Characterization of the Pseudomonas aeruginosa recA gene: the Les- phenotype.

The Les- phenotype (lysogeny establishment deficient) is a pleiotropic effect of the lesB908 mutation of Pseudomonas aeruginosa PAO. lesB908-containing strains are also (i) deficient in general recombination, (ii) sensitive to UV irradiation, and (iii) deficient in UV-stimulated induction of prophages. The P. aeruginosa recA-containing plasmid pKML3001 complemented each of these pleiotropic characteristics of the lesB908 mutation, supporting the hypothesis that lesB908 is an allele of the P. aeruginosa recA gene. The phenotypic effects of the lesB908 mutation may be best explained by the hypothesis that the lesB908 gene product is altered in such a way that it has lost synaptase activity but possesses intrinsic protease activity in the absence of DNA damage. The Les- phenotype is a result of the rapid destruction of newly synthesized phage repressor, resulting in lytic growth of the infecting virus. This hypothesis is consistent with the observations that increasing the number of copies of the phage repressor gene by increasing the multiplicity of infection (i.e., average number of phage genomes per cell) or by introducing the cloned phage repressor gene into a lesB908 mutant will also suppress the Les- phenotype in a phage-specific fashion.     

Selective stabilization by the bacteriophage 434 repressor of the plasmid expressing bovine growth hormone in Escherichia coli.

The maintenance of a plasmid vector-host system that selects for bacteria carrying the plasmid without the need for antibiotics is described. In this system, the bacteriophage 434 repressor gene cloned on the plasmid protects the host from lysis by a lambda imm434 cI- prophage. Cells that occasionally lose the plasmid are killed by prophage induction and therefore do not accumulate in the growing culture. The presence of the phage 434 repressor in the cells does not interfere with the process of lambda repressor inactivation and the high-level production of bovine growth hormone.     

Selective stabilization by the bacteriophage 434 repressor of the plasmid expressing bovine growth hormone in Escherichia coli

The maintenance of a plasmid vector-host system that selects for bacteria carrying the plasmid without the need for antibiotics is described. In this system, the bacteriophage 434 repressor gene cloned on the plasmid protects the host from lysis by a lambda imm434 cI- prophage. Cells that occasionally lose the plasmid are killed by prophage induction and therefore do not accumulate in the growing culture. The presence of the phage 434 repressor in the cells does not interfere with the process of lambda repressor inactivation and the high-level production of bovine growth hormone.     

Construction of a hybrid bacteriophage-plasmid recombinant DNA vector.

A phage-plasmid hybrid was constructed for use as a recombinant DNA vector, allowing the propagation of cloned EcoRI restriction endonuclease fragments of about 2 X 10(6) to 11 X 10(6) daltons. The colicin E1 plasmid replicon was fused to the left arm of a lambdagt generalized transducing phage with a thermolabile repressor, yielding a genome which could be replicated either by phage lambda functions or via the colicin E1 plasmid replicon. At the nonpermissive temperature, phage functions were derepressed and phage growth occurred lytically. Alternatively, at the permissive temperature, lambda functions were repressed and the vector replicated as a covalently closed circular plasmid. The phage-plasmid hybrid vector could be maintained at a copy number determined by the colicin E1 plasmid replicon and was also sensitive to amplification after chloramphenicol treatment. An EcoRI fragment of Escherichia coli DNA encoding genes of the arabinose operon also was inserted into the central portion of the vector.     

Improved plasmid vectors with a thermoinducible expression and temperature-regulated runaway replication

Improved expression vectors have been constructed which are derived from runaway-replication mutants of plasmid R1 and carry the strong leftward promoter (pL) of bacteriophage lambda. The activity of this promoter is controlled by a temperature-sensitive repressor, product of the phage gene cI cloned on a compatible plasmid. Heat induction leads to amplification of the plasmid copy number and at the same time turns on the promoter. At a short distance downstream from the promoter, unique EcoRI, BamHI, XbaI and HindIII sites are present. This system was used for high level expression of the T4 DNA-ligase gene; 3 h after induction the ligase amounted to about 20% of total cellular protein.     

Retrovirus-mediated insertional mutagenesis: phagemid rescue of flanking DNA by selecting plasmid ori

A method for screening recombinant lambda libraries was devised to select phage containing genomic regions containing provirus insertions of retroviruses that carry the kanamycin and G418 resistance factor neo and the origin of replication derived from pBR322 (oripBR). Such recombinants are phagemids, able to replicate as bacteriophages or as plasmids under lambda repressor control. lambda repressor was cloned into a plasmid derived from pSC101 that is compatible with pBR322-derived phagemids. A strain carrying this plasmid may be used to select phagemids derived from a single proviral insertion with 100% efficiency from complex recombinant libraries. Homologous recombination between proviral long terminal repeats was observed at a rate of 10(-4)/plaque-forming unit in recABC+ strains. Despite this frequency, intact phagemids are easily recovered as phage after temperature shift to 42 degrees C. Since oripBR itself is a selectable marker in this system, the method could be applied to recover any sequence carrying the ori sequence from pBR322.     

Specific binding affinity for DNA of the L phage (Salmonella typhimurium) in extracts of Escherichia coli

The repressor gene c _II of the L phage was cloned into plasmid pHC624 and expressed in E. coli. Two separate binding affinities for L phage DNA were identified during fractionation of protein extract of that strain. The activity that salts out in low concentration of ammonium sulphate belonged to the repressor, the activity that salts out in high concentrations of (NH₄)₂SO₄ was proved to be of E. coli origin. Binding sites for the two proteins are located on different fragments of the L phage genome.     

Analysis of forward mutations induced by N-methyl-N''-nitro-N-nitrosoguanidine in the bacteriophage P22 mnt repressor gene.

We describe the isolation and genetic characterization of N-methyl-N'-nitro-N-nitrosoguanidine (MNNG)-induced mutations in the phage P22 mnt repressor gene cloned in plasmid pBR322. Mutations in the mnt repressor gene or its operator on this plasmid, pPY98, confer a tetracycline resistance phenotype, whereas the wild-type plasmid confers tetracycline sensitivity. Cells carrying pPY98 were briefly exposed to MNNG to give 20 to 40% survival and a 50- to 100-fold increase in tetracycline-resistant cells. DNA sequence analysis showed that 29 of 30 MNNG-induced mutations were GC-to-AT transitions and one was an AT-to-GC transition. About 80% of the mutations are in three hotspots. This mutation spectrum is consistent with the proposed mechanism of mutagenic action of MNNG, which involves mispairing of an alkylated base, O6-methylguanine. The mnt gene may be a useful target for determining mutagenic specificity at the nucleotide level because forward mutations are easily isolated, the target size is small, and the DNA sequence changes of mutations can be determined rapidly.     

Obtaining of fluorescent-labeled nodule bacteria strains of wild legumes for their detection in vive and in vitro

A series of expression vectors containing genes of fluorescent proteins TurboGFP and TurboRFP under the phage T5 constitutive promoter regulation, intended for lifetime marking of nodule bacteria is created: a series of vectors based on a broad-host-range replicon BBRI, for marking strains with an expression of reporter gene from a transformed plasmid and a series of vectors based on a plasmid pRL765gfp for marking strains by introduction genes of fluorescent proteins in a bacterial chromosome. It was shown that transformation is the most preferable method of constructions transfer in nodule bacteria cells, as in the presence of mob locus in the vectors necessary for conjugation, exists the possibility of occasional plasmid mobilization and its transition from marked strain cells in other soil bacteria. With application of the created vector constructions we obtained fluorescent tagged strains of Rhizobium sp., Mesorhizobium sp., Ensifer (Sinorhizobium) sp., Bradyrhizobium sp., Phyllobacterium sp., Agrobacterium sp. Also their suitability for experiments in vivo and in vitro is shown.     

Jekyll, a family of phage-plasmid shuttle vectors

A series of shuttle vectors has been constructed, which consist of a plasmid carrying a polylinker sequence and an M13 origin integrated into a lambda vector. A short direct repeat flanking the plasmid allows plasmid excision by homologous recombination. Sequences are cloned into unique restriction sites within the plasmid, and can be recovered either in phage or plasmid form, or can be packaged further as single-stranded DNA phage. These vectors therefore combine the efficiency of phage lambda cloning and screening with the ease of handling or analysing plasmid or M13 clones.     

Requirement for a functional host cell autolytic enzyme system for lysis of Escherichia coli by bacteriophage phi X174

Escherichia coli VC30 is a temperature-sensitive mutant which is defective in autolysis. Strain VC30 lyses at 30 degrees C when treated with beta-lactam antibiotics or D-cycloserine or when deprived of diaminiopimelic acid. The same treatments inhibit growth of the mutant at 42 degrees C but do not cause lysis. Strain VC30 was used here to investigate the mechanism of host cell lysis induced by bacteriophage phi X 174. Strain VC30 was transformed with plasmid pUH12, which carries the cloned lysis gene (gene E) of phage phi X174 under the control of the lac operator-promoter, and with plasmid pMC7, which encodes the lac repressor to keep the E gene silent. Infection of strain VC30(pUH12)(pMC7) with phage phi X174 culminated in lysis at 30 degrees C. At 42 degrees C, intracellular phage development was normal, but lysis did not occur unless a temperature downshift to 30 degrees C was imposed. Similarly, induction of the cloned phi X174 gene E with isopropyl-beta-D-thiogalactoside resulted in lysis at 30 degrees C but not at 42 degrees C. Temperature downshift of the induced culture to 30 degrees C resulted in lysis even in the presence of chloramphenicol. These results indicate that host cell lysis by phage phi X174 is dependent on a functional cellular autolytic enzyme system.     

Characterization of the primary immunity region of the Escherichia coli linear plasmid prophage N15.

N15 is the only bacteriophage of Escherichia coli known to lysogenize as a linear plasmid. Clear-plaque mutations lie in at least two regions of the 46-kb genome. We have cloned, sequenced, and characterized the primary immunity region, immB. This region contains a gene, cB, whose product shows homology to lambdoid phage repressors. The cB3 mutation confers thermoinducibility on N15 lysogens, consistent with CB being the primary repressor of N15. Downstream of cB lies the locus of N15 plasmid replication. Upstream of cB lies an operon predicted to encode two products: one homologous to the late repressor of P22 (Cro), the other homologous to the late antiterminator of phi 82 (Q). The Q-like protein is essential for phage development. We show that CB protein regulates the expression of genes that flank the cB gene by binding to DNA at symmetric 16-bp sites. Three sites are clustered upstream of cB and overlap a predicted promoter of the cro and Q-like genes as well as two predicted promoters of cB itself. Two sites downstream of cB overlap a predicted promoter of a plasmid replication gene, repA, consistent with the higher copy number of the mutant, N15cB3. The leader region of repA contains terminators in both orientations and a putative promoter. The organization of these regulatory elements suggests that N15 plasmid replication is controlled not only by CB but also by an antisense RNA and by a balance between termination and antitermination.     

A broad-host-range expression vector based on the pL promoter of coliphage lambda: regulated synthesis of human interleukin 2 in Erwinia and Serratia species.

We report the construction of a broad-host-range expression vector based on an RSF1010-derived replicon. The vector carries the strong leftward promoter (pL) of coliphage lambda as well as the cI857 allele, which codes for a thermolabile repressor protein. The coding region of mature human interleukin 2, which is preceded by the ner ribosome binding site of phage Mu, was cloned downstream from the pL promoter. The plasmid was introduced into Erwinia and Serratia species by means of mobilization. Heat-inducible synthesis of interleukin 2 protein was obtained, showing that the pL promoter is functional in these genera. As in Escherichia coli, the bulk of the overproduced protein was present in an insoluble form.     

Plasmids containing many tandem copies of a synthetic lactose operator

Up to 12 tandem copies of the lactose operator sequence AATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTGG (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAA (5') have been cloned in the EcoRI site of plasmid pMB9. A 12-operator plasmid is about 8% operator by weight and represents a rich source of this DNA segment. A procedure for the rapid and convenient isolation of operator in mg quantities is presented. The lifetimes of complexes formed between repressor and oligo-operator plasmids increased with increasing numbers of tandem operators per plasmid. Evidence is presented indicating that only one tetrameric repressor molecule binds strongly to a segment of four (or fewer) tandem operators, but that two repressor molecules can be accommodated on segments containing at least six tandem operators.