear covalently linked plus and minus sense RNA copies of the standard infectious virus RNA 5' terminus as predicted from the prototype snapback DI structure, but instead appears to be a hairpin copy of the ST1 DI RNA genome. This is the first evidence suggesting that DI particles may be generated from RNA templates other than the standard virus RNA. Generation models and the implications of these findings for RNA virus evolution are discussed.     

Analysis of Dengue Virus Genetic Diversity during Human and Mosquito Infection Reveals Genetic Constraints

Dengue viruses (DENV) cause debilitating and potentially life-threatening acute disease throughout the tropical world. While drug development efforts are underway, there are concerns that resistant strains will emerge rapidly. Indeed, antiviral drugs that target even conserved regions in other RNA viruses lose efficacy over time as the virus mutates. Here, we sought to determine if there are regions in the DENV genome that are not only evolutionarily conserved but genetically constrained in their ability to mutate and could hence serve as better antiviral targets. High-throughput sequencing of DENV-1 genome directly from twelve, paired dengue patients’ sera and then passaging these sera into the two primary mosquito vectors showed consistent and distinct sequence changes during infection. In particular, two residues in the NS5 protein coding sequence appear to be specifically acquired during infection in Ae. aegypti but not Ae. albopictus. Importantly, we identified a region within the NS3 protein coding sequence that is refractory to mutation during human and mosquito infection. Collectively, these findings provide fresh insights into antiviral targets and could serve as an approach to defining evolutionarily constrained regions for therapeutic targeting in other RNA viruses.     

Homologous interference mediated by defective interfering influenza virus derived from a temperature-sensitive mutant of influenza virus.

A temperature-sensitive group II mutant of influenza virus, ts-52, with a presumed defect in viral RNA synthesis, readily produced von Magnus-type defective interfering virus (DI virus) when passed serially (four times) at high multiplicity in MDBK cells. The defective virus (ts-52 DI virus) had a high hemagglutinin and a low infectivity titer, and strongly interfered with the replication of standard infectious viruses (both ts-52 and wild-type ts+) in co-infected cells. Progeny virus particles produced by co-infection of DI virus and infectious virus were also defective and also had low infectivity, high hemagglutinating activity, and a strong interfering property. Infectious viruses ts+ and ts-52 were indistinguishable from ts-52 DI viruses by sucrose velocity or density gradient analysis. Additionally, these viruses all possessed similar morphology. However, when the RNA of DI viruses was analyzed by use of polyacrylamide gels containing 6 M urea, there was a reduction in the amount of large RNA species (V1 to V4), and a number of new smaller RNA species (D1 to D6) with molecular weights ranging from 2.9 X 10(5) to 1.05 X 10(5) appeared. Since these smaller RNA species (D1 to D6) were absent in some clones of infectious viruses, but were consistently associated with DI viruses and increased during undiluted passages and during co-infection of ts-52 with DI virus, they appeared to be a characteristic of DI viruses. Additionally, the UV target size of interfering activity and infectivity of DI virus indicated that interfering activity was 40 times more resistant to UV irradiation than was infectivity, further implicating small RNA molecules in interference. Our data suggest that the loss of infectivity observed among DI viruses may be due to nonspecific loss of a viral RNA segment(s), and the interfering property of DI viruses may be due to interfering RNA segments (DIRNA, D1 to D6). ts-52 DI virus interfered with the replication of standard virus (ts+) at both permissive (34 degrees C) and nonpermissive temperatures. The infectivity of the progeny virus was reduced to 0.2% for ts+ and 0.05% for ts-52 virus without a reduction in hemagglutinin titer. Interference was dependent on the concentration of DI virus. A particle ratio of 1 between DI virus (0.001 PFU/cell) and infectious virus (1.0 PFU/cell) produced a maximal amount of interference. Infectious virus yield was reduced 99.9% without any reduction of the yield of DI viruses Interference was also dependent on the time of addition of DI virus. Interference was most effective within the first 3 h of infection by infectious virus, indicating interference with an early function during viral replication.     

Defective interfering particles of poliovirus: mapping of the deletion and evidence that the deletions in the genomes of DI(1), (2) and (3) are located in the same region.

The deletions in RNAs of three defective interfering (DI) particles of poliovirus type 1 have been located and their approximate extent determined by three methods. (1) Digestion with RNase III of DI RNAs yields the same 3′-terminal fragments as digestion with RNase III of standard virus RNA. The longest 3′-terminal fragment has a molecular weight of 1.55 × 10⁶. This suggests that the deletions are located in the 5′-terminal half of the polio genome. (2) Fingerprints of RNase T₁-resistant oligonucleotides of all three DI RNAs are identical and lack four large oligonucleotides as compared to the fingerprints of standard virus, an observation suggesting that the deletions in all three DI RNAs are located in the same region of the viral genome. The deletion-specific oligonucleotides have also been shown to be within the 5′-terminal half of the viral genome by alkali fragmentation of the RNA and fingerprinting poly (A)-linked (3′-terminal) fragments of decreasing size. (3) Virion RNA of DI(2) particles was annealed with denatured double-stranded RNA (RF) of standard virus and the hybrid heteroduplex molecules examined in the electron microscope. A single loop, approximately 900 nucleotides long and 20% from one end of the molecules, was observed. Both the size and extent of individual deletions is somewhat variable in different heteroduplex molecules, an observation suggesting heterogeneity in the size of the deletion in RNA of the DI(2) population. Our data show that the DI RNAs of poliovirus contain an internal deletion in that region of the viral genome known to specify the capsid polypeptides. This result provides an explanation as to why poliovirus DI particles are unable to synthesize viral coat proteins.     

Dengue virus-like particles: construction and application

Virus-like particles (VLPs) are shell-like viruses that lack virus-specific genetic materials. Many viral-structured proteins can assemble into VLPs, which mimic the overall structure of virus particles and can elicit strong immune responses in a host. Dengue viruses (DENVs), from the genus Flavivirus, are transmitted to humans through the bites of an infected Aedes mosquito. DENVs cause several diseases that prevailed mainly in tropical and subtropical areas. However, effective treatment measures and preventive strategies for dengue diseases are still lacking. The present minireview summarized the assembly and maturation of DENVs, the strategies and effective factors for dengue VLP construction, and the application of DENV VLPs.     

Distribution of Dengue Virus Types 1 and 4 in Blood Components from Infected Blood Donors from Puerto Rico

Background

Dengue is a mosquito-borne viral disease caused by the four dengue viruses (DENV-1 to 4) that can also be transmitted by blood transfusion and organ transplantation. The distribution of DENV in the components of blood from infected donors is poorly understood.

Methods

We used an in-house TaqMan qRT-PCR assay to test residual samples of plasma, cellular components of whole blood (CCWB), serum and clot specimens from the same collection from blood donors who were DENV-RNA-reactive in a parallel blood safety study. To assess whether DENV RNA detected by TaqMan was associated with infectious virus, DENV infectivity in available samples was determined by culture in mosquito cells.

Results

DENV RNA was detected by TaqMan in all tested blood components, albeit more consistently in the cellular components; 78.8% of CCWB, 73.3% of clots, 86.7% of sera and 41.8% of plasma samples. DENV-1 was detected in 48 plasma and 97 CCWB samples while DENV-4 was detected in 21 plasma and 31 CCWB samples. In mosquito cell cultures, 29/111 (26.1%) plasma and 32/97 (32.7%) CCWB samples were infectious. A subset of samples from 29 donors was separately analyzed to compare DENV viral loads in the available blood components. DENV viral loads did not differ significantly between components and ranged from 3–8 log₁₀ PCR-detectable units/ml.

Conclusions

DENV was present in all tested components from most donors, and viral RNA was not preferentially distributed in any of the tested components. Infectious DENV was also present in similar proportions in cultured plasma, clot and CCWB samples, indicating that these components may serve as a resource when sample sizes are limited. However, these results suggest that the sensitivity of the nucleic acid tests (NAT) for these viruses would not be improved by testing whole blood or components other than plasma.     

Segment-specific noncoding sequences of the influenza virus genome RNA are involved in the specific competition between defective interfering RNA and its progenitor RNA segment at the virion assembly step.

The generation of influenza A virus defective interfering (DI) particles was studied by using an NS2 mutant which produces, in a single cycle of virus replication, a large amount of DI particles lacking the PA polymerase gene. The decrease in PA gene replication has been shown to occur primarily at the cRNA synthesis step, with preferential amplification of PA DI RNA species present in a marginal amount in the virus stock. In addition, at the assembly step the PA DI RNAs were preferentially incorporated into virions, resulting in selective reduction in the packaging of the PA gene into virions. Similarly, in cells dually infected with the NS2 mutant and wild-type viruses, packaging of the wild-type PA gene was also greatly suppressed. In contrast, incorporation of other RNA segments, i.e., the PB2 and NS genes, was not affected, suggesting that the PA DI RNAs competed only with the PA gene in a segment-specific manner. Experiments involving rescue of recombinant chloramphenicol acetyltransferase (CAT) RNA flanked by the noncoding regions of the PA (PA/CAT RNA) and PB2 (PB2/CAT RNA) genes into viral particles showed that only PA/CAT RNA was not rescued by infection with the NS2 mutant virus containing the PA DI RNAs. However, recombinant PA/CAT RNA in which either the 3' or 5' noncoding region was replaced with that of the PB2 gene was rescued by the NS2 mutant. These results suggest that the noncoding regions of the PA gene are responsible for the competition with PA DI RNA species at the virus assembly step and that coexistence of the both noncoding regions would be a prerequisite for this phenomenon. Decreased packaging of the progenitor RNA by the DI RNA, in addition to the suppression of cRNA synthesis, is likely involved in the production of DI particles.     

Loquacious modulates flaviviral RNA replication in mosquito cells

Arthropod-borne viruses infect both mosquito and mammalian hosts. While much is known about virus-host interactions that modulate viral gene expression in their mammalian host, much less is known about the interactions that involve inhibition, subversion or avoidance strategies in the mosquito host. A novel RNA-Protein interaction detection assay was used to detect proteins that directly or indirectly bind to dengue viral genomes in infected mosquito cells. Membrane-associated mosquito proteins Sec61A1 and Loquacious (Loqs) were found to be in complex with the viral RNA. Depletion analysis demonstrated that both Sec61A1 and Loqs have pro-viral functions in the dengue viral infectious cycle. Co-localization and pull-down assays showed that Loqs interacts with viral protein NS3 and both full-length and subgenomic viral RNAs. While Loqs coats the entire positive-stranded viral RNA, it binds selectively to the 3’ end of the negative-strand of the viral genome. In-depth analyses showed that the absence of Loqs did not affect translation or turnover of the viral RNA but modulated viral replication. Loqs also displayed pro-viral functions for several flaviviruses in infected mosquito cells, suggesting a conserved role for Loqs in flavivirus-infected mosquito cells.     

Defective interfering influenza viruses and host cells: establishment and maintenance of persistent influenza virus infection in MDBK and HeLa cells.

WSN (H0N1) influenza virus upon undiluted passages in different species of cells, namely, bovine kidney (MDBK), chicken embryo (CEF), and HeLa cells, produced a varying amount of defective interfering (DI) virus which correlated well with the ability of the species of cell to produce infectious virus. However, the nature of the influenza DI viral RNA produced from a single clonal stock was essentially identical in all three cells types, suggesting that these cells do not exert a great selective pressure in the amplification of specific DI viral RNAs either at early or late passages. DI viruses produced from one subtype (H0N1) could interfere with the replication of infectious viruses belonging to other subtypes (H1N1, H3N2). DI viral RNAs could also replicate with the helper function of other subtype viruses. The persistent infection of MDBK and HeLa cells could be initiated by coinfecting cells with both temperature-sensitive mutants (ts-) and DI influenza viruses. Persistently infected cultures cultures at early passages (up to passage 7) showed a cyclical pattern of cell lysis and virus production (crisis), whereas, at later passages (after passage 20), they produced little or no virus and were resistant to infection by homologous virus but not by heterologous virus. The majority of persistently infected cells, however, contained the complete viral genome since they expressed viral antigens and produced infectious centers. Selection of a slow-growing temperature-sensitive variant rather than the presence of DI virus or interferon appears to be critical in maintaining persistent influenza infection in these cells.     

Long-range RNA-RNA interactions circularize the dengue virus genome

Secondary and tertiary RNA structures present in viral RNA genomes play essential regulatory roles during translation, RNA replication, and assembly of new viral particles. In the case of flaviviruses, RNA-RNA interactions between the 5' and 3' ends of the genome have been proposed to be required for RNA replication. We found that two RNA elements present at the ends of the dengue virus genome interact in vitro with high affinity. Visualization of individual molecules by atomic force microscopy revealed that physical interaction between these RNA elements results in cyclization of the viral RNA. Using RNA binding assays, we found that the putative cyclization sequences, known as 5' and 3' CS, present in all mosquito-borne flaviviruses, were necessary but not sufficient for RNA-RNA interaction. Additional sequences present at the 5' and 3' untranslated regions of the viral RNA were also required for RNA-RNA complex formation. We named these sequences 5' and 3' UAR (upstream AUG region). In order to investigate the functional role of 5'-3' UAR complementarity, these sequences were mutated either separately, to destroy base pairing, or simultaneously, to restore complementarity in the context of full-length dengue virus RNA. Nonviable viruses were recovered after transfection of dengue virus RNA carrying mutations either at the 5' or 3' UAR, while the RNA containing the compensatory mutations was able to replicate. Since sequence complementarity between the ends of the genome is required for dengue virus viability, we propose that cyclization of the RNA is a required conformation for viral replication.     

Characterization of the Molecular Mechanism of Defective Interfering RNA-Mediated Symptom Attenuation in Tombusvirus-Infected Plants

Different tombusviruses were able to support the replication of either homologous or heterologous defective interfering (DI) RNAs, and those infected plants usually developed typical attenuated symptoms. However, in some helper virus-DI RNA combinations the inoculated plants were necrotized, although they contained a high level of DI RNA, suggesting that the accumulation of DI RNA and the resulting suppression of genomic RNA replication were not directly responsible for the symptom attenuation. Moreover, the 19-kDa protein product of ORF 5, which is known to play a crucial role in necrotic symptom development, accumulated at the same level in the infected plants in the presence of protective homologous DI RNA and in the presence of nonprotective heterologous DI RNA. It was also demonstrated, by chimeric helper viruses, that the ability of heterologous DI RNA to protect the virus-infected plants against systemic necrosis is determined by the 5′-proximal region of the helper virus genome. The results presented suggest that DI RNA-mediated protection did not operate via the specific inhibition of 19-kDa protein expression but, more likely, DI RNAs in protective DI-helper virus combinations specifically interacted with viral products, preventing the induction of necrotic symptoms.     

Dengue Virus Type 2 Infections of Aedes aegypti Are Modulated by the Mosquito's RNA Interference Pathway

A number of studies have shown that both innate and adaptive immune defense mechanisms greatly influence the course of human dengue virus (DENV) infections, but little is known about the innate immune response of the mosquito vector Aedes aegypti to arbovirus infection. We present evidence here that a major component of the mosquito innate immune response, RNA interference (RNAi), is an important modulator of mosquito infections. The RNAi response is triggered by double-stranded RNA (dsRNA), which occurs in the cytoplasm as a result of positive-sense RNA virus infection, leading to production of small interfering RNAs (siRNAs). These siRNAs are instrumental in degradation of viral mRNA with sequence homology to the dsRNA trigger and thereby inhibition of virus replication. We show that although dengue virus type 2 (DENV2) infection of Ae. aegypti cultured cells and oral infection of adult mosquitoes generated dsRNA and production of DENV2-specific siRNAs, virus replication and release of infectious virus persisted, suggesting viral circumvention of RNAi. We also show that DENV2 does not completely evade RNAi, since impairing the pathway by silencing expression of dcr2, r2d2, or ago2, genes encoding important sensor and effector proteins in the RNAi pathway, increased virus replication in the vector and decreased the extrinsic incubation period required for virus transmission. Our findings indicate a major role for RNAi as a determinant of DENV transmission by Ae. aegypti.     

The complete sequence of a unique RNA species synthesized by a DI particle of VSV.

The 2S RNA synthesized in vitro by the RNA polymerase of a defective interfering (DI) particle of vesicular stomatitis virus was labeled at its 3' terminus with 32P-cytidine 3', 5' bisphosphate and RNA ligase. Analysis of the labeled RNA showed that it was a family of RNAs of different length but all sharing the same 5' terminal sequence. The largest labeled RNA was purified by gel electrophoresis, and the sequence of 41 of its 46 nucleotides was determined by rapid RNA sequencing methods. The assignment of the remaining 5 nucleotides was made on the basis of an analysis of one of the smaller RNAs and published data. A new approach in RNA sequencing based on the identification of 3' terminal nucleotides of rna fragments originally present in the DI product or generated during the ligation reaction confirmed most of the sequence. The complete sequence of this 46 nucleotide long plus-sense RNA is: ppACGAAGACCACAAAACCAGAUAAAAAA UAAAAACCACAAGAGGGUC-OH. This RNA anneals to the RNA of the DI particle from which it was synthesized, indicating that its synthesis is template-specified. At least the first 17 and possibly all of the nucleotides are also complementary to sequences at the 3' end of two other VSV DI particles which were derived independently and whose genomes differ significantly in length. These data suggest a common 3' terminal sequence among all VSV DI particles which contain part of the Lgene region of the parental genome.     

Inhibition of dengue virus replication by diisopropyl chrysin-7-yl phosphate

Dengue fever is a tropical disease and caused by dengue virus (DENV), which is transmitted by mosquitoes and infects about 400 million people annually. With the development of international trade and travel, China is facing a growing threat. Over 40 thousands of people were infected during the 2014 DENV outbreak in Guangdong. Neither licensed vaccine nor therapeutic drug has been available. In this report, we isolated two clinical DENV strains. The full-length genome was sequenced and characterized. We also applied a flavonoid, CPI, into an anti-DENV assay. Replication of viral RNA and expression of viral protein was all strongly inhibited. These results indicated that CPI may serve as potential protective agents in the treatment of patients with chronic DENV infection.