共查询到20条相似文献,搜索用时 15 毫秒
1.
Yang M Wang W Zhong M Philippi A Lichtarge O Sanborn BM 《Molecular endocrinology (Baltimore, Md.)》2002,16(4):814-823
To identify structural elements important to specific G alpha(q) coupling in the oxytocin receptor (OTR), intracellular domains were exchanged between OTR and G alpha(s)-coupled vasopressin V(2) receptors (V(2)Rs). Substitution of sequence from the second (2i) and third (3i) intracellular domains of V(2)R into comparable positions in OTR markedly reduced ligand affinity and resulted in a loss of G alpha(q) coupling. Substitution of the 2i domain of OTR into V(2)R decreased ligand affinity and vasopressin-stimulated adenylyl cyclase activity and only slightly increased phosphatidylinositide turnover. In contrast, substitution of the OTR3i domain into V(2)R produced a receptor chimera with high ligand affinity, decreased vasopressin-stimulated adenylyl cyclase activity, and markedly enhanced ligand-stimulated phosphatidylinositide turnover. The C-terminal 36 amino acids, but not the N-terminal 13 amino acids, of the OTR3i domain contained the determinants critical for enhanced activation of PLC. Mutation of a single lysine in the C-terminal OTR3i sequence to the corresponding V(2)R residue (valine) eliminated the enhanced ability of the V(2)R chimera to stimulate PLC but did not affect maximal adenylyl cyclase stimulation. Furthermore, mutation of this residue (K270) in wild-type OTR completely abolished the ability of the receptor to stimulate phosphatidylinositide turnover, with only a small reduction in ligand affinity. These data demonstrate that OTR K270 is critically important in the stimulation by OTR of phosphatidylinositide turnover and that this determinant can also increase this activity in the V(2)R chimera. Mutation of K270 also adversely affects the ability of OTR to stimulate ERK1/2 phosphorylation. Therefore, this residue plays an important role in the specificity of OTR/G alpha(q)/PLC coupling. 相似文献
2.
The Gq-coupled oxytocin receptor (OTR) and the Gs-coupled β2-adrenergic receptor (β2AR) are both expressed in myometrial cells and mediate uterine contraction and relaxation, respectively. The two receptors represent important pharmacological targets as OTR antagonists and β2AR agonists are used to control pre-term uterine contractions. Despite their physiologically antagonistic effects, both receptors activate the MAP kinases ERK1/2, which has been implicated in uterine contraction and the onset of labor. To determine the signalling pathways involved in mediating the ERK1/2 response, we assessed the effect of blockers of specific G protein-associated pathways. In human myometrial hTERT-C3 cells, inhibition of Gαi as well as inhibition of the Gαq/PKC pathway led to a reduction of both OTR- and β2AR-mediated ERK1/2 activation. The involvement of Gαq/PKC in β2AR-mediated ERK1/2 induction was unexpected. To test whether the emergence of this novel signalling mechanism was dependent on OTR expression in the same cell, we conducted experiments in HEK 293 cells that were transfected with the β2AR alone or co-transfected with the OTR. Using this approach, we found that β2AR-mediated ERK1/2 responses became sensitive to PKC inhibition only in cells co-transfected with the OTR. Inhibitor studies indicated the involvement of an atypical PKC isoform in this process. We confirmed the specific involvement of PKCζ in this pathway by assessing PKCζ translocation to the cell membrane. Consistent with our inhibitor studies, we found that β2AR-mediated PKCζ translocation was dependent on co-expression of OTR. The present demonstration of a novel β2AR-coupled signalling pathway that is dependent on OTR co-expression is suggestive of a molecular interaction between the two receptors. 相似文献
3.
Reversi A Rimoldi V Marrocco T Cassoni P Bussolati G Parenti M Chini B 《The Journal of biological chemistry》2005,280(16):16311-16318
In human myometrial cells, the promiscuous coupling of the oxytocin receptors (OTRs) to G(q) and G(i) leads to contraction. However, the activation of OTRs coupled to different G protein pathways can also trigger opposite cellular responses, e.g. OTR coupling to G(i) inhibits, whereas its coupling to G(q) stimulates, cell proliferation. Drug analogues capable of promoting a selective receptor-G protein coupling may be of great pharmacological and clinical importance because they may target only one specific signal transduction pathway. Here, we report that atosiban, an oxytocin derivative that acts as a competitive antagonist on OTR/G(q) coupling, displays agonistic properties on OTR/G(i) coupling, as shown by specific (35)S-labeled guanosine 5'-3-O-(thio) trisphosphate ([(35)S]GTPgammaS) binding. Moreover, atosiban, by acting on a G(i)-mediated pathway(,) inhibits cell growth of HEK293 and Madin-Darby canine kidney cells stably transfected with OTRs and of DU145 prostate cancer cells expressing endogenous OTRs. Notably, atosiban leads to persistent ERK1/2 activation and p21(WAF1/CIP1) induction, the same signaling events leading to oxytocin-mediated cell growth inhibition via a G(i) pathway. Finally, atosiban exposure did not cause OTR internalization and led to only a modest decrease (20%) in the number of high affinity cell membrane OTRs, two observations consistent with the finding that atosiban did not lead to any desensitization of the oxytocin-induced activation of the G(q)-phospholipase C pathway. Taken together, these observations indicate that atosiban acts as a "biased agonist" of the human OTRs and thus belongs to the class of compounds capable of selectively discriminating only one among the multiple possible active conformations of a single G protein-coupled receptor, thereby leading to the selective activation of a unique intracellular signal cascade. 相似文献
4.
Alisson L. da Rocha Bruno C. Pereira José R. Pauli Dennys E. Cintra Claudio T. de Souza Eduardo R. Ropelle Adelino S. R. da Silva 《PloS one》2015,10(10)
The purpose of this study was to verify the effects of overtraining (OT) on insulin, inflammatory and gluconeogenesis signaling pathways in the livers of mice. Rodents were divided into control (CT), overtrained by downhill running (OTR/down), overtrained by uphill running (OTR/up) and overtrained by running without inclination (OTR). Rotarod, incremental load, exhaustive and grip force tests were used to evaluate performance. Thirty-six hours after a grip force test, the livers were extracted for subsequent protein analyses. The phosphorylation of insulin receptor beta (pIRbeta), glycogen synthase kinase 3 beta (pGSK3beta) and forkhead box O1 (pFoxo1) increased in OTR/down versus CT. pGSK3beta was higher in OTR/up versus CT, and pFoxo1 was higher in OTR/up and OTR versus CT. Phosphorylation of protein kinase B (pAkt) and insulin receptor substrate 1 (pIRS–1) were higher in OTR/up versus CT and OTR/down. The phosphorylation of IκB kinase alpha and beta (pIKKalpha/beta) was higher in all OT protocols versus CT, and the phosphorylation of stress-activated protein kinases/Jun amino-terminal kinases (pSAPK-JNK) was higher in OTR/down versus CT. Protein levels of peroxisome proliferator-activated receptor-gamma coactivator 1alpha (PGC-1alpha) and hepatocyte nuclear factor 4alpha (HNF-4alpha) were higher in OTR versus CT. In summary, OTR/down improved the major proteins of insulin signaling pathway but up-regulated TRB3, an Akt inhibitor, and its association with Akt. 相似文献
5.
Oxytocin receptor (OTR) activates the GTP-binding protein Galpha(q). To investigate whether the N-terminal region of the fourth intracellular domain of this receptor, which forms putative helix 8, plays a role in coupling, its hydrophilic residues (H7.59, H7.62, E7.63, Q7.66, and R7.67) were mutated individually to alanine. In COSM6 cells, these mutants were expressed at equivalent concentrations, but at lower concentrations than OTR. Alanine substitution for H7.62 or Q7.66 did not substantially affect the affinity for OT (K(d) = 0.63 and 0.48 nM, respectively, vs 0.52 nM for the wild type), whereas substitution for H7.59, E7.63, or R7.67 reduced the affinity 5-6-fold. When expressed at equal concentrations, OTR-H7.62/A and OTR-Q7.66/A stimulated phosphatidylinositide turnover as well as OTR, whereas OTR-H7.59/A, OTR-E7.63/A, and OTR-R7.67/A exhibited an impaired ability to respond to OT. Therefore, residues H7.59, E7.63, and R7.67 within the putative hydrophilic interface appeared to influence both the OTR conformation and Galpha(q) coupling. To explore this further, five multiple alanine substitution mutants were constructed. Alanine modification at H7.62 and Q7.66 did not substantially affect the affinity for OT (K(d) = 0.75 nM), whereas any combination of alanine substitutions for H7.59, E7.63, and R7.67 produced mutant receptors that lost high-affinity ligand binding. While OTR-(H7.62,Q7.66)/A exhibited PLC activation equivalent to that of OTR, receptors with two or more changes in H7.59, E7.63, and R7.67 lost the ability to respond to OT in a dose-dependent manner. Five residues (L7.60, F7.61, L7.64, V7.65, and F7.68) in the opposite hydrophobic interface were also mutated to alanine. None of these substitutions affected ligand binding; only OTR-(L7.60,F7.61)/A had a somewhat weaker ability to activate PLC. These data are consistent with the prediction that these residues lie within an amphipathic alpha-helix and emphasize the importance of this hydrophilic interface, and particularly of H7.59, E7.63, and R7.67, in OTR function. 相似文献
6.
Zhong M Parish B Murtazina DA Ku CY Sanborn BM 《American journal of physiology. Endocrinology and metabolism》2007,292(4):E977-E984
Previously, residue K6.30 in the COOH-terminal region of the third intracellular domain (3iC) of the oxytocin (OT) receptor (OTR) was identified as important for receptor function leading to phospholipase C activation in both OTR and the vasopressin V(2) receptor (V(2)R) chimera V(2)ROTR3iC. Substitution of either A6.28K or V6.30K in wild-type V(2)R did not recapitulate the increase in phosphatidylinositide (PI) turnover observed in V(2)ROTR3iC. Hence, the role of K6.30 may be context-specific. Deletion of two NH(2)-terminal OTR3iC segments in the V(2)ROTR3iC chimera did not diminish vasopressin-stimulated PI turnover, whereas deletion of RVSSVKL (residues 6.19-6.25) reduced receptor expression. Deletion of this sequence in wild-type OTR reduced expression by 50% without affecting affinity for [(3)H]OT. This OTR mutant was unable to activate PI turnover or extracellular signal-regulated kinase 1/2 phosphorylation. The effects of alanine substitution for individual residues in RVSSVKL indicated differential importance for OTR function. The R6.19A substitution lost high-affinity sites for [(3)H]OT and the ability to stimulate PI turnover. Affinity for [(3)H]OT and membrane expression was not affected by any other substitutions. OTR-V6.20A and OTR-K6.24A mutants functioned as well as wild-type OTR, whereas OTR S6.21A, S6.22A, and V6.23A mutants exhibited impaired abilities to activate PI turnover (20-40% of OTR), and the OTR-L6.25A mutant exhibited constitutive activity. In conclusion, specific amino acids in the RVSSVKL segment in the COOH-terminal region of the third intracellular domain of OTR influence the ability of OTR to activate G protein-mediated actions. 相似文献
7.
Although the oxytocin receptor (OTR) mediates many important functions including uterine contractions, milk ejection, and maternal behavior, the mechanisms controlling agonist-induced OTR desensitization have remained unclear, and attempts to demonstrate involvement of a G protein-coupled receptor kinase (GRK) have so far failed. Using the OTR as a model, we demonstrate here directly for the first time the dynamics of agonist-induced interactions of a GRK with a G protein-coupled receptor in real time, using time-resolved bioluminescence resonance energy transfer. GRK2/receptor interactions started within 4 sec, peaked at 10 sec, and decreased to less than 40% within 8 min. By contrast, beta-arrestin/OTR interactions initiated only at 10 sec, reached plateau levels at 120 sec, but remained stable with little decrease thereafter. Physical GRK2/OTR association was further demonstrated by coimmunoprecipitation of endogenous GRK2 with activated OTR. In COS-7 cells, which express low levels of GRK2 and beta-arrestin, overexpression of GRK2 and beta-arrestin increased receptor phosphorylation, desensitization, and internalization to the high levels observed in human embryonic kidney 293 cells. By contrast, specific inhibition of endogenous GRK2 by dominant-negative mutants robustly inhibited OTR phosphorylation and internalization as well as arrestin/OTR interactions. These data characterize the temporal and causal relationship of GRK-2/OTR and beta-arrestin/OTR interactions and establish GRK/OTR interaction as a prerequisite for beta-arrestin-mediated OTR desensitization. 相似文献
8.
Influence of protein kinases on the osmosensitive release of taurine from cerebellar granule neurons
Morales-Mulia S Cardin V Torres-Márquez ME Crevenna A Pasantes-Morales H 《Neurochemistry international》2001,38(2):153-161
The role of phosphorylation events on the activation and modulation of the osmosensitive (3)H-taurine release (OTR) was examined in cultured cerebellar granule neurons (CGN) stimulated with 30% hyposmotic solutions. OTR was not decreased when [Ca(2+)](i) rise evoked by hyposmolarity was prevented by EGTA-AM (50 microM) or depleted by treatment with 1 microM ionomycin in Ca(2+)-free medium. Accordingly, OTR was not inhibited by Ca(2+)-dependent signaling events. The calmodulin (CAM) blocker W-7 (50 microM) potentiated OTR while the Ca(2+)/CAM kinase blocker KN-93 (10 microM) was without effect. Blockade of PKC by H-7, H-8 (50 microM) and G?6976 (1 microM), as well as activation by phorbol myristate acetate (PMA) (100 nM) did not influence OTR, but chronic treatment to down regulate PKC decreased it by 30%. Forskolin (20 microM) and 8-BrcAMP (10 microM) did not change OTR. Protein tyrosine phosphorylation seems to be of crucial importance in the activation and modulation of OTR, as it was markedly inhibited (90%) by tyrphostine A23 (50 microM) and potentiated by the tyrosine phosphatase inhibitor ortho-vanadate (100 microM). The PI3 kinase blocker wortmannin 100 nM essentially abolished OTR but LY294002 (10-100 microM) was without effect. This difference may be accounted for PI3K isoforms in neurons with different sensitivity to the blockers. Alternatively, the effect of wortmannin may be exerted not in PI3 kinase but instead on phospholipases, which are also sensitive to this blocker. The hyposmotic stimulus induced activation of Erk1/Erk2, but blockade of this effect by PD 98059 (50 microM) only marginally decreased OTR suggesting that the Erk1/Erk2 is an epiphenomenon, not directly involved in OTR activation. 相似文献
9.
Kinsey CG Bussolati G Bosco M Kimura T Pizzorno MC Chernin MI Cassoni P Novak JF 《Journal of cellular and molecular medicine》2007,11(1):96-110
Oxytocin receptor (OTR) is a membrane protein known to mediate oxytocin (OT) effects, in both normal and neoplastic cells. We report here that human osteosarcoma (U2OS, MG63, OS15 and SaOS2), breast cancer (MCF7), and primary human fibroblastic cells (HFF) all exhibit OTR not only on the cell membrane, but also in the various nuclear compartments including the nucleolus. Both an OTR-GFP fusion protein and the native OTR appear to be localized to the nucleus as detected by transfection and/or confocal immunofluorescence, respectively. Treatment with oxytocin causes internalization of OTR and the resulting vesicles accumulate in the vicinity of the nucleus and some of the perinuclear OTR enters the nucleus. Western blots indicate that OTR in the nucleus and on the plasma membrane are likely to be the same biochemical and immunological entities. It appears that OTR is first visible in the nucleoli and subsequently disperses within the nucleus into 4-20 spots while some of the OTR diffuses throughout the nucleoplasm.The behaviour and kinetics of OTR-GFP and OTR are different, indicating interference by GFP in both OTR entrance into the nucleus and subsequent relocalization of OTR within the nucleus. There are important differences among the tested cells, such as the requirement of a ligand for transfer of OTR in nuclei. A constitutive internalization of OTR was found only in osteosarcoma cells, while the nuclear localization in all other tested cells was dependent on ligand binding. The amount of OTR-positive material within and in the vicinity of the nucleus increased following a treatment with oxytocin in both constitutive and ligand-dependent type of cells. The evidence of OTR compartmentalization at the cell nucleus (either ligand-dependent or constitutive) in different cell types suggests still unknown biological functions of this protein or its ligand and adds this G-protein-coupled receptor to other heptahelical receptors displaying this atypical and unexpected nuclear localization. 相似文献
10.
T Kimura R Ivell W Rust Y Mizumoto K Ogita C Kusui Y Matsumura C Azuma Y Murata 《Biochemical and biophysical research communications》1999,264(1):86-92
The US-2 DNA-binding element (ggaatgattactcagctaga) in the promoter of the human oxytocin receptor (OTR) gene has been shown to bind specifically nuclear proteins from human myometrium at parturition. To elucidate the molecular mechanisms involved in OTR gene upregulation at term, the US-2 element was used in a yeast one-hybrid system to screen a cDNA library derived from term human myometrium. Positive clones were further screened by electrophoretic mobility shift assay for their ability to bind the human OTR gene promoter, containing the US-2 motif. A 2.3-kb full-length cDNA encoding a human homologue of chicken MafF (hMafF) was isolated. hMafF represents an 18-kDa protein and contains an extended leucine zipper structure, but lacks a transactivation domain. Furthermore, Northern hybridization showed strong hMafF mRNA expression in the kidney and in term myometrium only, but not in nonpregnant myometrium. The hMafF protein is also preferentially expressed in term myometrium, as shown by specific binding to the OTR promoter. The highly specific binding of hMafF to the US-2 motif in the human OTR gene, together with its pattern of expression, supports a role for hMafF in OTR gene upregulation at term. 相似文献
11.
Beta 2-agonist treatment enhances uterine oxytocin receptor mRNA expression in pregnant rats 总被引:1,自引:0,他引:1
The objective of this study was to disclose an interaction between Beta(2)-adrenergic (Beta(2)-ARs) and oxytocin (OT) receptors (OTRs) in the late-pregnant rat uterus. We investigated the level of uterine OTR mRNA expression after the administration of Beta(2)-AR agonists fenoterol and hexoprenaline to rats from day 18 to 22 of pregnancy, and also tested the effect of fenoterol on uterine explants. Hexoprenaline induced a maximum 24% increase of OTR mRNA. Fenoterol in vivo elicited a maximum 125% increase of OTR mRNA, in vitro produced a maximum fourfold increase in OTR mRNA. In fenoterol-treated rats the maximal contractility increasing effect of OT on isolated uterine rings was significantly higher than in intact term pregnant rats, but the EC50 values were not statistically different. It was concluded that the enhanced expression of OTR mRNA induced by Beta(2)-agonists in the late-pregnant rat uterus may be a possible drawback to effective therapy of preterm uterine contractions with Beta(2)-agonists. 相似文献
12.
Social interest reflects the motivation to approach a conspecific for the assessment of social cues and is measured in rats by the amount of time spent investigating conspecifics. Virgin female rats show lower social interest towards unfamiliar juvenile conspecifics than virgin male rats. We hypothesized that the neuropeptide oxytocin (OT) may modulate sex differences in social interest because of the involvement of OT in pro-social behaviors. We determined whether there are sex differences in OT system parameters in the brain and whether these parameters would correlate with social interest. We also determined whether estrus phase or maternal experience would alter low social interest and whether this would correlate with changes in OT system parameters. Our results show that regardless of estrus phase, females have significantly lower OT receptor (OTR) binding densities than males in the majority of forebrain regions analyzed, including the nucleus accumbens, caudate putamen, lateral septum, bed nucleus of the stria terminalis, medial amygdala, and ventromedial hypothalamus. Interestingly, male social interest correlated positively with OTR binding densities in the medial amygdala, while female social interest correlated negatively with OTR binding densities in the central amygdala. Proestrus/estrus females showed similar social interest to non-estrus females despite increased OTR binding densities in several forebrain areas. Maternal experience had no immediate or long-lasting effects on social interest or OT brain parameters except for higher OTR binding in the medial amygdala in primiparous females. Together, these findings demonstrate that there are robust sex differences in OTR binding densities in multiple forebrain regions of rats and that OTR binding densities correlate with social interest in brain region- and sex-specific ways. 相似文献
13.
14.
We present robust methods for online estimation of cell specific oxygen uptake and carbon dioxide production rates (q(O2) and q(CO2), respectively) during perfusion cultivation of mammalian cells. Perfusion system gas and liquid phase mass balance expressions for oxygen and carbon dioxide were used to estimate q(O2), q(CO2) and the respiratory quotient (RQ) for Chinese hamster ovary (CHO) cells in perfusion culture over 12 steady states with varying dissolved oxygen (DO), pH, and temperature set points. Under standard conditions (DO = 50%, pH = 6.8, T = 36.5°C), q(O2) and q(CO2) ranges were 5.14-5.77 and 5.31-6.36 pmol/cell day, respectively, resulting in RQ values of 0.98-1.14. Changes to DO had a slight reducing effect on respiration rates with q(O2) and q(CO2) values of 4.64 and 5.47, respectively, at DO = 20% and 4.57 and 5.12 at DO = 100%. Respiration rates were lower at low pH with q(O2) and q(CO2) values of 4.07 and 4.15 pmol/cell day at pH = 6.6 and 4.98 and 5.36 pmol/cell day at pH = 7. Temperature also impacted respiration rates with respective q(O2) and q(CO2) values of 3.97 and 4.02 pmol/cell day at 30.5°C and 5.53 and 6.25 pmol/cell day at 37.5°C. Despite these changes in q(O2) and q(CO2) values, the RQ values in this study ranged from 0.98 to 1.23 suggesting that RQ was close to unity. Real-time q(O2) and q(CO2) estimates obtained using the approach presented in this study provide additional quantitative information on cell physiology both during bioprocess development and commercial biotherapeutic manufacturing. 相似文献
15.
Friebe-Hoffmann U Baston DM Chiao JP Winebrenner LD Krüssel JS Hoffmann TK Hirchenhain J Rauk PN 《Regulatory peptides》2007,138(2-3):74-81
Experimental objectives: Activation of the oxytocin receptor (OTR) induces phospholipase C induced PIP(2) turnover in the human uterus. Relaxin (RLX), a polypeptide hormone produced in the corpus luteum of pregnancy as well as in the placenta and decidua inhibits PIP(2) turnover and subsequent signaling in human myometrium. The purpose of this study was to evaluate a possible effect of RLX on OTR regulation in human uterine smooth muscle cells. Primary cultures of myometrium from term pregnant women undergoing elective caesarean section were incubated for different time periods (0-96 h) and with different concentrations of RLX [10 pg/ml-20 microg/ml]. The effects on OTR binding, mRNA and protein expression were evaluated by means of (125)I-OVT binding assay, RT-PCR and flow cytometry. RESULTS: Prolonged RLX incubation was able to inhibit 30-40% of OTR binding while binding affinity remained unchanged. Oxytocin receptor mRNA and protein expression were down regulated by RLX about 50% and 35% respectively. CONCLUSION: We report for the first time an effect of RLX on OTR regulation in human uterine myometrial cells. The above results indicate that high local uterine RLX concentrations may be involved in uterine quiescence during human pregnancy by down regulating the OTR. 相似文献
16.
Smith MP Ayad VJ Mundell SJ McArdle CA Kelly E López Bernal A 《Molecular endocrinology (Baltimore, Md.)》2006,20(2):379-388
Oxytocin (OT) has long been used as an uterotonic during labor management in women, and yet responses to OT infusion remain variable and unpredictable among patients. The investigation of oxytocin receptor (OTR) regulation will benefit labor management, because the clinical practice of continuous iv infusion of OT is not optimal. As with other G protein-coupled receptors, it is likely that the OTR internalizes and/or desensitizes upon continuous agonist exposure. The mechanisms by which this might occur, however, are unclear. Here we explore OTR internalization and desensitization in human embryonic kidney cells by utilizing inhibitors of heterologous second messenger systems and recently available mutant cDNA constructs. We report rapid and extensive internalization and desensitization of the OTR upon agonist exposure. Internalization was unaffected by inhibitors of protein kinase C or Ca(2+) calmodulin-dependant kinase II but was significantly reduced after transfection with dominant-negative mutant cDNAs of G protein-coupled receptor kinase 2, beta-Arrestin2, Dynamin, and Eps15 (a component of clathrin-coated pits). Moreover, desensitization of the OTR, measured by a calcium mobilization assay, was also inhibited by the aforementioned cDNA constructs. Thus, our data demonstrate, for the first time, the importance of the classical clathrin-mediated pathway during agonist-induced OTR internalization and desensitization. 相似文献
17.
Francisco M. Gí rio J. Carlos Roseiro Pascolina S -Machado A. Rita Duarte-Reis M. T. Amaral-Colla o 《Enzyme and microbial technology》1994,16(12):1074-1078
The titers of key enzymes of xylose metabolism were measured and correlated with the kinetics of xylitol production by Debaryomyces hansenii under different oxygen transfer rates (OTR) in a batch reactor. An OTR change from 2.72 to 4.22 mmol O2 l−1 min−1 resulted in a decrease in NADPH-dependent xylose reductase (XR) and NAD ± -dependent xylitol dehydrogenase (XDH) activities. For higher values of OTR (12.93 mmol O2 l−1 min−1, the XDH titer increased twofold whereas the XR titer did not show a significant change. At the lowest OTR (2.72 mmol O2 l−1 min−1), xylitol (and ethanol) production rates showed the highest values. However, xylitol specific productivity was twice as high as ethanol specific productivity. The titer of the NADPH-forming enzyme, glucose-6-phosphate dehydrogenase (GPDH), increased from 333 to 412 mU mg−1 when the OTR was increased. However, 6-phosphogluconate dehydrogenase (PGDH) activity remained unchanged and at a lower level, which indicates that this enzyme is responsible for the carbon flux control of the oxidative branch of the pentose phosphate pathway. The activity of the alcohol-forming enzyme was repressed at the higher amount of oxygen, decreasing its activity more than 50%. The changes in ADH suggested that two different metabolic regions under oxygen-limited conditions can be hypothesized for xylose metabolism by D. hansenii. For low OTR values (up to 4.22 mmol O2 l−1 min−1), a fermentative-type activity is displayed. At higher OTR values (above 4.22 mmol O2 l−1 min−1), no significant fermentative activity is reported. 相似文献
18.
Oxytocin receptor (OTR) expression is suppressed by progesterone (P4) during the luteal phase of the estrous cycle and then it increases at the time of luteolysis, but its regulation is still not completely understood. In vitro studies to determine the mechanism of action are hindered because OTR spontaneously upregulates in vitro and it is impossible to alter expression with P4 or estradiol. During recent studies examining the effect of P4 and an antagonist (mifepristone) on PG secretion, we found that mifepristone attenuated OT-stimulated PG secretion from endometrial epithelial cells. The objective of the present study was to determine, whether this effect of mifepristone was due to changes in prostaglandin synthesis and/or OTR. A time-course showed that mifepristone (5 microM) had no significant effect after 24 h but by 72 h it decreased PGF(2alpha) secretion (P<0.01) and abolished the response of the cells to OT (P<0.01). The presence or absence of P4 did not affect the response to mifepristone. To determine the site of action of mifepristone, cells were cultured for 72 h with or without mifepristone and then COX-1 and COX-2 were measured by Western blotting and OTR was measured by saturation analysis. The results showed that mifepristone did not affect basal or PMA-stimulated expression of either COX-1 or COX-2 but did, however, decrease OTR number (P<0.05). These data demonstrate that OTR and the response to OT can be downregulated in endometrial epithelial cells in vitro via a mechanism involving the P4 receptor. 相似文献
19.
20.
A synthetic glycosaminoglycan mimetic binds vascular endothelial growth factor and modulates angiogenesis 总被引:2,自引:0,他引:2
Rouet V Hamma-Kourbali Y Petit E Panagopoulou P Katsoris P Barritault D Caruelle JP Courty J 《The Journal of biological chemistry》2005,280(38):32792-32800
In a previous study, we showed that in situ injection of glycosaminoglycan mimetics called RGTAs (ReGeneraTing Agents) enhanced neovascularization after skeletal muscular ischemia (Desgranges, P., Barbaud, C., Caruelle, J. P., Barritault, D., and Gautron, J. (1999) FASEB J. 13, 761-766). In the present study, we showed that the RGTA OTR4120 modulated angiogenesis in the chicken embryo chorioallantoic membrane assay, in a dose-dependent manner. We therefore investigated the effect of OTR4120 on one of the most specific angiogenesis-regulating heparin-binding growth factors, vascular endothelial growth factor 165 (VEGF165). OTR4120 showed high affinity binding to VEGF165 (Kd = 2.2 nm), as compared with heparin (Kd = 15 nm), and potentiated the affinity of VEGF165 for VEGF receptor-1 and -2 and for neuropilin-1. In vitro, OTR4120 potentiated VEGF165-induced proliferation and migration of human umbilical vein endothelial cells. In the in vivo Matrigel plug angiogenesis assay, OTR4120 in a concentration as low as 3 ng/ml caused a 6-fold increase in VEGF165-induced angiogenesis. Immunohistochemical staining showed a larger number of well differentiated VEGFR-2-expressing-cells in Matrigel sections of OTR4120-treated plug than in control sections. These findings indicate that OTR4120 enhances the VEGF165-induced angiogenesis and therefore may hold promise for treating disorders characterized by deficient angiogenesis. 相似文献