The 3''-terminal nucleotide sequences of adenovirus types 2 and 5 DNA.

Short nucleotide sequences at the 3'-termini of adenovirus types 2 and 5 DNA have been determined using T4 DNA polymerase as described by P. T. Englund (1972). The terminal sequences of both serotypes appear to be completely identical. Both molecular ends of type 2 as well as of type 5 DNA terminate with the sequence ...pCpC...pGpApTpG3', consistent with the presence of an inverted terminal repetition in adenovirus DNA.     

The nucleotide sequence of the inverted terminal repetition of the tree shrew adenovirus DNA

The termini of the tupaia (tree shrew) adenovirus (TAV) DNA have been sequenced. The inverted terminal repetitions (ITR) are 166 bp long containing the A + T-rich, highly conserved sequence present in all adenovirus DNAs so far analysed. An unusual feature within the TAV ITR is the presence of four sets of a conserved sequence TGACCG which occur at or near the ends of many adenovirus ITR.     

Mutational mapping of a cloned adenovirus origin

We have developed a standardized, quantitative assay to study the function of a cloned adenovirus origin. We have shown that the adenovirus origin is located within the first 20 bp of the adenovirus inverted terminal repetition (ITR), a region containing a sequence conserved among human, simian, murine, and avian adenoviruses. Deletions removing or penetrating from either direction into the conserved sequence inactivated the cloned adenovirus origin. A point mutation within the conserved sequence impaired the adenovirus origin, but point mutations outside the conserved sequence had no effect. These results strongly suggest that the conserved sequence within the first 20 bp of the ITR alone constitutes the adenovirus origin (ori) signal.     

Encapsidation of adenovirus 16 DNA is directed by a small DNA sequence at the left end of the genome

We have identified a DNA sequence in adenovirus type 16 which contains recognition signals for encapsidation of the viral DNA. The sequence acts in cis to direct the encapsidation of DNA from the end of the viral genome where it is located. The sequence is normally contained in the first 390–400 bp of the left end of the genome. The location was determined by analyzing a series of spontaneous mutants of Ad16 which carried reduplications of 200 to >500 bp of left end sequences at the right end of the genome, thus giving rise to enlarged inverted terminal repetitions (ITR). In plaque-purified (PP) Ad16 prototype virus the subgenomic DNA found in incomplete virus particles exclusively represents left end sequences. When the reduplication mutants were analyzed, we found that a reduplication of about 390 bp enabled subgenomic DNA molecules containing the right end to be encapsidated into incomplete particles as well. A reduplication of about 290 bp, however, did not allow subgenomic DNA containing the right end to be encapsidated. The difference in encapsidation described could not be attributed to an asymetric DNA replication in the mutants, since subgenomic DNA originating from both ends of the genome was produced in equal amounts in the infected cells. We conclude that an essential part of the encapsidation sequence must be located between 290 and 390 bp from the left end of the Ad16 genome.     

A linear DNA plasmid from Streptomyces rochei with an inverted terminal repetition of 614 base pairs.

The terminal structure of a linear plasmid pSLA2 , which was isolated from Streptomyces rochei , was analysed. The 5' ends of pSLA2 DNA were blocked by the association of a protein probably covalently bonded with the DNA. This block is removed by alkali treatment and blunt ends with 5'-phosphate and 3'-hydroxy termini were released. The two terminal fragments of pSLA2 were cloned and the nucleotide sequence was determined. An inverted terminal repetition of 614 bp was found along with the presence of further interrupted homologous sequences beyond this area up to 800 bp. These are the first inverted terminal repeat sequences found in microbial linear plasmids.     

Nucleotide sequence at the inverted terminal repetition of adenovirus type 2 DNA.

We have determined the nucleotide sequence of the inverted repetition present at the termini of adenovirus type 2 DNA. The terminal repetition is 103 nucleotides long. It is exactly identical in sequence at both termini. Adenovirus types 2 and 5 molecules share a perfect homology within this region.     

Tandem repeats within the inverted terminal repetition of vaccinia virus DNA

A tandemly repeated sequence within the genome of vaccinia virus is cut to fragments of approximately 70 bp by Hinf I, Taq I or Mbo II. The 70 bp repetition was localized within the much larger (10,300 bp) inverted terminal repetition by restriction analysis of cloned DNA fragments and by hybridization of the purified 70 bp repeat to vaccinia virus DNA restriction fragments. The molar abundance of the 70 bp fragment corresponds to a 30 fold repetition at each end of the genome. The repeating restriction endonuclease sites were mapped by agarose gel electrophoresis of partial Hinf I digests of the terminally labeled cloned DNA fragment. The first of 13 repetitive Hinf I sites occurred approximately 150 bp from the end of the cloned DNA. After an intervening sequence of approximately 435 bp, a second series of 17 repetitive Hinf I sites occurred. The DNA between the two blocks of repetitions has a unique sequence containing single Dde I, Alu I and Sau 3A sites. Tandem repeats within the inverted terminal repetition could serve to accelerate self-annealing of single strands of DNA to form circular structures during replication.     

Nucleotide sequence required for resolution of the concatemer junction of vaccinia virus DNA.

The mature form of the vaccinia virus genome consists of a linear, 185,000-base-pair (bp) DNA molecule with a 10,000-bp inverted terminal repetition and incompletely base-paired 104-nucleotide hairpin loops connecting the two strands at each end. In concatemeric forms of intracellular vaccinia virus DNA, the inverted terminal repetitions of adjacent genomes form an imperfect palindrome. The apex of this palindrome corresponds in sequence to the double-stranded form of the hairpin loop. Circular plasmids containing palindromic concatemer junction fragments of 250 bp or longer are converted into linear minichromosomes with hairpin ends when they are transfected into vaccinia virus-infected cells, providing a model system with which to study the resolution process. To distinguish between sequence-specific and structural requirements for resolution, plasmids with symmetrical insertions, deletions, and oligonucleotide-directed mutations within the concatemer junction were constructed. A sequence (ATTTAGTGTCTAGAAAAAAA) located on both sides of the apex segment was found to be critical for resolution. Resolution was more efficient when additional nucleotides, TGTG, followed the run of A residues. Both the location and sequence of the proposed resolution signal are highly conserved among poxviruses.     

MDBK nuclear factor-binding site of various serotypes of adenovirus DNA

A fraction with the ability to bind the terminal fragment of equine adenovirus (EAd) DNA was prepared from MDBK cell nuclei. The fraction (MDBK nuclear factor) bound to the terminal fragment of all human and animal adenovirus DNAs examined except avian adenovirus EDS-76. However, the terminal fragments of two animal adenoviruses, EAd and bovine adenovirus type 3 (BAd3), showed higher affinity for the nuclear factor than the others. The MDBK nuclear factor-binding site determined by footprinting analysis was the sequence located between nucleotides 22 and 46 in EAd, between 36 and 53 in canine adenovirus type 2, and between 20 and 46 in BAd3, counting from the terminus. The respective binding site contained a sequence resembling the consensus sequence. The binding site of Ad4 DNA was not within the inverted terminal repetition, but was located at least 550 base pairs apart from the terminus.     

Adenovirus DNA replication in vitro: a protein linked to the 5' end of nascent DNA strands.

Soluble nuclear extracts prepared from adenovirus-infected HeLa cells supported adenovirus DNA replication with exogenous DNA-protein complex as template, but protease-treated, phenol-extracted DNA was less active. Replication was enhanced when creatine phosphate and creatine phosphokinase were included in the reaction mixture, rendering the reaction independent of exogenous ATP. Genomic-length, newly synthesized DNA strands were first observed 30 min after initiation of replication and continued to increase in amount for at least 4 h. Thus, the rate of replication is consistent with previous estimates of the rate of replication in vivo. Nascent DNA strands bound to benzoylated, naphthoylated DEAE-cellulose due to their association with protein. The 5' termini of nascent DNA strands were resistant to the 5'- to 3'-specific T7 exonuclease, and the 3' termini of nascent strands were sensitive to the 3'- to 5'-specific exonuclease III. These results suggest that a protein becomes covalently linked to the 5' termini of nascent DNA strands replicated in vitro. Nuclear extracts prepared from adenovirus type 2-infected cells also supported replication of DNA-protein complex prepared from the unrelated type 7 adenovirus. The limited sequence homology between these two viruses at the origin of replication further defines recognition sequences at the origin. These results are discussed in terms of a model for adenovirus DNA replication in which the terminal protein and sequences within the inverted terminal repetition are involved in the formation of an initiation complex that is able to prime DNA replication.     

The complete nucleotide sequence of the left very early region of Escherichia coli bacteriophage PRD1 coding for the terminal protein and the DNA polymerase

DNA molecules replicating in a linear form have been found in certain viruses and plasmids of both prokaryotic and eukaryotic origin. Characteristic of this type of molecules are the proteins covalently linked to their 5' ends and inverted terminal nucleotide sequences. The molecules replicate via a protein-priming mechanism, where participants include terminal protein and a specific polymerase. We report here the nucleotide sequence of the left very early region of Escherichia coli bacteriophage PRD1. This region codes for the terminal protein and the phage DNA polymerase. The predicted amino acid sequence of the terminal protein does not share homology with those of other known terminal proteins. The PRD1 DNA polymerase shows four regions of extensive homology to that of Bacillus subtilis phage phi 29. One of these conserved regions is also found in several animal virus DNA polymerases.     

Inverted terminal repetitions of the two linear DNA associated with the killer character of the yeast Kluyveromyces lactis

The killer character of some Kluyveromyces lactis strains is associated with the presence of two linear double-stranded DNA, pGKl-1 (or k1) and pGKl-2 (or k2). Nucleotide sequencing has revealed that each DNA has inverted terminal repetitions of about 200 base-pairs whose 5' ends seem to be blocked. The repetitions of the two DNA do not share extensive sequence homology. The role of these repetitions in the replication of killer DNA is discussed.     

Nucleotide sequence and properties of the cohesive DNA termini from bacteriophage HP1c1 of Haemophilus influenzae Rd

The termini of the mature DNA of phage HP1c1 of Haemophilus influenzae Rd have been characterized by DNA ligation, nucleotide sequencing, and deoxynucleotide incorporation experiments. A hybrid plasmid containing the joined phage termini (the cos site) inserted into pBR322 has been constructed. The phage DNA has cohesive termini composed of complementary 5' single-stranded extensions which are seven residues long. The left cohesive terminal extension consists only of pyrimidines and the right only of purines. When the ends of the phage are joined, the terminal sequences constitute the central 7 bp of an 11 bp sequence containing only purines on one strand and pyrimidines on the other strand. This oligopyrimidine/oligopurine sequence does not possess rotational symmetry. A 10-bp sequence and its inverted repeat are located approx. 20 bp to the left and right of the fused ends.     

Physical organization of subgroup B human adenovirus genomes.

Cleavage sites of nine bacterial restriction endonucleases were mapped in the DNA of adenovirus type 3 (Ad3) and Ad7, representative serotypes of the "weakly oncogenic" subgroup B human adenoviruses. Of 94 sites mapped, 82 were common to both serotypes, in accord with the high overall sequence homology of DNA among members of the same subgroups. Of the sites in Ad3 and Ad7 DNA, fewer than 20% corresponded to mapped restriction sites in the DNA of Ad2 or Ad5. The latter serotypes represent the "nononcogenic" subgroup C, having only 10 to 20% overall sequence homology with the DNA of subgroup B adenoviruses. Hybridization mapping of viral mRNA from Ad7-infected cells resulted in a complex physical map that was nearly identical to the map of early and late gene clusters in Ad2 DNA. Thus the DNA sequences of human adenoviruses of subgroups B and C have significantly diverged in the course of viral evolution, but the complex organization of the adenovirus genome has been rigidly conserved.     

The nucleotide sequence at the termini of adenovirus type 5 DNA.

The sequences of the first 194 base pairs at both termini of adenovirus type 5 (Ad5) DNA have been determined, using the chemical degradation technique developed by Maxam and Gilbert (Proc. Nat. Acad. Sci. USA 74 (1977), pp. 560-564). The nucleotide sequences 1-75 were confirmed by analysis of labeled RNA transcribed from the terminal HhaI fragments in vitro. The sequence data show that Ad5 DNA has a perfect inverted terminal repetition of 103 base pairs long.     

The origin of adenovirus DNA replication: minimal DNA sequence requirement in vivo.

Adenovirus mini-chromosomes which contain two cloned, inverted adenovirus termini replicate in vivo when supplied with non-defective adenovirus as a helper. This system has been used to define the minimum cis acting DNA sequences required for adenovirus DNA replication in vivo. Deletions into each end of the adenovirus inverted terminal repeat (ITR) were generated with Bal31 exonuclease and the resulting molecules constructed into plasmids which contained two inverted copies of the deleted ITR separated by the bacterial neomycin phosphotransferase gene. To determine the effect of the deletion in vivo plasmids cleaved to expose the adenovirus termini were co-transfected with adenovirus type 2 DNA into tissue culture cells. The replicative ability of the molecules bearing adenovirus termini was assayed by Southern blotting of extracted DNA which had been treated with DpnI, a restriction enzyme which cleaves only methylated and therefore unreplicated, input DNA. Molecules containing the terminal 45 bp of the viral genome were fully active whereas molecules containing only 36 bp were in-active in this assay. Therefore sequences required for DNA replication are contained entirely within the terminal 45 bp of the viral genome. Thus, both the previously described highly conserved region (nucleotides 9-18) and the binding site for the cellular nuclear factor I (nucleotides 19-48) are essential for adenovirus DNA replication in vivo.     

DNA sequence analysis of Tn10 insertions: origin and role of 9 bp flanking repetitions during Tn10 translocation.

The sequences of insertions of the translocatable tetracycline-resistance element Tn10 into the repressor (cl) gene of bacteriophage lambda have been analyzed. Each insertion contains the same discrete set of Tn10 sequences flanked by a direct repetition of a 9 bp cl-gene sequence. The flanking repititions are generated by duplication of information present only in the target DNA molecule rather than by a Campbell-type recombination event between one 9 bp sequence on the target DNA and a second one provided on the incoming element. The repetitions do not contain genetic or structural information important for translocation. A genetically constructed Tn10 insertion which lacks flanking repetitions is fully functional in translocation to a new position. Tn10 insertions cluster at preferred positions along a target DNA (Kleckner et al., 1979). Sequence analysis shows that four independently isolated cl::Tn10 insertions occur at identical positions in the cl gene. We speculate that homology between Tn10 and its target, at some distance from the site of the actual recombination event, could be relevant to the preference of Tn10 for particular insertion sites.     

Nucleotide sequence analysis of the linked left and right hand terminal regions of adenovirus type 5 DNA present in the transformed rat cell line 5RK20.

A peculiar phenomenon is observed in several adenovirus type 2 or 5 (Ad2 or Ad5) transformed cell lines: the right hand and left hand terminal regions of the viral genome present in the viral DNA insertions of these cell lines are found to be linked together. A large part of the viral DNA insertion present in the Ad5 transformed rat cell line 5RK20 has been cloned in the lambda vector Charon21A, including the segment containing the linked terminal regions. Sequence analysis of the linkage region showed a perfect homology with the Ad5 DNA sequence and a direct linkage of basepair (bp) 63 of the left hand end of the viral genome to bp 108 of the right hand end. No cellular or rearranged viral sequences were present. Our findings suggest that the joining of viral sequences into the cellular genome.     

Analysis of separate isolates of Bordetella pertussis repeated DNA sequences

Two independent isolates of a Bordetella pertussis repeated DNA unit were sequenced and shown to be an insertion sequence element with five nucleotide differences between the two copies. The sequences were 1053 bp in length with near-perfect terminal inverted repeats of 28 bp, had three open reading frames, and were each flanked by short direct repeats. The two insertion sequences showed considerable homology to two other B. pertussis repeated DNA sequences reported recently: IS481 and a 530 bp repeated DNA unit. The B. pertussis insertion sequence would appear to comprise a group of closely related sequences differing mainly in flanking direct repeats and the terminal inverted repeats. The two isolates reported here, which were from the adenylate cyclase and agglutinogen 2 regions of the genome, were numbered IS48lvl and IS48lv2 respectively.