Structure of 5S rRNA in actinomycetes and relatives and evolution of eubacteria

Summary The primary structure of 5S ribosomal RNA has been determined in five species belonging to the genusMycobacterium and inMicrococcus luteus. The sequences of 5S RNAs from Actinomycetes and relatives point to the existence in this taxon of a bulge on the helix that joins the termini of the molecule. An attempt was made to reconstruct bacterial evolution from a sequence dissimilarity matrix based on 142 eubacterial 5S RNA sequences and corrected for multiple mutation. The algorithm is based on weighted pairwise clustering, and incorporates a correction for divergent mutation rates, as derived by comparison of sequence dissimilarities with an external reference group of eukaryotic 5S RNAs. The resulting tree is compared with the eubacterial phylogeny built on 16S rRNA catalog comparison. The bacteria for which the 5S RNA sequence is known form a number of clusters also discernible in the 16S rRNA phylogeny. However, the branching pattern leading to these clusters shows some notable discrepancies with the aforementioned phylogeny.     

Sequences of the 5S rRNAs of the thermo-acidophilic archaebacterium Sulfolobus solfataricus (Caldariella acidophila) and the thermophilic eubacteria Bacillus acidocaldarius and Thermus aquaticus.

We have determined the nucleotide sequences of the 5 S rRNAs of three thermophilic bacteria: the archaebacterium Sulfolobus solfataricus, also named Caldariella acidophila, and the eubacteria Bacillus acidocaldarius and Thermus aquaticus. A 5 S RNA sequence for the latter species had already been published, but it looked suspect on the basis of its alignment with other 5 S RNA sequences and its base-pairing pattern. The corrected sequence aligns much better and fits in the universal five helix secondary structure model, as do the sequences for the two other examined species. The sequence found for Sulfolobus solfataricus is identical to that determined by others for Sulfolobus acidocaldarius. The secondary structure of its 5 S RNA shows a number of exceptional features which distinguish it not only from eubacterial and eukaryotic 5 S RNAs, but also from the limited number of archaebacterial 5 S RNA structures hitherto published. The free energy change of secondary structure formation is large in the three examined 5 S RNAs.     

Phylogeny of the 5S ribosomal RNA from Synechococcus lividus II: the cyanobacterial/chloroplast 5S RNAs form a common structural class

The complete nucleotide sequence of the 5S ribosomal RNA from the cyanobacterium Synechococcus lividus II has been determined. The sequence is (sequence in text) This 5S RNA has the cyanobacterial- and chloroplast-specific nucleotide insertion between positions 30 and 31 (using the numbering system of the generalized eubacterial 5S RNA) and the chloroplast-specific nucleotide-deletion signature between positions 34 and 39. The 5S RNA of S. lividus II has 27 base differences compared with the 5S RNA of the related strain S. lividus III. This large difference may reflect an ancient divergence between these two organisms. The electrophoretic mobilities on nondenaturing polyacrylamide gels of renatured 5S RNAs from S. lividus II, S. lividus III, and spinach chloroplasts are identical, but differ considerably from that of Escherichia coli 5S RNA. This most likely reflects differences in higher-order structure between the 5S RNA of E. coli and these cyanobacterial and chloroplast 5S RNAs.     

A ribosomal RNA operon from Pseudomonas stutzeri Zobell

A ribosomal RNA operon from the marine bacterium, Pseudomonas stutzeri Zobell, was cloned and characterized by Southern hybridization and sequence analysis. The 16S rRNA, 23S rRNA, 5S rRNA and 2 tRNA genes (alanine and isoleucine) were identified by homology with sequences in GenBank. The rRNA gene exhibited typical eubacterial organization (16S-tRNAs-23S-5S). A putative ribosomal promoter and anti-terminator regions were also identified and described. Significant differences in spacing of the anti-terminator regulatory elements were observed between P. stutzeri Zobell and Escherichia coli.     

Characterization of the small RNA of the bacteriophage phi 29 DNA packaging machine.

The prohead connector of the bacteriophage luminal diameter 29 DNA packaging machine was reconstructed with the small RNA that regulates DNA packaging in vitro. The complete sequence of the 120 nucleotide RNA proved its origination from the promoter PE1(A1) of the left early region of phi 29 DNA, the end packaged first during assembly. The prohead RNA was clearly distinct from eubacterial 5S rRNA in sequence and composition.     

Transfer RNAs as genotypic fingerprints of eubacteria

A new method was developed for rapid genotypic identification and classification of bacteria. The method is based on high resolution gel electrophoresis of the stable, low molecular weight (LMW) RNA fraction of single bacterial strains. This fraction comprises the total transfer RNA pool and the 5S ribosomal RNA. On a one-dimensional gel, every eubacterial strain exhibited a distinct LMW RNA profile, a set of bands belonging to three different size classes: 5S rRNAs (110–131 nt), class 2 tRNAs (82–96 nt) and class 1 tRNAs (72–79 nt). LMW RNA profiles of members of five of the ten major eubacterial groups, previously defined by 16S rRNA sequence analysis, were highly diverse. For some major groups, like flavobacteria and planctomyces, the distinctive sizes of their 5S rRNAs allowed the assignment of strains to these groups. More specific taxonomic information was gained from analysis of the tRNA part of the profile. Strains could be grouped as species and genera due to species- and genus-specific tRNA bands. From an evolutionary point of view, this order found in the total tRNA pool of eubacteria could indicate that cytoplasmic tRNA evolution reflects ribosomal RNA evolution. Given the universality of tRNAs, it is to be expected that their electrophoretic mobility profiles may serve as a convenient RNA fingerprint for defining bacterial species operationally and for identifying new genotypes by differing patterns.     

Discovery and characterization of Acanthamoeba castellanii mitochondrial 5S rRNA

Although 5S rRNA is a highly conserved and universal component of eubacterial, archaeal, chloroplast, and eukaryotic cytoplasmic ribosomes, a mitochondrial DNA-encoded 5S rRNA has so far been identified only in land plants and certain protists. This raises the question of whether 5S rRNA is actually required for and used in mitochondrial translation. In the protist Acanthamoeba castellanii, BLAST searches fail to reveal a 5S rRNA gene in the complete mitochondrial genome sequence, nor is a 5S-sized RNA species detectable in ethidium bromide-stained gels of highly purified mitochondrial RNA preparations. Here we show that an alternative visualization technique, UV shadowing, readily detects a novel, mitochondrion-specific small RNA in A. castellanii mitochondrial RNA preparations, and that this RNA species is, in fact, a 5S rRNA encoded by the A. castellanii mitochondrial genome. These results emphasize the need for caution when interpreting negative results that suggest the absence of 5S rRNA and/or a mitochondrial DNA-encoded 5S rRNA sequence in other (particularly protist) mitochondrial systems.     

The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum.

The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH. The homology with the 55 rRNA from another archaebacterial species, Halobacterium cutirubrum, is only 60.6% and other 55 rRNAs are even less homologous. Examination of the potential for forming secondary structure is revealing. T. acidophilum does not conform to the usual models employed for either procaryotic or eucaryotic 5S rRNAs. Instead this 5S rRNA has a mixture of the characteristic features of each. On the whole this 5S rRNA does however appear more eucaryotic than eubacterial. These results give further support to the notion that the archaebacteria represent an extremely early divergence among entities with procaryotic organization.     

Phylogeny of the 5S ribosomal RNA fromSynechococcus lividus II: The cyanobacterial/chloroplast 5S RNAs form a common structural class

Summary The complete nucleotide sequence of the 5S ribosomal RNA from the cyanobacteriumSynechococcus lividus II has been determined. The sequence is 5-UGCCUAGUGUUUAUGGCGCG-GUGGAACCACGCUGAUCCAUCCCGAACUC-AGAGGUGAAACAUCGCAGCGGUGAAGAU-AGUUGGAGGGUAGCCUCCUGCAAAAAUA-GCUCAAUGCUAGGCA_OH-3. This 5S RNA has the cyanobacterial- and chloroplast-specific nucleotide insertion between positions 30 and 31 (using the numbering system of the generalized eubacterial 5S RNA) and the chloroplast-specific nucleotide-deletion signature between positions 34 and 39. The 5S RNA ofS. lividus II has 27 base differences compared with the 5S RNA of the related strainS. lividus III. This large difference may reflect an ancient divergence between these two organisms. The electrophoretic mobilities on nondenaturing polyacrylamide gels of renatured 5S RNAs fromS. lividus II,S. lividus III, and spinach chloroplasts are identical, but differ considerably from that ofEscherichia coli 5S RNA. This most likely reflects differences in higher-order structure between the 5S RNA ofE. coli and these cyanobacterial and chloroplast 5S RNAs.     

Structural and functional exchangeability of 5 S RNA species from the eubacterium E.coli and the thermoacidophilic archaebacterium Sulfolobus solfataricus.

The role of 5 S RNA within the large ribosomal subunit of the extremely thermophilic archaebacterium Sulfolobus solfataricus has been analysed by means of in vitro reconstitution procedures. It is shown that Sulfolobus 50 S subunits reconstituted in the absence of 5 S RNA are inactive in protein synthesis and lack 2-3 ribosomal proteins. Furthermore, it has been determined that in the course of the in vitro assembly process Sulfolobus 5 S RNA can be replaced by the correspondent RNA species of E.coli; Sulfolobus reconstituted particles containing the eubacterial 5 S molecule are stable and active in polypeptide synthesis at high temperatures.     

Structural features unique to the 5 S ribosomal RNAs of the thermophilic cyanobacterium Synechococcus lividus III and the green plant chloroplasts

The complete nucleotide sequence of the 5 S ribosomal RNA from the thermophilic cyanobacterium Synechococcus lividus III was determined. The sequence is: ^5′U-C- C-U-G-G-U-G-G-U-G-A-U-G-G-C-G-A-U-G-U-G-G-A-C-C-C-A-C-A-C-U-C-A-U-C- C-A-U-C-C-C-G-A-A-C-U-G-A-G-U-G-G-U-G-A-A-A-C-G-C-A-U-U-U-G-C-G-G-C- G-A-C-G-A-U-A-G-U-U-G-G-A-G-G-G-U-A-G-C-C-U-C-C-U-G-U-C-A-A-A-A-U-A- G-C-U-A-A-C-C-G-C-C-A-G-G-G-U_OH^3′This 5 S RNA has regional structural characteristics that are found in the green plant chloroplast 5 S RNAs and not in other known sequences of 5 S ribosomal RNAs. These homologies suggest a close phylogenetic relationship between S. lividus and the green plant chloroplasts.     

Cloning, characterization and taxonomic significance of genes for the 5S ribosomal RNA of Leptonema illini strain 3055.

The genes encoding the 5S ribosomal RNA (rRNA) for Leptonema illini strain 3055 were isolated and sequenced. The 5S RNA molecule encoded was 117 nucleotides long. The genome of strain 3055 contained two genes for 5S rRNA that were located close together. The nucleotide sequences of the Leptonema illini genes exhibited less similarity to the rRNA gene of Leptospira interrogans strain Moulton and also to those of typical eubacterial genes than did the rRNA genes of other leptospires. However, the overall secondary structure of the 5S rRNA encoded exhibited a strong similarity to that of typical eubacterial 5S rRNA. Southern hybridization of the 5S rRNA gene probe with the genomic DNA of strain 965, which is currently classified as Leptospira biflexa, showed the latter to have close similarity to that of strain 3055. The physical map of strain 965 was quite similar to that of strain 3055 and was greatly different from that of any other strains of L. biflexa. In the organization of 5S rRNA genes, strain 965 is sufficiently different from other members of the genus Leptospira to be regarded as a member of the genus Leptonema.     

Characterization of a novel small RNA encoded by Dictyostelium discoideum mitochondrial DNA

In this study, we analyzed a mitochondrial small (ms) RNA in Dictyostelium discoideum, which is 129 nucleotides long and has a GC content of only 22.5%. In the mitochondrial DNA, a single-copy gene (msr) for the ms RNA was located downstream of the gene for large-subunit rRNA. The location of msr was similar to that of the 5S rRNA gene in prokaryotes and chloroplasts, but clearly different from that in mitochondria of plants, liverwort and the chlorophycean alga Prototheca wikerhamii, in which small-subunit rRNA and 5S rRNA genes are closely linked. The primary sequence of ms RNA showed low homology with mitochondrial 5S rRNA from plants, liverwort and the chlorophycean alga, but the proposed secondary structure of ms RNA was similar to that of cytoplasmic 5S rRNA. In addition, ms RNA showed a highly conserved GAAC sequence in the same loop as in common 5S rRNA. However, ms RNA was detected mainly in the mitochondrial 25?000?×?g supernatant fraction which was devoid of ribosomes. It is possible that ms RNA is an evolutionary derivative of mitochondrial 5S rRNA.     

Evolutionary changes in the higher order structure of the ribosomal 5S RNA.

Comparative studies have been undertaken on the higher order structure of ribosomal 5S RNAs from diverse origins. Competitive reassociation studies show that 5S RNA from either a eukaryote or archaebacterium will form a stable ribonucleoprotein complex with the yeast ribosomal 5S RNA binding protein (YL3); in contrast, eubacterial RNAs will not compete in a similar fashion. Partial S1 ribonuclease digestion and ethylnitrosourea reactivity were used to probe the structural differences suggested by the reconstitution experiments. The results indicate a more compact higher order structure in eukaryotic 5S RNAs as compared to eubacteria and suggest that the archaebacterial 5S RNA contains features which are common to either group. The potential significance of these results with respect to a generalized model for the tertiary structure of the ribosomal 5S RNA and to the heterogeneity in the protein components of 5S RNA-protein complexes are discussed.     

5S rRNA sequences of representatives of the genera Chlorobium, Prosthecochloris, Thermomicrobium, Cytophaga, Flavobacterium, Flexibacter and Saprospira and a discussion of the evolution of eubacteria in general.

5S rRNA sequences were determined for the green sulphur bacteria Chlorobium limicola, Chlorobium phaeobacteroides and Prosthecochloris aestuarii, for Thermomicrobium roseum, which is a relative of the green non-sulphur bacteria, and for Cytophaga aquatilis, Cytophaga heparina, Cytophaga johnsonae, Flavobacterium breve, Flexibacter sp. and Saprospira grandis, organisms allotted to the phylum 'Bacteroides-Cytophaga-Flavobacterium' and relatives as determined by 16S rRNA analyses. By using a clustering algorithm a dendrogram was constructed from these sequences and from all other known eubacterial 5S RNA sequences. The dendrogram showed differences, as well as similarities, with respect to results obtained by 16S RNA analyses. The 5S RNA sequences of green sulphur bacteria were closely related to one another, and to a cluster containing 5S RNA sequences from Bacteroides and its relatives, including Cytophaga aquatilis. 5S RNA sequences of all other representatives of the 'Bacteroides-Cytophaga-Flavobacterium' phylum as distinguished by 16S RNA analysis failed to group with Bacteroides and related clusters. On the basis of 5S RNA sequences, Thermomicrobium roseum clustered with Chloroflexus aurantiacus, as was expected from 16S RNA analysis.     

Variable base pairing in a helix of eubacterial 5 S ribosomal RNA points to the existence of a conformational switch

A survey of 160 published sequences of eubacterial 5 S rRNAs shows that there exists structural variability in one of the helices of the generally accepted secondary structure model. Four structural variants are found, which differ with respect to the position and the number of bulges present. Most eubacterial 5 S RNAs fit into at least two of these conformations. A reaction scheme connecting the four observed conformations by changes in the base pairing scheme is proposed. Each of the known 5 S RNA sequences fits into conformations interconvertible by the proposed reactions.