Ti plasmid vector for the introduction of DNA into plant cells without alteration of their normal regeneration capacity

A Ti plasmid mutant was constructed in which all the on-cogenic functions of the T-DNA have been deleted and replaced by pBR322. This Ti plasmid, pGV3850, still mediates efficient transfer and stabilization of its truncated T-DNA into infected plant cells. Moreover, integration and expression of this minimal T-DNA in plant cells does not interfere with normal plant cell differentiation. A DNA fragment cloned in a pBR vector can be inserted in the pGV3850 T-region upon a single recombination event through the pBR322 region of pGV3850 producing a co-integrate useful for the transformation of plant cells. Based upon these properties, pGV3850 is proposed as an extremely versatile vector for the introduction of any DNA of interest into plant cells.     

Efficient octopine Ti plasmid-derived vectors for Agrobacterium-mediated gene transfer to plants.

A two-component cloning system to transfer foreign DNA into plants was derived from the octopine Ti plasmid pTiB6S3. pGV2260 is a non-oncogenic Ti plasmid from which the T-region is deleted and substituted by pBR322. pGV831 is a streptomycin-resistant pBR325 derivative that contains a kanamycin resistance marker gene for plant cells and a site for cloning foreign genes between the 25-bp border sequences of the octopine T-region. Conjugative transfer of pGV831 derivatives to Agrobacterium and cointegration by homologous recombination between the pBR322 sequences present on pGV831 and pGV2260, can be obtained in a single step. Strains carrying the resulting cointegrated plasmids transfer and integrate T-DNA into the genome of tobacco protoplasts, and transformed tobacco calli are readily selected as resistant to kanamycin. Intact plants containing the entire DNA region between the T-DNA borders have been regenerated from such clones. In view of these properties we present pGV831 and its derivatives as vectors for efficient integration of foreign genes into plants.     

The oriT region of the Agrobacterium tumefaciens Ti plasmid pTiC58 shares DNA sequence identity with the transfer origins of RSF1010 and RK2/RP4 and with T-region borders.

Ti plasmids of Agrobacterium tumefaciens are conjugal elements whose transfer is induced by certain opines secreted from crown galls. On transmissible plasmids, DNA transfer initiates within a cis-acting site, the origin of conjugal transfer, or oriT. We have localized an oriT on the A. tumefaciens plasmid pTiC58 to a region containing the conjugal transfer loci traI and traII and acc, which is the locus encoding catabolism of the two conjugal opines, agrocinopines A and B. The smallest functional oriT clone, a 65-bp BamHI-ApaI fragment in the recombinant plasmid pDCBA60-11, mapped within the traII locus. The nucleotide sequence for a 665-bp KpnI-EcoRI fragment with oriT activity was determined. DNA sequence alignments showed identities between the pTiC58 oriT and the transfer origins of RSF1010, pTF1, and RK2/RP4 and with the pTiC58 T-region borders. The RSF1010-like sequence on pTiC58 is located in the smallest active oriT clone of pTiC58, while the sequence showing identities with the oriT regions of RK2/RP4 and with T-region borders maps outside this region. Despite their sequence similarities, pTiC58 oriT clones were not mobilized by RP4; nor could vectors containing the RK2/RP4 oriT region or the oriT-mob region from RSF1010 be mobilized by pTiC58. In contrast, other Ti plasmids and a conjugally active Agrobacterium opine catabolic plasmid, pAtK84b, efficiently mobilized pTiC58 oriT clones. In addition, the RSF1010 derivative, pDSK519, was mobilized at moderate frequencies by an Agrobacterium strain harboring only the cryptic plasmid pAtC58 and at very low frequencies by an Agrobacterium host that does not contain any detectable plasmids.     

Intergeneric transfer and exchange recombination of restriction fragments cloned in pBR322: a novel strategy for the reversed genetics of the Ti plasmids of Agrobacterium tumefaciens

Transmission of ColE1/pMB1-derived plasmids, such as pBR322, from Escherichia coli donor strains was shown to be an efficient way to introduce these plasmids into Agrobacterium. This was accomplished by using E. coli carrying the helper plasmids pGJ28 and R64drd11 which provide the ColE1 mob functions and tra functions, respectively. For example, the broad host-range replication plasmid, pGV1150, a co-integrate plasmid between pBR322 and the W-type mini-Sa plasmid, pGV1106, was transmitted from E. coli to A. tumefaciens with a transfer frequency of 4.5 x 10(-3). As pBR322 clones containing pTiC58 fragments were unable to replicate in Agrobacterium, these clones were found in Agrobacterium only if the acceptor carried a Ti plasmid, thus allowing a co-integration of the pBR322 clones with the Ti plasmid by homology recombination. These observations were used to develop an efficient method for site-specific mutagenesis of the Ti plasmids. pTiC58 fragnents, cloned in pBR322, were mutagenized in vitro and transformed into E. coli. The mutant clones were transmitted from an E. coli donor strain containing pGJ28 and R64drd11 to an Agrobacterium containing a target Ti plasmid. Selecting for stable transfer of the mutant clone utilizing its antibiotic resistance marker(s) gave exconjugants that already contained a co-integrate plasmid between the mutant clone and the Ti plasmid. A second recombination can dissociate the co-integrate plasmid into the desired mutant Ti plasmid and a non-replicating plasmid formed by the vector plasmid pBR322 and the target Ti fragment. These second recombinants lose the second plasmid and they are identified by screening for the appropriate marker combination.     

Characterization of conjugal transfer functions of Agrobacterium tumefaciens Ti plasmid pTiC58.

Physical characterization of 13 transposon Tn5 insertions within the agrocinopine-independent, transfer-constitutive Ti plasmid pTiC58Trac identified three separate loci essential for conjugation of this nopaline/agrocinopine A + B-type Ti plasmid. Complementation analysis with relevant subcloned DNAs indicated that the three physically separated blocks of conjugal genes constitute distinct complementation groups. Two independent Tn5 insertions within the wild-type, agrocinopine-dependent, repressed pTiC58 plasmid resulted in constitutive expression of conjugal transfer. These two insertions were physically indistinguishable and could not be complemented in trans. However, the Trac phenotype resulted when the Tn5-mutated fragment cointegrated into the wild-type Ti plasmid. While the spontaneous Trac mutant Ti plasmids were also derepressed for agrocinopine catabolism, those generated by Tn5 insertions remained inducible, indicating that this apparent cis-acting site is different from that affected in the spontaneous mutants. No chromosomal Tn5 insertion mutations were obtained that affected conjugal transfer. An octopine-type Ti plasmid, resident in different Agrobacterium tumefaciens chvB mutants, transferred at normal frequencies, demonstrating that this virulence locus affecting plant cell binding is not required for Ti plasmid conjugation. None of our conjugal mutants limited tumor development on Kalanchoe diagremontiana. Known lesions in pTiC58 vir loci had no effect on conjugal transfer of this Ti plasmid. These results show that pTiC58 Ti plasmid conjugal transfer occurs by functions independent of those required for transfer of DNA to plant cells.     

Co-evolution of the agrocinopine opines and the agrocinopine-mediated control of TraR, the quorum-sensing activator of the Ti plasmid conjugation system

Conjugal transfer of Agrobacterium tumefaciens Ti plasmids is controlled by a hierarchical system in which opines, substrates produced by crown gall tumours, induce a quorum-sensing system. The cascade results from the control of expression of traR, the quorum-sensing activator, by a regulator responsive to the opine. In the two cases studied to date, the gene arrangements responsible for the cascade differ remarkably, suggesting that considerable diversity exists among the many Ti-like plasmids in the agrobacteria. In this study, we demonstrated that the novel Ti plasmid pTiChry5 is induced to transfer at high frequency by extracts from tumours initiated by strain Chry5. The purified inducer had the chemical and biological properties of agrocinopines C and D, a set of sugar phosphodiester opines known to induce transfer of another Ti plasmid, pTiBo542. The T-region of pTiChry5 contained a gene whose product, called Acs(Chry5), is virtually identical to the agrocinopine C+D synthase from the T-region of pTiBo542. The two genes are less closely related to acs of pTiC58, which is responsible for the production of agrocinopines A+B, a similar but not identical set of phosphodiester opines by tumours induced by strain C58. Agrocinopines A+B induce transfer of pTiC58 but did not induce transfer of pTi(Chry5). A single copy of traR was identified at the 11 o'clock region of pTi(Chry5), where it is part of a two-gene operon called arc(Chry5). Although altered by deletions, arc(Chry5) is related to the five-gene arc operon that controls the expression of traR on pTiC58. Expression of traR(Chry5) was induced by agrocinopines C+D and the opines isolated from Chry5 tumours but not by agrocinopines A+B. A mutation in traR(Chry5) abolished transfer, and transfer was restored by complementation in trans. We conclude that the agrocinopine opines and the corresponding opine-meditated conjugal regulatory regions of pTiChry5 and pTiC58 share a common origin, but that the opine signals for the two Ti plasmids have evolved divergently through changes in the opine synthase enzymes. The alterations in the opines, in turn, necessitated a co-evolutionary change in the opine recognition systems responsible for controlling expression of the traR genes on these two types of Ti plasmids.     

Genetic analysis of T-DNA transcripts in nopaline crown galls

Plant crown gall tumor cells result from the insertion and expression of a defined DNA sequence, called T-DNA, which is derived from the Ti plasmid, harbored by Agrobacterium tumefaciens strains. To study the function of the genes of the T-DNA of the nopaline Ti plasmid, pTiC58, a collection of mutants was isolated so that T-DNA genes are inactivated either separately or in various combinations. It was found that no single T-DNA gene or T-region border is absolutely essential for stable tumor formation. We have identified the gene responsible for synthesis in transformed cells of the phosphorylated sugar, agrocinopine, and at least three additional genes controlling the morphology of plant tumors. Two of these latter genes work together to inhibit shoot formation and ensure efficient tumorous growth. Inactivation of these genes can be suppressed by the addition of auxins. The third gene inhibits root formation and appears to play a role in the cytokinin-independent growth of transformed cells. Mutants missing all three genes do not induce tumors, nor shoot or root formation, although the mutant T-DNA sequence is transferred to plant cells.     

Conjugation transfer of the bireplicon plasmid pSPA044 into Rhizobiaceae bacteria

We have demonstrated the possibility of hybrid plasmid pSPA044 conjugative transfer from E. coli cells into different Rhizobium species. The bireplicon plasmid, constructed earlier in our laboratory, consisting of pBR325 and HindIII fragment 13 of the nopaline plasmid pTiC58 was mobilized for transfer by the helper plasmid pRK2013 with the frequency about 10(-4). We conclude the hybrid plasmid pSPA044 to be able to replicate stably in Rhizobiaceae cells.     

Right 25 bp terminus sequence of the nopaline T-DNA is essential for and determines direction of DNA transfer from agrobacterium to the plant genome

We have determined which sequences at the right border of the T-DNA region of the nopaline C58 Ti plasmid are required for transfer and/or integration of the T-DNA into the plant cell genome. The results indicate that the 25 bp T-DNA terminus repeat sequence, TGACAGGATATATTGGCGGGTAAAC, is directly responsible for T-DNA transfer; furthermore, this sequence is directional in its mode of action. A transfer-negative nononcogenic Ti plasmid derivative, pGV3852, was constructed, in which 3 kb covering the right T-DNA border region was substituted for by pBR322 sequences. The pBR322 sequences in pGV3852 provide a site for homologous recombination with pBR-derived plasmids containing sequences to assay for transfer activity. First, a 3.3 kb restriction fragment overlapping the deleted region in pGV3852 was shown to restore transfer activity. Second, a sequence of only 25 bp, the T-DNA terminus sequence, was shown to be sufficient to restore normal transfer activity. The transfer-promoting sequences are most active when reinserted in one orientation, that normally found in the Ti plasmid.     

Identification of a chromosomal tra-like region in Agrobacterium tumefaciens

The virD4 gene is one of the virulence genes present on the pTiC58 plasmid of Agrobacterium tumefaciens. Unexpectedly, we found that a pTi-free A. tumefaciens strain carried a protein of similar size to the plasmid-encoded VirD4 protein which reacted with VirD4-specific antibodies. This suggested that this strain may contain a homologue of the VirD4 protein. A chromosomal fragment encoding a protein of similar sequence to VirD4 was isolated and a 7.8 kilobase region surrounding the gene encoding this putative homologue was sequenced. This region contained four open reading frames, encoding putative proteins similar to proteins of known bacterial transfer and conjugation systems, viz., orf1 encoded a putative homologue of the TraA protein of the Rhizobium symbiosis plasmid pNGR234 and the TraA protein encoded by pTiC58 from A. tumefaciens plasmid pTiC58, orf3 encoded a protein very similar to the MobC protein encoded by the IncQ plasmid RSF1010 of E. coli and to MobS encoded by pTF1 from Thiobacillus ferrooxidans, whereas the predicted product of orf4 displayed similarity to the TraG protein encoded by the IncPalpha plasmid RP4 of E. coli, TraG and VirD4 encoded by A. tumefaciens plasmid pTiC58. The product of orf2 showed no significant similarity to any known protein. Preliminary assays with two orf4 mutants suggested that the product of this orf is involved in DNA transfer. The 7.8 kb chromosomal fragment seems to be closely related to the tra region of different conjugative plasmids and appears to be confined to Agrobacterium species, raising the question of the role of a chromosomal tra-like region during evolution.     

Tumour genes in plants: T-DNA encoded cytokinin biosynthesis

Gene 4 from the T-region of Ti plasmids is responsible for cytokinin effects in crown gall cells; we investigated whether it codes for an enzyme of hormone biosynthesis. In a first set of experiments, gene 4 from octopine plasmid pTiAch5 and nopaline plasmid pTiC58 was expressed in Escherichia coli, and the gene products were identified by reaction with antiserum raised against a decapeptide derived from the DNA sequence of the gene. Extracts from cells expressing the gene contained high isopentenyl-transferase activity catalyzing the formation of N6-(delta2-isopentenyl)adenosine from 5'-AMP and delta2-isopentenylpyrophosphate. The cytokinin was identified by sequential h.p.l.c. chromatography and mass spectrometry. In a second set of experiments it was shown that crown gall cells contained isopentenyltransferase activity and a protein of mol. wt. 27 000 which was identified as the product of gene 4 by reaction with the antiserum. Isopentenyltransferase activity was specifically inhibited by the antiserum. No comparable enzyme activity or immunoreactive protein was detected in cytokinin-autotrophic, T-DNA free tobacco cells. The results establish that gene 4 from the T-region of octopine and nopaline Ti plasmids codes for an enzyme of cytokinin biosynthesis.     

Transfer of the octopine T-DNA segment to plant cells mediated by different types of Agrobacterium tumor- or root-inducing plasmids: generality of virulence systems.

Genetic complementation studies demonstrated that the transfer to plant cells of the octopine T-DNA, entirely present as the only part of the tumor-inducing (Ti) plasmid on the plasmid pAL1050, was effected by the virulence systems from related plasmids, viz. the nopaline Ti plasmid pTiC58, the limited host range plasmid pTiAg57, and the root-inducing (Ri) plasmid pRi1855. Rhizobium symbiosis plasmids were not capable of effecting the introduction of pAL1050 into plant cells.     

Characterization of the virA virulence gene of the nopaline plasmid, pTiC58, of Agrobacterium tumefaciens

We have determined the complete nucleotide sequence of a 4.8 kilobase fragment encompassing the virA locus of the nopaline-type plasmid, pTiC58, of Agrobacterium tumefaciens. virA is composed of a single open reading frame of 2499 nucleotides, capable of encoding a protein of 91.3 kiloDaltons. A trpE::virA gene fusion was used to confirm the reading frame of virA. High nucleotide and amino acid sequence homologies were observed between pTiC58 virA and the virA sequences of three octopine-type plasmids. Strong homologies in amino acid sequence were observed between pTiC58 VirA and seven bacterial proteins which control various regulons. Two hydrophobic domains within VirA are also consistent with a model in which VirA acts as a membrane-bound sensor of plant signal molecules.     

Indoleacetic acid complementation and its relation to host range specifying genes on the Ti plasmid of Agrobacterium tumefaciens

Summary Host range variations were noted when 23 wildtype strains of Agrobacterium tumefaciens were tested on 27 different plant species. Because we have shown previously that host range specificity is conferred by the pTi plasmid, these variations in host specificity implicated genetic differences among p Ti plasmids within the A. tumefaciens population that was tested. Host specificity was independent of the type of opine utilized and biotype of the strain used. These data suggested that separate genetic determinants operate for host specificity. This hypothesis was confirmed by Tn5 mutagenesis of the pTi plasmid, which generated mutants affected in host specificity. The regions of host specifying genes were located by displacement analysis of mutant pTi-plasmid-DNA restriction fragments. There are at least two sites on the pTiC58 plasmid: one within the T-region and the other about 75–77 kb to the right of this region. Mutations within the T-region were chemically complemented by indoleacetic acid, which restored the host range of the mutants. Such complementations were not observed with mutants outside the T-region.     

Detection of T-DNA transfer to plant cells by A. tumefaciens virulence mutants using agroinfection

Summary To test whether virulence mutants of Agrobacterium tumefaciens are capable of promoting T-DNA transfer into plant cells, a tandem array of Cauliflower Mosaic Virus (CaMV) DNA was cloned between T-region border sequences on a wide host range plasmid and introduced into various virulence mutants. The resulting strains were used to infect Brassica rapa cv. Just Right. This assay, recently referred to as agroinfection, is based on the appearance of viral symptoms following transfer of T-DNA to plant cells, and is shown to be at least 100 times more sensitive in detecting T-DNA transfer than tumour formation. Mutants in the loci vir A, B and G, which were avirulent on turnip, failed to induce virus symptoms. Of the two vir D mutants tested, neither induced tumours, but one was capable of inducing virus symptoms. Mutants in vir E, C and F, which induced respectively no, small and normal tumours on turnip, all induced virus symptoms.     

Delivery of T-DNA from the Agrobacterium tumefaciens chromosome into plant cells

The intact T-region of the B6Ti plasmid of Agrobacterium tumefaciens was stepwise cloned into a site in transposon Tn3. In this way a suitable vehicle (Tn1882) was obtained for translocating the T-region to different replicons, i.e., to other plasmids or the chromosome. The IncP plasmid R772::Tn1882 conferred tumorigenicity on Agrobacterium if the virulence genes were provided in trans in the same cell. This result showed that the T-region present on Tn1882 was transferred efficiently to plant cells. Normal tumor development also occurred if the T-region was placed in the chromosome of A. tumefaciens and an R' plasmid was present carrying virA–E or virA–F. We conclude that the plasmid location of the T-region is not a prerequisite for transfer to the plant cell. The apparently normal delivery of the T-DNA from a bacterial chromosomal location supports a model involving a processing step within Agrobacterium effecting transfer of the T-region as a separate entity.     

Structure and expression of DNA transferred to tobacco via transformation of protoplasts with Ti-plasmid DNA: co-transfer of T-DNA and non T-DNA sequences

Summary The T-DNA structure and organization in tissues obtained via transformation of tobacco protoplasts with Ti-plasmid DNA was found to be completely different from the T-DNA introduced via Agrobacterium tumefaciens. It is often fragmented. Overlapping copies of T-DNA, having various sizes, as well as separated fragments of T-DNA were detected. The border sequences of 23 basepairs (bp), flanking the T-region in the Ti-plasmid as direct repeats are not used as preferred sequences for integration. Similar results were obtained with a T-region clone lacking one of the T_L-borders. This clone, which carried the cytokinin locus and only the right border sequence of T_L and the left border sequence of T_R, still had the capacity to transform protoplasts. Also the Vir-region of the Ti-plasmid is not required for integration of foreign DNA via DNA transformation. This is demonstrated by the results with the T-region clone mentioned and by the transforming capacity of a Ti-plasmid carrying a mutated Vir-region. Nevertheless, in a number of Ti-plasmid DNA transformants Vir-region fragments were found to be stably integrated. Furthermore, it has been established that co-transformation can occur with plant cells. Besides the detection of Ti-plasmid fragments from outside the T-region also DNA sequences originating from two DNA sources, which were both independently present in transformation experiments, have been found in some DNA transformants, e.g. calf thymus DNA, which was used as carrier DNA. No expression of the co-transferred DNA was observed. In total three phenotypical classes of DNA transformants were isolated. Although the T-DNA was often scrambled, polyA⁺ mRNA studies indicated that the different phenotypes studied can be explained by the presence of active T-DNA genes with known functions.