A cis-acting element that directs circular adeno-associated virus replication and packaging

A novel pathway of adeno-associated virus (AAV) replication marked by the assembly of circular monomer duplex intermediates (cAAV) has been recently discovered. In the present report we identify a single AD domain of the inverted terminal repeat as a minimal origin of cAAV replication. A small internal palindrome (BB'), necessary for optimal Rep-inverted terminal repeat interaction, does not contribute to the efficiency of cAAV replication, while the terminal resolution site is an essential cis-acting element. Furthermore, recombinant cAAV vectors that encompass only the AD domain replicate exclusively in a circular form and no detectable linear duplex replicative intermediates are generated, suggesting that both pathways of AAV replication are independent and can be separated. In addition, we show that cAAVs are efficient templates for encapsidation of single-stranded DNA genomes, an observation that assigns a biological role for these novel replication species. Together, these findings shed new light on the current model of AAV replication and packaging.     

Novel cis-acting replication element in the adeno-associated virus type 2 genome is involved in amplification of integrated rep-cap sequences

This study identifies a region of the adeno-associated virus type 2 (AAV-2) rep gene (nucleotides 190 to 540 of wild-type AAV-2) as a cis-acting Rep-dependent element able to promote the replication of transiently transfected plasmids. This viral element is also shown to be involved in the amplification of integrated sequences in the presence of adenovirus and Rep proteins.     

cis effects in adeno-associated virus type 2 replication

We have utilized deletion mutants of adeno-associated virus (AAV) to investigate which elements of the AAV genome are required in cis for high yields of the wild-type virus in a plasmid transfection assay and in addition whether these elements affect primarily AAV DNA replication or encapsidation. All tested deletions from within the Rep region demonstrated a modest, approximately threefold, decrease in viral production. Deletions within the cap region resulted in markedly less virus. Previous observations suggested that in cells in which recombinant AAV (rAAV) was produced, as in our assay with the helper plasmid pDG, there is a substantial excess of empty capsids. Co-transfections of high- and low-yielding constructs demonstrated that under conditions where Cap is abundant, the constructs with cap deletions did not package efficiently. These observation suggest that the lower yields of rAAV cannot be entirely due to lack of capsids but that elements within the cap region of the wild-type genome are important for efficient encapsidation. The production of virus by the mutants we tested was, however, not consistent with the disruption of a cis-acting packaging signal. Apparently, when Cap is provided "in trans," encapsidation is inefficient. A second observation is that there were equivalent amounts of replicated but unencapsidated viral DNA in cells transfected with each of our constructs. We propose that, in accord with the previously proposed link between DNA replication and encapsidation, the total amount of AAV DNA replication can be limited by the efficiency of encapsidation.     

Helper-independent retrovirus vectors with Rous-associated virus type O long terminal repeats.

We have constructed nonpermuted replication-competent avian retrovirus vectors that derive from Rous sarcoma virus (S. H. Hughes, J. J. Greenhouse, C. J. Petropoulos, and P. Sutrave, J. Virol. 61:3004-3012, 1987). We describe here the construction and properties of corresponding vectors in which the long terminal repeats (LTRs) of the parental virus have been replaced by the LTRs of the endogenous chicken virus Rous-associated virus type O. The Rous-associated virus type O LTR vectors replicated approximately 1/10 as well as the parental vectors and expressed a test gene, chloramphenicol acetyltransferase, approximately 1/30 to 1/50 as well.     

Control of adeno-associated virus type 2 cap gene expression: relative influence of helper virus, terminal repeats, and Rep proteins.

Adeno-associated virus type 2 (AAV-2) gene expression is tightly controlled by functions of the helper virus as well as by the products of its own viral rep gene. Double-immunofluorescence studies of Rep and VP protein expression in cells coinfected with AAV-2 and adenovirus type 2 showed that a large proportion of these cells expressed Rep78 and Rep52 but no capsid proteins. The percentage of Rep78/Rep52- and capsid protein-positive cells was strongly influenced by the relative ratio of AAV-2 to adenovirus type 2. In contrast, nearly all cells positive for Rep68/Rep40 were also positive for capsid protein expression. Examination of p40 promoter transactivation by individual Rep proteins in the presence of adenovirus, however, showed that both Rep78 and Rep68 efficiently stimulated p40 mRNA accumulation and capsid protein expression. This strong transactivation was reliant upon the presence of terminal repeats and correlated with template amplification. In replication-deficient expression constructs, transactivation was observed only with Rep68 and was dependent on the linear Rep binding site within the left terminal repeat which was detected in the presence of high adenovirus concentrations. In the absence of any terminal repeat sequences, Rep68 expression again led to a minor transactivation of capsid protein expression which was detectable only at low adenovirus concentrations. This low level of transactivation of capsid protein expression by Rep proteins in the absence of terminal repeats resulted in a lower efficiency of capsid assembly. The data show a dominant influence of adenovirus type 2 functions on AAV-2 gene expression, a requirement for terminal repeats for strong transactivation of the p40 promoter by Rep proteins, and differential influences of Rep78 and Rep68 on AAV-2 promoters. Implications for the production of recombinant AAV-2 vectors are discussed.     

Sequence requirements for stable binding and function of Rep68 on the adeno-associated virus type 2 inverted terminal repeats.

Replication of the palindromic inverted terminal repeats (ITRs) of adeno-associated virus type 2 requires several functions of the viral nonstructural Rep proteins. These include binding to the ITR, nicking of the double-stranded replication intermediate at the terminal resolution site (trs), and then strand displacement and synthesis from the nick. This report demonstrates the ability of both recombinant fusion maltose-binding protein (MBP)-Rep68 delta produced in Escherichia coli and wild-type (wt) Rep68 to bind to a linear truncated form of the ITR, delta 57 ITR, with similar affinity as to the wt hairpin ITR. A dissociation constant for MBP-Rep68 delta of approximately 8 x 10(-10) M was determined for the wt ITR and delta 57 ITR probes. Truncation of delta 57 ITR to generate delta 28 ITR, which retains the GCTC repeat motif but not the trs, bound at least 10 times less efficiently than delta 57 ITR. Extension of delta 28 ITR with nonspecific sequence restored the ability of MBP-Rep68 delta to bind to delta 28 ITR. Thus, high-affinity binding would appear to require stabilization by flanking sequence as well as the intact GCTC repeat motif. Cleavage of the delta 57 ITR probe with DdeI, which truncates the flanking sequence and was previously shown to inhibit binding by Rep68, also inhibited the binding of MBP-Rep68 delta. The requirements for stable binding were further defined with a series of oligonucleotide probes which spanned the region protected by MBP-Rep78 in DNase I footprinting. The binding activity of either MBP-Rep68 delta or wt Rep68 to hairpin ITR or delta 57 ITR was indistinguishable. However, the binding activity of MBP-Rep68 delta to DNA does not appear to correlate with trs endonuclease activity. The nicking and covalent linkage of MBP-Rep68 delta to the nonhairpin delta 57 ITR was approximately 100-fold less efficient than its linkage to a hairpin-containing ITR. Therefore, although the hairpin portion of the ITR does not appear to play a role in recognition and stabilization of MBP-Rep68 delta binding, its presence does affect the trs cleavage activity of the protein.     

Scalable production of adeno-associated virus type 2 vectors via suspension transfection

Vectors derived from adeno-associated virus type 2 (AAV2) are promising gene delivery vehicles, but it is still challenging to get the large number of recombinant adeno-associated virus (rAAV) particles required for large animal and clinical studies. Current transfection technology requires adherent cultures of HEK 293 cells that can only be expanded by preparing multiple culture plates. A single large-scale suspension culture could replace these multiple culture preparations, but there is currently no effective co-transfection scheme for generating rAAV from cells in suspension culture. Here, we weaned HEK 293 cells to suspension culture using hydrogel-coated six-well culture plates and established an efficient transfection strategy suitable for these cells. Then the cultures were gradually scaled up. We used linear polyethylenimine (PEI) to mediate transfection and obtained high transfection efficiencies ranging from 54% to 99%, thereby allowing efficient generation of rAAV vectors. Up to 10(13) rAAV particles and, more importantly, up to 10(11) infectious particles were generated from a 2-L bioreactor culture. The suspension-transfection strategy of this study facilitates the homogeneous preparation of rAAV at a large scale, and holds further potential as the basis for establishing a manufacturing process in a larger bioreactor.     

Efficient replication, integration, and packaging of retroviral vectors with modified long terminal repeats containing the packaging signal.

Retroviral vectors were modified to contain packaging (psi) signals of varying lengths (nucleotides 211-355, 211-565, or 211-1039 of MoMuLV RNA) between the U3-r and U5 sequences of their 5' long terminal repeat (LTR). For the vector MoTN-PR3, containing the full length 211-1039 nucleotide-long psi signal within the 5' LTR, replication, integration, and packaging were almost as efficient as for the original unmodified vector. This result confirmed that the 211-1039 nucleotide-long sequence from the MoMuLV RNA is sufficient and necessary to allow efficient packaging of RNAs. In addition, an important site was revealed where insertion of foreign DNA sequences of up to 829 nucleotides can be made within the 5' LTR, between U3-r and U5 sequences, without affecting viral replication, integration, or packaging.     

Rep-dependent initiation of adeno-associated virus type 2 DNA replication by a herpes simplex virus type 1 replication complex in a reconstituted system

Productive infection by adeno-associated virus type 2 (AAV) requires coinfection with a helper virus, e.g., adenovirus or herpesviruses. In the case of adenovirus coinfection, the replication machinery of the host cell performs AAV DNA replication. In contrast, it has been proposed that the herpesvirus replication machinery might replicate AAV DNA. To investigate this question, we have attempted to reconstitute AAV DNA replication in vitro using purified herpes simplex virus type 1 (HSV-1) replication proteins. We show that the HSV-1 UL5, UL8, UL29, UL30, UL42, and UL52 gene products along with the AAV Rep68 protein are sufficient to initiate replication on duplex DNA containing the AAV origins of replication, resulting in products several hundred nucleotides in length. Initiation can occur also on templates containing only a Rep binding site and a terminal resolution site. We further demonstrate that initiation of DNA synthesis can take place with a subset of these factors: Rep68 and the UL29, UL30, and UL42 gene products. Since the HSV polymerase and its accessory factor (the products of the UL30 and UL42 genes) are unable to efficiently perform synthesis by strand displacement, it is likely that in addition to creating a hairpin primer, the AAV Rep protein also acts as a helicase for DNA synthesis. The single-strand DNA binding protein (the UL29 gene product) presumably prevents reannealing of complementary strands. These results suggest that AAV can use the HSV replication apparatus to replicate its DNA. In addition, they may provide a first step for the development of a fully reconstituted AAV replication assay.     

Adeno-associated virus type 2 DNA replication in vivo: mutation analyses of the D sequence in viral inverted terminal repeats.

The adeno-associated virus type 2 (AAV) genome contains inverted terminal repeats (ITRs) of 145 nucleotides. The terminal 125 nucleotides of each ITR form palindromic hairpin (HP) structures that serve as primers for AAV DNA replication. These HP structures also play an important role in integration as well as rescue of the proviral genome from latently infected cells or from recombinant AAV plasmids. Each ITR also contains a stretch of 20 nucleotides, designated the D sequence, that is not involved in HP structure formation. We have recently shown that the D sequence plays a crucial role in high-efficiency rescue, selective replication, and encapsidation of the AAV genome and that a host cell protein, designated the D sequence-binding protein (D-BP), specifically interacts with this sequence (X.-S. Wang, S. Ponnazhagan, and A. Srivastava, J. Virol. 70:1668-1677, 1996). We have now performed mutational analyses of the D sequences to evaluate their precise role in viral DNA rescue, replication, and packaging. We report here that 10 nucleotides proximal to the HP structure in each of the D sequences are necessary and sufficient to mediate high-efficiency rescue, replication, and encapsidation of the viral genome in vivo. In in vitro studies, the same 10 nucleotides were found to be required for specific interaction with D-BP, but viral Rep protein-mediated cleavage at the functional terminal resolution site is independent of these sequences. These data suggest that AAV replication and terminal resolution functions can be uncoupled and that the lack of efficient replication of AAV DNA may not be a consequence of impaired resolution of the viral ITRs. These studies further illustrate that the D sequence-D-BP interaction plays an important role in the AAV life cycle and indicate that it may be possible to develop the next generation of AAV vectors capable of encapsidating larger pieces of DNA.     

Infectious entry pathway of adeno-associated virus and adeno-associated virus vectors

We have investigated the infectious entry pathway of adeno-associated virus (AAV) and recombinant AAV vectors by assessing AAV-mediated gene transfer and by covalently conjugating fluorophores to AAV and monitoring entry by fluorescence microscopy. We examined AAV entry in HeLa cells and in HeLa cell lines which inducibly expressed a dominant interfering mutant of dynamin. The data demonstrate that AAV internalizes rapidly by standard receptor-mediated endocytosis from clathrin-coated pits (half-time <10 min). The lysosomotropic agents ammonium chloride and bafilomycin A(1) prevent AAV-mediated gene transfer when present during the first 30 min after the onset of endocytosis, indicating that AAV escapes from early endosomes yet requires an acidic environment for penetration into the cytosol. Following release from the endosome, AAV rapidly moves to the cell nucleus and accumulates perinuclearly beginning within 30 min after the onset of endocytosis. We present data indicating that escape of AAV from the endosome and trafficking of viral particles to the nucleus are unaffected by the presence of adenovirus, the primary helper virus for a productive AAV infection. Within 2 h, viral particles could be detected within the cell nucleus, suggesting that AAV enters the nucleus prior to uncoating. Interestingly, the majority of the intracellular virus particles remain in a stable perinuclear compartment even though gene expression from nuclear AAV genomes can be detected. This suggests that the process of nuclear entry is rate limiting or that AAV entry involves multiple pathways. Nevertheless, these data establish specific points in the AAV infectious entry process and have allowed the generation of a model for future expansion to specific cell types and AAV vector analysis in vivo.     

A novel terminal resolution-like site in the adeno-associated virus type 2 genome.

The adeno-associated virus 2 (AAV) contains a single-stranded DNA genome of which the terminal 145 nucleotides are palindromic and form T-shaped hairpin structures. These inverted terminal repeats (ITRs) play an important role in AAV DNA replication and resolution, since each of the ITRs contains a terminal resolution site (trs) that is the target site for the AAV rep gene products (Rep). However, the Rep proteins also interact with the AAV DNA sequences that lie outside the ITRs, and the ITRs also play a crucial role in excision of the proviral genome from latently infected cells or from recombinant AAV plasmids. To distinguish between Rep-mediated excision of the viral genome during rescue from recombinant AAV plasmids and the Rep-mediated resolution of the ITRs during AAV DNA replication, we constructed recombinant AAV genomes that lacked either the left or the right ITR sequence and one of the Rep-binding sites (RBSs). No rescue and replication of the AAV genome occurred from these plasmids following transfection into adenovirus type 2-infected human KB cells, as expected. However, excision and abundant replication of the vector sequences was clearly detected from the plasmid that lacked the AAV left ITR, suggesting the existence of an additional putative excision site in the left end of the AAV genome. This site was precisely mapped to one of the AAV promoters at map unit 5 (AAV p5) that also contains an RBS. Furthermore, deletion of this RBS abolished the rescue and replication of the vector sequences. These studies suggest that the Rep-mediated cleavage at the RBS during viral DNA replication may, in part, account for the generation of the AAV defective interfering particles.     

Efficient generation and amplification of high-capacity adeno-associated virus/adenovirus hybrid vectors

Effective gene therapy is dependent on safe gene delivery vehicles that can achieve efficient transduction and sustained transgene expression. We are developing a hybrid viral vector system that combines in a single particle the large cloning capacity and efficient cell cycle-independent nuclear gene delivery of adenovirus (Ad) vectors with the long-term transgene expression and lack of viral genes of adeno-associated virus (AAV) vectors. The strategy being pursued relies on coupling the AAV DNA replication mechanism to the Ad encapsidation process through packaging of AAV-dependent replicative intermediates provided with Ad packaging elements into Ad capsids. The generation of these high-capacity AAV/Ad hybrid vectors takes place in Ad early region 1 (E1)-expressing cells and requires an Ad vector with E1 deleted to complement in trans both AAV helper functions and Ad structural proteins. The dependence on a replicating helper Ad vector leads to the contamination of AAV/Ad hybrid vector preparations with a large excess of helper Ad particles. This renders the further propagation and ultimate use of these gene delivery vehicles very difficult. Here, we show that Cre/loxP-mediated genetic selection against the packaging of helper Ad DNA can reduce helper Ad vector contamination by 99.98% without compromising hybrid vector rescue. This allowed amplification of high-capacity AAV/Ad hybrid vectors to high titers in a single round of propagation.     

Rescue of adeno-associated virus from recombinant plasmids: gene correction within the terminal repeats of AAV

We have isolated three types of pBR322-AAV recombinant plasmids that contain deletions within the 145 bp AAV terminal repeats. When the plasmids were transfected into human cells, mutants that contained deletions within the left (type I) or right (type II) terminal repeat were viable. Of four mutants examined that contained deletions in both termini (type III), only one was viable. All of the viable mutants produced AAV virions that contained wild-type AAV DNA. Furthermore, the viable type III deletion could be converted to a nonviable mutant by deleting all copies of an 11 bp sequence from its termini. We conclude that there is an efficient mechanism for correcting deletions within the AAV termini. A model that could account for these observations is also discussed.     

Sequence requirements for binding of Rep68 to the adeno-associated virus terminal repeats.

We have used reciprocal competition binding experiments with mutant substrates and chemical modification interference assays to precisely define the sequences within the adeno-associated virus (AAV) terminal repeat (TR) that are involved in site-specific binding to the AAV Rep protein. Mutagenesis experiments were done with a 43-bp oligonucleotide which contained the Rep binding element (RBE) within the A stem of the TR. Experiments in which two adjacent base pairs of the RBE were substituted simultaneously with nucleotides that produced transversions identified a 22-bp sequence (CAGTGAGCGAGCGAGCGCGCAG) in which substitutions measurably affected the binding affinity. Although the 22-bp RBE contains the GAGC motifs that have been found in all known Rep binding sites, our results suggest that the GAGC motifs alone are not the only sequences specifically recognized by Rep. The effects of substitutions within the 22-bp sequence were relatively symmetrical, with nucleotides at the periphery of the RBE having the least effect on binding affinity and those in the middle having the greatest effect. Dinucleotide mutations within 18 (GTGAGCGAGCGAGC) of the 22 bp were found to decrease the binding affinity by at least threefold. Dinucleotide mutations within a 10-bp core sequence (GCGAGCGAGC) were found to decrease binding affinity by more than 10-fold. Single-base substitutions within the 10-bp core sequence lowered the binding affinity by variable amounts (up to fivefold). The results of the mutagenesis analysis suggested that the A-stem RBE contains only a single Rep binding site rather than two or more independent sites. To confirm the results of the mutant analysis and to determine the relative contribution of each base to binding, chemical modification experiments using dimethyl sulfate and hydrazine were performed on both the linear A-stem sequence and the entire AAV TR in both the flip and flop hairpinned configurations. Interference assays on the linear A stem identified the 18-bp sequence described above as essential for binding. G, C, and T residues on both strands contributed to binding, and the interference pattern correlated well with the results of the mutagenesis experiments. Interference assays with complete hairpinned TR substrates also identified the 18-bp sequence as important for binding. However, the interference patterns on the two strands within the RBE and the relative contributions of the individual bases to binding were clearly different between the hairpinned substrates and the linear A-stem binding element. Interference assays also allowed us to search for residues within the small internal palindromes of the TR (B and C) that contribute to binding. The largest effect was seen by modification of two T residues within the sequence CTTTG. This sequence was present in the same position relative to the terminal resolution site (trs) in both the flip and flop orientations of the TR. In addition, the interference pattern suggested that the remaining bases within the CTTTG motif as well as other bases within the B and C palindromes make contacts with the Rep protein, albeit with lower affinities. Regardless of whether the TR was in the flip or flop orientation, most of the contact points were clustered in the small internal palindrome furthest away from the trs. We also determined the relative binding affinity of linear substrates containing a complete RBE with hairpinned substrates and found that linear substrates bound Rep less efficiently. Our results were consistent with our previous model that there are three distinct elements within the hairpinned AAV TR that contribute to binding affinity or to efficient nicking at the trs: the A-stem RBE, the secondary structure element which consists of the B and C palindromes, and the trs.     

Conjugate-based targeting of recombinant adeno-associated virus type 2 vectors by using avidin-linked ligands

The development of targeted vectors, capable of tissue-specific transduction, remains one of the important aspects of vector modification for gene therapy applications. Recombinant adeno-associated virus type 2 (rAAV-2)-based vectors are nonpathogenic, have relatively low immunogenicity, and are capable of long-term transgene expression. AAV-2 vectors bind primarily to heparan sulfate proteoglycan (HSPG), a receptor that is present in many tissues and cell types. Because of the widespread expression of HSPG on many tissues, targeted transduction in vivo appears to be limited with AAV-2 vectors. Thus, development of strategies to achieve transductional targeting will have a profound benefit in the future application of these vectors. We report here a novel conjugate-based targeting method to enhance tissue-specific transduction of AAV-2-based vectors. The present report utilized a high-affinity biotin-avidin interaction as a molecular bridge to cross-link purified targeting ligands, produced genetically as fusion proteins to core-streptavidin, in a prokaryotic expression system. Conjugation of the bispecific targeting protein to the vector was achieved by biotinylating purified rAAV-2 without abolishing the capsid structure, internalization, and subsequent transgene expression. The tropism-modified vectors, targeted via epidermal growth factor receptor (EGFR) or fibroblast growth factor 1alpha receptor (FGFR1alpha), resulted in a significant increase in transduction efficiency of EGFR-positive SKOV3.ip1 cells and FGFR1alpha-positive M07e cells, respectively. Further optimization of this method of targeting should enhance the potential of AAV-2 vectors in ex vivo and in vivo gene therapy and may form the basis for developing targeting methods for other AAV serotype capsids.     

The red clover necrotic mosaic virus RNA2 trans-activator is also a cis-acting RNA2 replication element

The expression of the coat protein gene requires RNA-mediated trans-activation of subgenomic RNA synthesis in Red clover necrotic mosaic virus (RCNMV), the genome of which consists of two positive-strand RNAs, RNA1 and RNA2. The trans-acting RNA element required for subgenomic RNA synthesis from RNA1 has been mapped previously to the protein-coding region of RNA2, whereas RNA2 is not required for the replication of RNA1. In this study, we investigated the roles of the protein-coding region in RNA2 replication by analyzing the replication competence of RNA2 mutants containing deletions or nucleotide substitutions. Our results indicate that the same stem-loop structure (SL2) that functions as a trans-activator for RNA-mediated coat protein expression is critically required for the replication of RNA2 itself. Interestingly, however, disruption of the RNA-RNA interaction by nucleotide substitutions in the region of RNA1 corresponding to the SL2 loop of RNA2 does not affect RNA2 replication, indicating that the RNA-RNA interaction is not required for RNA2 replication. Further mutational analysis showed that, in addition to the stem-loop structure itself, nucleotide sequences in the stem and in the loop of SL2 are important for the replication of RNA2. These findings suggest that the structure and nucleotide sequence of SL2 in RNA2 play multiple roles in the virus life cycle.     

A developmentally regulated deletion element with long terminal repeats has cis-acting sequences in the flanking DNA

Approximately 6000 specific DNA deletion events occur during development of the somatic macronucleus of the ciliate Tetrahymena. The eliminated Tlr1 element is 13 kb or more in length and has an 825 bp inverted repeat near the rearrangement junctions. A functional analysis of the cis-acting sequences required for Tlr1 rearrangement was performed. A construct consisting of the entire inverted repeat and several hundred base pairs of flanking DNA on each side was rearranged accurately in vivo and displayed junctional variability similar to the chromosomal Tlr1 rearrangement. Thus, 11 kb or more of internal element DNA is not required in cis for DNA rearrangement. A second construct with only 51 bp of Tetrahymena DNA flanking the right junction underwent aberrant rearrangement. Thus, a signal for determination of the Tlr1 junction is located in the flanking DNA, 51 bp or more from the right junction. Within the Tlr1 inverted repeat are 19 bp tandem repeats. A construct with the 19mer repeat region deleted from the right half of the inverted repeat utilized normal rearrangement junctions. Thus, despite its transposon-like structure, Tlr1 is similar to other DNA rearrangements in Tetrahymena in possessing cis-acting sequences outside the deleted DNA.