Amino acid sequences of heterotrophic and photosynthetic ferredoxins from the tomato plant (Lycopersicon esculentum Mill.)

Several forms (isoproteins) of ferredoxin in roots, leaves, and green and red pericarps in tomato plants (Lycopersicon esculentum Mill.) were earlier identified on the basis of N-terminal amino acid sequence and chromatographic behavior (Green et al. 1991). In the present study, a large scale preparation made possible determination of the full length amino acid sequence of the two ferredoxins from leaves. The ferredoxins characteristic of fruit and root were sequenced from the amino terminus to the 30th residue or beyond. The leaf ferredoxins were confirmed to be expressed in pericarp of both green and red fruit. The ferredoxins characteristic of fruit and root appeared to be restricted to those tissue. The results extend earlier findings in demonstrating that ferredoxin occurs in the major organs of the tomato plant where it appears to function irrespective of photosynthetic competence.Abbreviations CBB Coomassie brilliant blue R-250 - Cm Carboxymethylated - Fd Ferredoxin - FNR ferredoxin-NADP⁺ oxidoreductase - FPLC Fast protein liquid chromatography - HPLC High performance liquid chromatography - rt root     

Amino acid sequences of two ferredoxins from pokeweed, Phytolacca americana

The amino acid sequences of two ferredoxins isolated from pokeweed, Phytolacca americana, were determined. Tryptic peptides of maleyl-carboxymethyl-ferredoxin I and carboxymethyl-ferredoxin II were prepared and analyzed. The large peptides were further digested with staphylococcal protease and chymotrypsin. Ferredoxins I and II were composed of 96 and 98 amino acid residues, respectively. Though ferredoxin I lacks tryptophan and methionine, ferredoxin II contains both of them. In a comparison of the amino acid sequences with those of other higher plant ferredoxins, ferredoxin I is one residue shorter than others at the carboxyl-terminus and ferredoxin II one longer than others at the amino-terminus. Ferredoxins I and II differ in 23 sites from each other and in 27 to 37 sites from other higher plant ferredoxins. This suggests that duplication of the ferredoxin gene occurred after the divergence of pokeweed from other higher plants. A phylogenetic tree including all other ferredoxins was constructed.     

Amino acid sequences of ferredoxin isoproteins from Japanese taro (Colocasia esculenta Schott)

The amino acid sequences of ferredoxins (Fd A and Fd B) from Japanese taro (Colocasia esculenta Schott) were determined. They consisted of single polypeptide chains of 98 residues, and both Fds had molecular masses of 10700 and 10500, respectively. There was a 92% homology between the sequences of the isoproteins (Fd A and Fd B). These sequences were compared with those of the closely related plant Fds and their phylogenetic tree was constructed. Two ferredoxin isoproteins from Hawaiian taro (Colocasia esculenta Schott) were also isolated and their N-terminal sequences were determined to be identical to those of Japanese taro.     

Complete amino acid sequence of ferredoxin from Peridinium bipes (Dinophyceae)

The amino acid sequence of the major ferredoxin component isolated from a dinoflagellate, Peridinium bipes, was completely determined. Staphylococcus aureus V8 proteolytic, tryptic and chymotryptic peptides of Cm-ferredoxin were prepared and sequenced. The sequence was Phe-Lys-Val-Thr-Leu-Asp-Thr-Pro-Asp-Gly-Lys-Lys-Ser-Phe-Glu-Cys- Pro-Gly-Asp-Ser-Tyr-Ile-Leu-Asp-Lys-Ala-Glu-Glu-Glu-Gly-Leu-Glu-Leu-Pro- Tyr-Ser - Cys-Arg-Ala-Gly-Ser-Cys-Ser-Ser-Cys-Ala-Gly-Lys-Val-Leu-Thr-Gly-Ser-Ile- Asp-Gln - Ser-Asp-Gln-Ala-Phe-Leu-Asp-Asp-Asp-Gln-Gly-Gly-Asp-Gly-Tyr-Cys-Leu-Thr- Cys-Val - Thr-Tyr-Pro-Thr-Ser-Asp-Val-Thr-Ile-Lys-Thr-His-Cys-Glu-Ser-Glu-Leu. It was composed of 93 amino acid residues with 7 cysteine residues, the highest number found among the chloroplast-type ferredoxins so far sequenced. A cysteine residue was found for the first time at the 89th position in a chloroplast-type ferredoxin. Calculation of the numbers of amino acid differences among chloroplast-type ferredoxins indicates that the Peridinium ferredoxin is far divergent not only from higher plant ferredoxins but also from blue-green algal ferredoxins.     

A non-photosynthetic ferredoxin gene is induced by ethylene in Citrus organs

The sequence and expression of mRNA homologous to a cDNA encoding a non-photosynthetic ferredoxin (Fd1) from Citrus fruit was investigated. The non-photosynthetic nature of this ferredoxin was deduced from: (1) amino acid sequence alignments showing better scores with non-photosynthetic than with photosynthetic ferredoxins, (2) higher expression in tissues containing plastids other than chloroplast such as petals, young fruits, roots and peel of fully coloured fruits, and (3) the absence of light-dark regulation characteristic of photosynthetic ferredoxins. In a phylogenetic tree constructed with higher-plant ferredoxins, Citrus fruit ferredoxin clustered together with root ferredoxins and separated from the photosynthetic ferredoxins. Non photosynthetic (root and fruit) ferredoxins, but not the photosynthetic ferredoxins, have their closest homologs in cyanobacteria. Analysis of ferredoxin genomic organization suggested that non-photosynthetic ferredoxins exist in Citrus as a small gene family. Expression of Fd1 is developmentally regulated during flower opening and fruit maturation, both processes may be mediated by ethylene in Citrus. Exogenous ethylene application also induced the expression of Fd1 both in flavedo and leaves. The induction of non-photosynthetic ferredoxins could be related with the demand for reducing power in non-green, but biosynthetically active, tissues.     

Ferredoxin Isolated from Plant Non-Photosynthetic Tissues. Purficaition and Characterization

A ferredoxin was isolated from non-photosynthetic tissues ofthe lower storage root of radish (Raphanus sativus L. var. acantiformiscultivar Miyashige) in a pure form by conventional means. Itshowed the characteristic features in its absorption spectrumof chloroplast-type ferredoxin. However, amino acid compositionand amino (N)- terminal sequence were different from those ofradish leaf ferredoxin. Root ferredoxin was able to transferelectrons from dithionite to nitrite reductase [EC 1.7.7.1 [EC] ]isolated from mung bean seedling roots and also to mediate NADP⁺photoreduction in spinach broken chloroplasts. It therefore is suggested that a set of distinctive molecularspecies of ferredoxin is present in non-photosynthetic tissuesand functions as a redox mediator in ferredox-independent enzymesystems. (Received October 18, 1985; Accepted January 16, 1986)     

Localization of ferredoxin isoproteins in mesophyll and bundle sheath cells in maize leaf

Four ferredoxin isoproteins were identified in the C₄ plant Zea mays L. by analysis of extracts from leaves, mesocotyls, and roots of the young seedlings. The relative amounts of the isoproteins isolated from the photosynthetic and nonphotosynthetic organs were different. All the isoproteins were present in the leaves of green and etiolated plants, whereas two out of the four isoproteins were not detected in the roots or in the mesocotyls. During the greening of etiolated seedlings, the level of the two isoproteins unique to the leaf increased markedly. Analysis of the cellular and subcellular distribution of the two major leaf isoproteins showed that one isoprotein was present in the chloroplasts of both mesophyll and bundle sheath cells, whereas the other was only found in the chloroplasts of bundle sheath cells. This is the first report of the cell-specific expression of ferredoxin isoproteins in the leaves of a C₄ plant.     

Evidence for the presence of a [2Fe-2S] ferredoxin in bean sprouts

An iron-sulfur protein with properties similar to those of ferredoxins found in the leaves of higher plants has been isolated from bean sprouts--a non-photosynthetic plant tissue. The bean sprout protein has a molecular mass of 12.5 kDa and appears to contain a single [2Fe-2S] cluster. The absorbance and circular dichroism spectra of the bean sprout protein resemble those of spinach leaf ferredoxin and the bean sprout protein can replace spinach ferredoxin as an electron donor for NADP+ reduction, nitrite reduction and thioredoxin reduction by spinach leaf enzymes. Although the reduced bean sprout protein (Em = -440 mV) is a slightly stronger reductant than spinach ferredoxin and appears to be less acidic than spinach ferredoxin, the two proteins are similar enough so that the bean sprout protein is recognized by an antibody raised against spinach ferredoxin.     

Properties of common wheat ferredoxin, and a comparison with ferredoxins from related species of triticum and aegilops.

Wheat ferredoxin was purified from the leaves of common wheat (Triticum aestivum). The absorption spectrum showed maxima at 465, 425, 332, and 278 nm. The absorbance ratio, A425 nm/A278 nm was 0.49, and the millimolar extinction coefficient at 425 nm was 10.8 mM-1. cm-1. The amino acid composition was determined to be Lys5, His2, Arg1, Asp11, Thr5, Ser7, Glu18, Pro5, Gly6, Ala7, Cys5, Val7, Met1, Ile4, Leu7, Tyr4, Phe1, and Trp1. The total number of amino acid residues was 97. The molecular weight was calculated from the amino acid composition to be 10,829, including iron and sulfur atoms. This value was confirmed by other methods, which were based on the contents of non-heme iron and of terminal amino acid. The N-terminal amino acid was alanine, and the C-terminal amino acid sequence was -Glu-Leu-Thr-AlaCOOH. Comparative studies were performed between T. aestivum ferredoxin and ferredoxins isolated from closely related species; these were T. aegilopoides, T. durum, Ae. squarrosa, and Ae. ovata. No significant differences in the properties of these ferredoxins were detected. It was also shown that these ferredoxins are immunologically homologous. It is, therefore, likely that one molecular species of ferredoxin is distributed through two genera of Triticum and Aegilops.     

Isolation and Characterization of a Ferredoxin Gene from Arabidopsis thaliana

We report the cloning and characterization of an Arabidopsis thaliana (L.) Heynh. (Columbia ecotype) ferredoxin gene (Fed A). Sequence analysis of a genomic clone shows an intron-free, 444-base pair open reading frame which encodes a 96 amino acid mature ferredoxin polypeptide preceded by a 52 amino acid transit peptide. Comparison with other plant ferredoxin proteins suggests that Fed A encodes a leaf ferredoxin. Genomic Southern blot analysis indicates the presence of a second, weakly related gene, consistent with other reports of at least two ferredoxins in plants. The Fed A gene promoter contains two regions, ACGCCACGTGGTAGATAGGATT (G-I box) and CCACGCCATTTCCACAAGC (CCAC box), which are strongly conserved in both sequence and position between the Arabidopsis and pea ferredoxin genes. Similarities with other better characterized plant promoter elements are also discussed.     

Ferredoxin and Formyltetrahydrofolate Synthetase: Comparative Studies with Clostridium acidiurici, Clostridium cylindrosporum, and Newly Isolated Anaerobic Uric Acid-Fermenting Strains

Six strains of Clostridium acidiurici and three strains of C. cylindrosporum were isolated from soil samples by enrichment culture with uric acid as the source of carbon, nitrogen, and energy. The newly isolated strains were characterized by their spore morphology and the amounts of glycine and formate formed by the fermentation of uric acid. The strains were easily identified as belonging to one species or the other on the basis of spore morphology and formate production. The crystal properties and spectra of the native ferredoxins of all the strains isolated and the amino acid composition and partial carboxy-terminal sequence of all their apoferredoxins were determined. All the ferredoxins were tested for cross-reactivity with antiserum to C. acidiurici ferredoxin by microcomplement fixation. Five of the six C. acidiurici strains, which had ferredoxins with amino acid compositions identical to that from C. acidiurici, also showed immunological identity (immunological distance = 0.0). These results suggest sequence identity. The one strain with a different amino acid composition failed to show complete cross-reactivity. Two of the three C. cylindrosporum strains have ferredoxin amino acid compositions identical to that from C. cylindrosporum. The third strain had a minimum of five differences in sequence. All C. cylindrosporum strains had ferredoxins that differed considerably from C. acidiurici strains (minimum of eight to nine differences), and none of these ferredoxins cross-reacted with antisera to C. acidiurici ferredoxin. Antisera were prepared to formyltetrahydrofolate synthetase from C. acidiurici and C. cylindrosporum, and all possible comparisons were made by using immunodiffusion and microcomplement fixation. There is more intraspecies variation in the synthetases than in the ferredoxins; however, the results suggest considerable interspecies differences in both proteins. These results suggest a low degree of genomic relatedness between the two species, which contrasts sharply with their apparent high degree of phenotypic similarity.     

Characterization of a ferredoxin:NADP+ oxidoreductase from a nonphotosynthetic plant tissue

A flavoprotein with properties similar to those of ferredoxin:NADP+ oxidoreductases found in the leaves of higher plants has been purified to apparent homogeneity from bean sprouts, a nonphotosynthetic plant tissue. The absorbance and circular dichroism spectra of the bean sprout protein are similar to those of spinach leaf ferredoxin:NADP+ oxidoreductase and an antibody raised against the spinach enzyme recognized the bean sprout enzyme. The bean sprout enzyme catalyzed ferredoxin-dependent electron transfer from NADPH to equine cytochrome c at a high rate but, unlike the spinach enzyme, exhibited little NADPH to 2,6-dichlorophenol indophenol diaphorase activity. The bean sprout enzyme forms a 1:1 electrostatically stabilized complex with ferredoxins isolated from either bean sprouts or spinach leaves.     

Comparative studies on two ferredoxins from the cyanobacterium Nostoc strain MAC.

Two ferredoxins were isolated from the cyanobacterium Nostoc strain MAC grown autotrophically in the light or heterotrophically in the dark. In either case approximately three times as much ferredoxin I as ferredoxin II was obtained. Both ferredoxins had absorption maxima at 276, 282 (shoulder), 330, 423 and 465 nm in the oxidized state, and each possessed a single 2 Fe-2S active centre. Their isoelectric points were approx. 3.2. The midpoint redox potentials of the ferredoxins differed markedly; that of ferredoxin I was --350mV and that of ferredoxin II was --445mV, at pH 8.0. The midpoint potential of ferredoxin II was unusual in being pH dependent. Ferredoxin I was most active in supporting NADP+ photoreduction by chloroplasts, whereas ferredoxin II was somewhat more active in pyruvate decarboxylation by the phosphoroclastic system of Clostridum pasteurianum. Though the molecular weights of the ferredoxins determined by ultracentrifugation were the same within experimetnal error, the amino acid compositions showed marked differences. The N-terminal amino acid sequences of ferredoxins I and II were determined by means of an automatic sequencer. There are 11--12 differences between the sequences of the first 32 residues. It appears that the two ferredoxins have evolved separately to fulfil different roles in the organism.     

Structure-function relationship of [2Fe2S] ferredoxins and design of a model molecule

[2Fe2S] ferredoxins isolated from various plants and algae comprise 93–99 amino acid residues and resemble each other not only in sequences, but also in physiological functions. One of them isolated from Spirulina platensis was subjected to X-ray analysis and its three dimensional structure is now known. [2Fe2S] ferredoxins of a different type are found in halobacteria and comprise 128 amino acid residues. Both types of the [2Fe2S] ferredoxins exhibit low redox potentials. By comparing the amino acid sequences of 28 [2Fe2S] ferredoxins and the tertiary structure of S. platensis ferredoxin we predicted a common three-dimensional structure to the [2Fe2S] ferredoxins and proposed a molecular surface area to be interacting with FNR. An artificial small molecule composed of 20 amino acid residues is designed on the basis of the tertiary structure of S. platensis ferredoxin. The amino acid sequence was predicted to be ProTyrSerCysArgAlaGlyAlaCysSerThrCysAlaGly ProLeuLeuThr CysVal which should have a [2Fe2S] cluster with a low redox potential     

The amino acid sequence of ferredoxin from Sambucus nigra

The amino acid sequence of the ferredoxin from Sambucus nigra consists of a single polypeptide chain of 97 amino acid residues, 5 of which are cysteine. The positions of the 4 cysteine residues which bind the iron atoms of the active centre are identical to those of other ferredoxins. Due to difficulties of obtaining pure protein, residues 87–90 have only been identified from the amino acid analysis of peptide C 10 and by homology with other higher plant ferredoxins.     

Amino acid sequence of a ferredoxin from Bumilleriopsis filiformis, a yellow-green alga: relationship with red algae, protoflorideophyceae, and filamentous blue-green algae

The amino acid sequence of a [2Fe-2S] ferredoxin isolated from Bumilleriopsis filiformis, a yellow-green alga, was determined by using conventional techniques. It consisted of 98 amino acid residues with a microheterogeneity at the amino-terminus: Ala/Glu-Thr-Tyr-Ser-Val-Thr-Leu-Val-Asn-Glu-Glu-Lys-Asn-Ile-Asn-Ala-Val- Ile- Lys-Cys-Pro-Asp-Asp-Gln-Phe-Ile-Leu-Asp-Ala-Ala-Glu-Glu-Gln-Gly-Ile-Glu- Leu- Pro-Tyr-Ser-Cys-Arg-Ala-Gly-Ala-Cys-Ser-Thr-Cys-Ala-Gly-Lys-Val-Leu-Ser- Gly- Thr-Ile-Asp-Gln-Ser-Glu-Gln-Ser-Phe-Leu-Asp-Asp-Asp-Gln-Met-Gly-Ala-Gly- Phe- Leu-Leu-Thr-Cys-Val-Ala-Tyr-Pro-Thr-Ser-Asp-Cys-Lys-Val-Gln-Thr-His-Ala- Glu- Asp-Asp-Leu-Tyr. No prominent structural feature was noted in this ferredoxin in comparison with other homologous ferredoxins. From the structural comparison, B. filiformis was placed taxonomically close to filamentous blue-green algae and red algae.     

Two distinct ferredoxins from Rhodobacter capsulatus: complete amino acid sequences and molecular evolution

Two distinct ferredoxins were purified from Rhodobacter capsulatus SB1003. Their complete amino acid sequences were determined by a combination of protease digestion, BrCN cleavage and Edman degradation. Ferredoxins I and II were composed of 64 and 111 amino acids, respectively, with molecular weights of 6,728 and 12,549 excluding iron and sulfur atoms. Both contained two Cys clusters in their amino acid sequences. The first cluster of ferredoxin I and the second cluster of ferredoxin II had a sequence, CxxCxxCxxxCP, in common with the ferredoxins found in Clostridia. The second cluster of ferredoxin I had a sequence, CxxCxxxxxxxxCxxxCM, with extra amino acids between the second and third Cys, which has been reported for other photosynthetic bacterial ferredoxins and putative ferredoxins (nif-gene products) from nitrogen-fixing bacteria, and with a unique occurrence of Met. The first cluster of ferredoxin II had a CxxCxxxxCxxxCP sequence, with two additional amino acids between the second and third Cys, a characteristics feature of Azotobacter-[3Fe-4S] [4Fe-4S]-ferredoxin. Ferredoxin II was also similar to Azotobacter-type ferredoxins with an extended carboxyl (C-) terminal sequence compared to the common Clostridium-type. The evolutionary relationship of the two together with a putative one recently found to be encoded in nifENXQ region in this bacterium [Moreno-Vivian et al. (1989) J. Bacteriol. 171, 2591-2598] is discussed.     

Ferredoxin from a liverwort, Marchantia polymorpha. Purification and amino acid sequence

Marchantia polymorpha ferredoxin was purified by DE-52 and Sephadex G-75 column chromatographies to homogeneity. The complete amino acid sequence of the carboxymethylated (Cm) ferredoxin was determined by conventional methods to be as follows. Thr-Phe-Lys- Val-Thr-Leu-Asn-Thr-Pro-Thr-Gly-Gln-Ser-Val-Ile-Asp-Val-Glu-Asp- Asp-Glu-Tyr-Ile-Leu-Asp-Ala-Ala-Glu-Glu-Ala-Gly-Leu-Ser-Leu-Pro- Tyr-Ser-Cys-Arg-Ala-Gly-Ala-Cys-Ser-Ser-Cys-Ala-Gly-Lys-Val-Thr- Ala-Gly-Glu-Val-Asp-Gln-Ser-Asp-Glu-Ser-Phe-Leu-Asp-Asp-Asp-Gln- Met-Asp-Glu-Gly-Tyr-Val-Leu-Thr-Cys-Ile-Ala-Tyr-Pro-Thr-Ser-Asp- Leu-Thr-Ile-Asp-Thr-His-Gln-Glu-Glu-Ala-Leu-Ile. The total number of amino acid residues was 95 and the molecular weight was calculated to be 10,174, excluding iron and sulfur atoms. The distribution of the four cysteine residues chelating the two iron atoms was identical to those of other [2Fe-2S] ferredoxins. The relationship between M. polymorpha and other plants was discussed in terms of plant phylogeny.