Local Field Spectroscopy of Metal Dimers by TPL Microscopy

We report on two-photon photoluminescence (TPL) spectroscopy on metal dimers made of two gold nanoparticles separated by subwavelength distances. A direct comparison with far-field scattering measurements shows that TPL provides additional data on the structure modes of major importance for their use in surface-enhanced Raman scattering, enhanced fluorescence, and sensing.     

Force Spectroscopy with Dual-Trap Optical Tweezers: Molecular Stiffness Measurements and Coupled Fluctuations Analysis

Dual-trap optical tweezers are often used in high-resolution measurements in single-molecule biophysics. Such measurements can be hindered by the presence of extraneous noise sources, the most prominent of which is the coupling of fluctuations along different spatial directions, which may affect any optical tweezers setup. In this article, we analyze, both from the theoretical and the experimental points of view, the most common source for these couplings in dual-trap optical-tweezers setups: the misalignment of traps and tether. We give criteria to distinguish different kinds of misalignment, to estimate their quantitative relevance and to include them in the data analysis. The experimental data is obtained in a, to our knowledge, novel dual-trap optical-tweezers setup that directly measures forces. In the case in which misalignment is negligible, we provide a method to measure the stiffness of traps and tether based on variance analysis. This method can be seen as a calibration technique valid beyond the linear trap region. Our analysis is then employed to measure the persistence length of dsDNA tethers of three different lengths spanning two orders of magnitude. The effective persistence length of such tethers is shown to decrease with the contour length, in accordance with previous studies.     

Analysis of an RNA Pseudoknot Structure by CD Spectroscopy

Abstract

The RNA PK5 (GCGAUUUCUGACCGCUUUUUUGUCAG) forms a pseudoknotted structure at low temperatures and a hairpin containing an A · C opposition at higher temperatures (J. Mol. Biol. 214, 455–470 (1990)). CD and absorption spectra of PK5 were measured at several temperatures. A basis set of spectra were fit to the spectra of PK5 using a method that can provide estimates of the numbers of A · U, G · C, and G · U base pairs as well as the number of each of 11 nearest-neighbor base pairs in an RNA (Biopolymers 31, 373–384 (1991)). The fits were close, indicating that PK5 retained the A conformation in the pseudoknot structure and that the fitting technique is not hindered by pseudoknots or A · C oppositions. The results from the analysis were consistent with the pseudoknotted structure at low temperatures and with the hairpin structure at higher temperatures. We concluded that the method of spectral analysis should be useful for determining the secondary structures of other RNAs containing pseudoknots and A · C oppositions.     

Tensile Mechanics of Alanine-Based Helical Polypeptide: Force Spectroscopy versus Computer Simulations

In nature, an α-helix is commonly used to build thermodynamically stable and mechanically rigid protein conformations. In view of growing interest in the mechanical rigidity of proteins, we measured the tensile profile of an alanine-based α-helical polypeptide on an atomic-force microscope to investigate the basic mechanics of helix extension with minimal interference from side-chain interactions. The peptide was extended to its maximum contour length with much less force than in reported cases of poly-L-Glu or poly-L-Lys, indicating that chain stiffness strongly depended on the physicochemical properties of side chains, such as their bulkiness. The low tensile-force extension originated presumably in locally unfolded parts because of spontaneous structural fluctuations. In 50% trifluoroethanol, the well-known helix-promoting agent, the rigidity of the sample polypeptide was markedly increased. Computer simulations of the peptide-stretching process showed that a majority of constituent residues underwent a transition from an α-helical to an extended conformation by overcoming an energy barrier around ψ ∼0° on the Ramachandran plot. The observed lability of an isolated helix signified the biological importance of the lateral bundling of helices to maintain a rigid protein structure.     

Structure Analysis of Proteins and Peptides by Difference Circular Dichroism Spectroscopy

The Protein Journal - Difference circular dichroism (CD) spectroscopy was used here to characterize changes in structure of flexible peptides upon altering their environments. Environmental changes...     

Toward Reproducible Computational Research: An Empirical Analysis of Data and Code Policy Adoption by Journals

Journal policy on research data and code availability is an important part of the ongoing shift toward publishing reproducible computational science. This article extends the literature by studying journal data sharing policies by year (for both 2011 and 2012) for a referent set of 170 journals. We make a further contribution by evaluating code sharing policies, supplemental materials policies, and open access status for these 170 journals for each of 2011 and 2012. We build a predictive model of open data and code policy adoption as a function of impact factor and publisher and find higher impact journals more likely to have open data and code policies and scientific societies more likely to have open data and code policies than commercial publishers. We also find open data policies tend to lead open code policies, and we find no relationship between open data and code policies and either supplemental material policies or open access journal status. Of the journals in this study, 38% had a data policy, 22% had a code policy, and 66% had a supplemental materials policy as of June 2012. This reflects a striking one year increase of 16% in the number of data policies, a 30% increase in code policies, and a 7% increase in the number of supplemental materials policies. We introduce a new dataset to the community that categorizes data and code sharing, supplemental materials, and open access policies in 2011 and 2012 for these 170 journals.     

Force and Premature Binding of ADP Can Regulate the Processivity of Individual Eg5 Dimers

Using a high-resolution optical trapping instrument, we directly observed the processive motions of individual Eg5 dimers over a range of external loads and ATP, ADP, and phosphate concentrations. To constrain possible models for dissociation from the microtubule, we measured Eg5 run lengths and also compared the duration of the last step of a processive run to all previous step durations. We found that the application of large longitudinal forces in either hindering or assisting directions could induce Eg5-microtubule dissociation. At a constant moderate force, maintained with a force clamp, the premature binding of ADP strongly promoted microtubule release by Eg5, whereas the addition of ATP or phosphate had little effect on dissociation. These results imply that run length is determined not only by the load, but also by the concentration and type of nucleotides present, and therefore that the biochemical cycles of the two motor domains of the Eg5 dimer are coordinated to promote processive stepping.     

Nanomechanical Properties of Tenascin-X Revealed by Single-Molecule Force Spectroscopy

Tenascin-X is an extracellular matrix protein and binds a variety of molecules in extracellular matrix and on cell membrane. Tenascin-X plays important roles in regulating the structure and mechanical properties of connective tissues. Using single-molecule atomic force microscopy, we have investigated the mechanical properties of bovine tenascin-X in detail. Our results indicated that tenascin-X is an elastic protein and the fibronectin type III (FnIII) domains can unfold under a stretching force and refold to regain their mechanical stability upon the removal of the stretching force. All the 30 FnIII domains of tenascin-X show similar mechanical stability, mechanical unfolding kinetics, and contour length increment upon domain unfolding, despite their large sequence diversity. In contrast to the homogeneity in their mechanical unfolding behaviors, FnIII domains fold at different rates. Using the 10th FnIII domain of tenascin-X (TNXfn10) as a model system, we constructed a polyprotein chimera composed of alternating TNXfn10 and GB1 domains and used atomic force microscopy to confirm that the mechanical properties of TNXfn10 are consistent with those of the FnIII domains of tenascin-X. These results lay the foundation to further study the mechanical properties of individual FnIII domains and establish the relationship between point mutations and mechanical phenotypic effect on tenascin-X. Moreover, our results provided the opportunity to compare the mechanical properties and design of different forms of tenascins. The comparison between tenascin-X and tenascin-C revealed interesting common as well as distinguishing features for mechanical unfolding and folding of tenascin-C and tenascin-X and will open up new avenues to investigate the mechanical functions and architectural design of different forms of tenascins.     

Computational Evaluation of Intermolecular Interactions of a Universal Base 3-Nitropyrrole in Stacked Dimers and DNA Duplexes

Abstract

The stacking interactions between a universal base of 3-nitropyrrole (3NP) and four canonical nucleobases were studied by means of ab initio molecular orbital calculations. The stabilities of the complexes are comparable to those of the stacked dimers of canonical bases reported previously. The detailed analysis of the interaction energies revealed the importance of the dipole-dipole interaction included in the Hartree-Fock terms to determine the geometry dependence of the stacking energies. It was also clarified that the dispersion energies included in the electron-correlation terms were essential to obtain adequate stabilities. The contribution of the nitro group was evaluated by the comparative studies of pyrrole and 3NP. The increased molecular dipole moment and surface are expected to account for the enhancement of the stability of the stacked dimers containing 3NP. The force field parameters required for calculation of the molecular mechanics of 3NP were obtained for 3NP on the basis of these molecular orbital calculations. The energy-minimized structures obtained by the molecular mechanics calculations of 3NP accorded with those obtained by the molecular orbital calculations described above. A DNA duplex structure containing 3NP-A, 3NP-T, or 3NP-C was calculated by use of these force field parameters. In the case of 3NP-A, the computationally calculated structure was in good agreement with that previously determined by use of ¹H-NMR except for the orientation of the nitro group.     

The Force is Strong with This Epigenome: Chromatin Structure and Mechanobiology

All life forms sense and respond to mechanical stimuli. Throughout evolution, organisms develop diverse mechanosensing and mechanotransduction pathways, leading to fast and sustained mechanoresponses. Memory and plasticity characteristics of mechanoresponses are thought to be stored in the form of epigenetic modifications, including chromatin structure alterations. These mechanoresponses in the chromatin context share conserved principles across species, such as lateral inhibition during organogenesis and development. However, it remains unclear how mechanotransduction mechanisms alter chromatin structure for specific cellular functions, and if altered chromatin structure can mechanically affect the environment. In this review, we discuss how chromatin structure is altered by environmental forces via an outside-in pathway for cellular functions, and the emerging concept of how chromatin structure alterations can mechanically affect nuclear, cellular, and extracellular environments. This bidirectional mechanical feedback between chromatin of the cell and the environment can potentially have important physiological implications, such as in centromeric chromatin regulation of mechanobiology in mitosis, or in tumor-stroma interactions. Finally, we highlight the current challenges and open questions in the field and provide perspectives for future research.     

Misfolded plant virus proteins: elicitors and targets of ubiquitylation

Mutant tobacco mosaic virus (TMV) coat proteins (CPs) with known amino acid replacements provide well defined examples of destabilized tertiary structures. Here we show that misfolded TMV CPs, but not functional wild-type CPs, induce massive ubiquitylation in tobacco cells and that denatured, insoluble CP subunits are the main substrates of ubiquitin conjugation. As TMV CPs can be easily manipulated they are unique tools to study the molecular basis of the plant cell's response to aberrant protein structures and the associated intracellular stress reactions.     

Investigating Receptor-ligand Systems of the Cellulosome with AFM-based Single-molecule Force Spectroscopy

Cellulosomes are discrete multienzyme complexes used by a subset of anaerobic bacteria and fungi to digest lignocellulosic substrates. Assembly of the enzymes onto the noncatalytic scaffold protein is directed by interactions among a family of related receptor-ligand pairs comprising interacting cohesin and dockerin modules. The extremely strong binding between cohesin and dockerin modules results in dissociation constants in the low picomolar to nanomolar range, which may hamper accurate off-rate measurements with conventional bulk methods. Single-molecule force spectroscopy (SMFS) with the atomic force microscope measures the response of individual biomolecules to force, and in contrast to other single-molecule manipulation methods (i.e. optical tweezers), is optimal for studying high-affinity receptor-ligand interactions because of its ability to probe the high-force regime (>120 pN). Here we present our complete protocol for studying cellulosomal protein assemblies at the single-molecule level. Using a protein topology derived from the native cellulosome, we worked with enzyme-dockerin and carbohydrate binding module-cohesin (CBM-cohesin) fusion proteins, each with an accessible free thiol group at an engineered cysteine residue. We present our site-specific surface immobilization protocol, along with our measurement and data analysis procedure for obtaining detailed binding parameters for the high-affinity complex. We demonstrate how to quantify single subdomain unfolding forces, complex rupture forces, kinetic off-rates, and potential widths of the binding well. The successful application of these methods in characterizing the cohesin-dockerin interaction responsible for assembly of multidomain cellulolytic complexes is further described.     

Degradation of Misfolded Endoplasmic Reticulum Glycoproteins in Saccharomyces cerevisiae Is Determined by a Specific Oligosaccharide Structure

In Saccharomyces cerevisiae, transfer of N-linked oligosaccharides is immediately followed by trimming of ER-localized glycosidases. We analyzed the influence of specific oligosaccharide structures for degradation of misfolded carboxypeptidase Y (CPY). By studying the trimming reactions in vivo, we found that removal of the terminal α1,2 glucose and the first α1,3 glucose by glucosidase I and glucosidase II respectively, occurred rapidly, whereas mannose cleavage by mannosidase I was slow. Transport and maturation of correctly folded CPY was not dependent on oligosaccharide structure. However, degradation of misfolded CPY was dependent on specific trimming steps. Degradation of misfolded CPY with N-linked oligosaccharides containing glucose residues was less efficient compared with misfolded CPY bearing the correctly trimmed Man₈GlcNAc₂ oligosaccharide. Reduced rate of degradation was mainly observed for mis- folded CPY bearing Man₆GlcNAc₂, Man₇GlcNAc₂ and Man₉GlcNAc₂ oligosaccharides, whereas Man₈GlcNAc₂ and, to a lesser extent, Man₅GlcNAc₂ oligosaccharides supported degradation. These results suggest a role for the Man₈GlcNAc₂ oligosaccharide in the degradation process. They may indicate the presence of a Man₈GlcNAc₂-binding lectin involved in targeting of misfolded glycoproteins to degradation in S. cerevisiae.     

The Structure of the Catalytic Domain of a Plant Cellulose Synthase and Its Assembly into Dimers

Cellulose microfibrils are para-crystalline arrays of several dozen linear (1→4)-β-d-glucan chains synthesized at the surface of the cell membrane by large, multimeric complexes of synthase proteins. Recombinant catalytic domains of rice (Oryza sativa) CesA8 cellulose synthase form dimers reversibly as the fundamental scaffold units of architecture in the synthase complex. Specificity of binding to UDP and UDP-Glc indicates a properly folded protein, and binding kinetics indicate that each monomer independently synthesizes single glucan chains of cellulose, i.e., two chains per dimer pair. In contrast to structure modeling predictions, solution x-ray scattering studies demonstrate that the monomer is a two-domain, elongated structure, with the smaller domain coupling two monomers into a dimer. The catalytic core of the monomer is accommodated only near its center, with the plant-specific sequences occupying the small domain and an extension distal to the catalytic domain. This configuration is in stark contrast to the domain organization obtained in predicted structures of plant CesA. The arrangement of the catalytic domain within the CesA monomer and dimer provides a foundation for constructing structural models of the synthase complex and defining the relationship between the rosette structure and the cellulose microfibrils they synthesize.     

A Unified Approach to Linking Experimental,Statistical and Computational Analysis of Spike Train Data

A fundamental issue in neuroscience is how to identify the multiple biophysical mechanisms through which neurons generate observed patterns of spiking activity. In previous work, we proposed a method for linking observed patterns of spiking activity to specific biophysical mechanisms based on a state space modeling framework and a sequential Monte Carlo, or particle filter, estimation algorithm. We have shown, in simulation, that this approach is able to identify a space of simple biophysical models that were consistent with observed spiking data (and included the model that generated the data), but have yet to demonstrate the application of the method to identify realistic currents from real spike train data. Here, we apply the particle filter to spiking data recorded from rat layer V cortical neurons, and correctly identify the dynamics of an slow, intrinsic current. The underlying intrinsic current is successfully identified in four distinct neurons, even though the cells exhibit two distinct classes of spiking activity: regular spiking and bursting. This approach – linking statistical, computational, and experimental neuroscience – provides an effective technique to constrain detailed biophysical models to specific mechanisms consistent with observed spike train data.     

The Volumetric Diversity of Misfolded Prion Protein Oligomers Revealed by Pressure Dissociation

Protein oligomerization has been associated with a wide range of diseases. High pressure approaches offer a powerful tool for deciphering the underlying molecular mechanisms by revealing volume changes associated with the misfolding and assembly reactions. We applied high pressure to induce conformational changes in three distinct β-sheet-rich oligomers of the prion protein PrP, a protein characterized by a variety of infectious quaternary structures that can propagate stably and faithfully and cause diseases with specific phenotypic traits. We show that pressure induces dissociation of the oligomers and leads to a lower volume monomeric PrP state that refolds into the native conformation after pressure release. By measuring the different pressure and temperature sensitivity of the tested PrP oligomers, we demonstrate significantly different void volumes in their quaternary structure. In addition, by focusing on the kinetic and energetic behavior of the pressure-induced dissociation of one specific PrP oligomer, we reveal a large negative activation volume and an increase in both apparent activation enthalpy and entropy. This suggests a transition state ensemble that is less structured and significantly more hydrated than the oligomeric state. Finally, we found that site-specific fluorescent labeling allows monitoring of the transient population of a kinetic intermediate in the dissociation reaction. Our results indicate that defects in atomic packing may deserve consideration as a new factor that influences differences between PrP assemblies and that could be relevant also for explaining the origin of prion strains.