The four repeat Giardia lamblia telomere forms tetramolecular G-quadruplex with antiparallel topology

Abstract

Guanine rich DNA sequences of regulatory genomic regions form secondary structures known as G-quadruplexes usually stabilized by tetrads of Hoogsteen hydrogen bonded guanines. The in vivo existence of G-quadruplexes ascertains their biological roles. Human telomeric repeats are the most studied G-rich sequences. The four repeat Giardia telomeric sequence (TAGGG)₄ differs from its human counterpart (TTAGGG)_4, by deletion of one T at the G-tract intervening site of each repeat. We show here that whilst the two repeat Giardia telomeric sequence (TAGGG)₂ forms parallel and antiparallel quadruplexes with tetramolecular topology exclusively, the four repeat version (TAGGG)₄ forms a tetramolecular (antiparallel) and unimolecular (parallel) quadruplexes in Na⁺. The tetramolecular (antiparallel) G-quadruplex formed by four repeats of Giardia telomeric sequence is stabilized by the additional Watson-Crick bonding between its intervening TA bases aligned in antiparallel fashion. Four stranded antiparallel quadruplex for four repeats of any telomeric sequence have not been characterized till date. We hypothesize that telomeric association in antiparallel fashion, (via G-overhangs to form tetramolecular quadruplex) could be a biologically relevant molecular event. Further, coexistence of Hoogsteen as well as Watson-Crick base pairing might give insight for recognition of conformationally diverse DNA structures by ligands.

Communicated by Ramaswamy H. Sarma     

Effect of a modified thymine on the structure and stability of [d(TGGGT)]4 quadruplex

Telomeric guanine-rich sequence can adopt quadruplex structures that are important for their biological role in chromosomal stabilisation. G quartets are characterised by the cyclic hydrogen bonding of four guanine bases in a coplanar arrangement and their stability is ion-dependent. In this work we compare the stability of [d(TGGGT)]₄ and [d(T*GGGT)]₄ quadruplexes. The last one contains a modified thymine, where the hydroxyl group substitutes one hydrogen atom of the methyl group of the thymine in the [d(TGGGT)]₄ sequence. We used a combination of spectroscopic, calorimetric and computational techniques to characterise the G-quadruplex formation. NMR and CD spectra of [d(T*GGGT)]₄ were characteristic of parallel-stranded, tetramolecular quadruplex. CD and DSC melting experiments reveal that [d(T*GGGT)]₄ is less stable that unmodified quadruplex. Molecular models suggest possible explanation for the observed behaviour.     

Kinetics of double-chain reversals bridging contiguous quartets in tetramolecular quadruplexes

Repetitive 5'GGXGG DNA segments abound in, or near, regulatory regions of the genome and may form unusual structures called G-quadruplexes. Using NMR spectroscopy, we demonstrate that a family of 5'GCGGXGGY sequences adopts a folding topology containing double-chain reversals. The topology is composed of two bistranded quadruplex monomeric units linked by formation of G:C:G:C tetrads. We provide a complete thermodynamic and kinetic analysis of 13 different sequences using absorbance spectroscopy and DSC, and compare their kinetics with a canonical tetrameric parallel-stranded quadruplex formed by TG4T. We demonstrate large differences (up to 10(5)-fold) in the association constants of these quadruplexes depending on primary sequence; the fastest samples exhibiting association rate equal or higher than the canonical TG4T quadruplex. In contrast, all sequences studied here unfold at a lower temperature than this quadruplex. Some sequences have thermodynamic stability comparable to the canonical TG4T tetramolecular quadruplex, but with faster association and dissociation. Sequence effects on the dissociation processes are discussed in light of structural data.     

Biophysical properties of quadruple helices of modified human telomeric DNA

Telomeric DNA of a variety of vertebrates including humans contains the tandem repeat d(TTAGGG)n. The guanine rich strand can fold into four-stranded G-quadruplex structures, which have recently become attractive for biomedical research. Indeed, the aptamers based on the quadruplex motif may prove useful as tools aimed at binding and inhibiting particular proteins, catalyzing various biochemical reactions, or even serving as pharmaceutically active agents. The incorporation of modified bases into oligonucleotides can have profound effects on their folding and may produce useful changes in physical and biological properties of the resulting DNA fragments. In this work, the adenines of the human telomeric repeat oligonucleotide d(TAGGGT) and d(AGGGT) were substituted by 2'-deoxy-8-(propyn-1-yl)adenosine (A-->APr) or by 8-bromodeoxyadenosine (A-->ABr). The biophysical properties of the resulting quadruplex structures were compared with the unmodified quadruplexes. NMR and CD spectra of the studied sequences were characteristic of parallel-stranded, tetramolecular quadruplexes. The analysis of the equilibrium melting curves reveals that the modifications stabilize the quadruplex structure. The results are useful when considering the design of novel aptameric nucleic acids with diverse molecular recognition capabilities that would not be present using native RNA/DNA sequences.     

Guanines are a quartet's best friend: impact of base substitutions on the kinetics and stability of tetramolecular quadruplexes

Parallel tetramolecular quadruplexes may be formed with short oligodeoxynucleotides bearing a block of three or more guanines. We analyze the properties of sequence variants of parallel quadruplexes in which each guanine of the central block was systematically substituted with a different base. Twelve types of substitutions were assessed in more than 100 different sequences. We conducted a comparative kinetic analysis of all tetramers. Electrospray mass spectrometry was used to count the number of inner cations, which is an indicator of the number of effective tetrads. In general, the presence of a single substitution has a strong deleterious impact on quadruplex stability, resulting in reduced quadruplex lifetime/thermal stability and in decreased association rate constants. We demonstrate extremely large differences in the association rate constants of these quadruplexes depending on modification position and type. These results demonstrate that most guanine substitutions are deleterious to tetramolecular quadruplex structure. Despite the presence of well-defined non-guanine base quartets in a number of NMR and X-ray structures, our data suggest that most non-guanine quartets do not participate favorably in structural stability, and that these quartets are formed only by virtue of the docking platform provided by neighboring G-quartets. Two notable exceptions were found with 8-bromo-guanine (X) and 6-methyl-isoxanthopterin (P) substitutions, which accelerate quadruplex formation by a factor of 10 when present at the 5' end. The thermodynamic and kinetic data compiled here are highly valuable for the design of DNA quadruplex assemblies with tunable association/dissociation properties.     

Kinetically governed polymorphism of d(G₄T₄G₃) quadruplexes in K+ solutions

It has been generally recognized that understanding the molecular basis of some important cellular processes is hampered by the lack of knowledge of forces that drive spontaneous formation/disruption of G-quadruplex structures in guanine-rich DNA sequences. According to numerous biophysical and structural studies G-quadruplexes may occur in the presence of K(+) and Na(+) ions as polymorphic structures formed in kinetically governed processes. The reported kinetic models suggested to describe this polymorphism should be considered inappropriate since, as a rule, they include bimolecular single-step associations characterized by negative activation energies. In contrast, our approach in studying polymorphic behavior of G-quadruplexes is based on model mechanisms that involve only elementary folding/unfolding transitions and structural conversion steps that are characterized by positive activation energies. Here, we are investigating a complex polymorphism of d(G(4)T(4)G(3)) quadruplexes in K(+) solutions. On the basis of DSC, circular dichroism and UV spectroscopy and polyacrylamide gel electrophoresis experiments we propose a kinetic model that successfully describes the observed thermally induced conformational transitions of d(G(4)T(4)G(3)) quadruplexes in terms of single-step reactions that involve besides single strands also one tetramolecular and three bimolecular quadruplex structures.     

Effects of abasic sites on structural,thermodynamic and kinetic properties of quadruplex structures

Abasic sites represent the most frequent lesion in DNA. Since several events generating abasic sites concern guanines, this damage is particularly important in quadruplex forming G-rich sequences, many of which are believed to be involved in several biological roles. However, the effects of abasic sites in sequences forming quadruplexes have been poorly studied. Here, we investigated the effects of abasic site mimics on structural, thermodynamic and kinetic properties of parallel quadruplexes. Investigation concerned five oligodeoxynucleotides based on the sequence d(TGGGGGT), in which all guanines have been replaced, one at a time, by an abasic site mimic (dS). All sequences preserve their ability to form quadruplexes; however, both spectroscopic and kinetic experiments point to sequence-dependent different effects on the structural flexibility and stability. Sequences d(TSGGGGT) and d(TGGGGST) form quite stable quadruplexes; however, for the other sequences, the introduction of the dS in proximity of the 3′-end decreases the stability more considerably than the 5′-end. Noteworthy, sequence d(TGSGGGT) forms a quadruplex where dS does not hamper the stacking between the G-tetrads adjacent to it. These results strongly argue for the central role of apurinic/apyrimidinic site damages and they encourage the production of further studies to better delineate the consequences of their presence in the biological relevant regions of the genome.     

G4 resolvase 1 binds both DNA and RNA tetramolecular quadruplex with high affinity and is the major source of tetramolecular quadruplex G4-DNA and G4-RNA resolving activity in HeLa cell lysates

Quadruplex structures that result from stacking of guanine quartets in nucleic acids possess such thermodynamic stability that their resolution in vivo is likely to require specific recognition by specialized enzymes. We previously identified the major tetramolecular quadruplex DNA resolving activity in HeLa cell lysates as the gene product of DHX36 (Vaughn, J. P., Creacy, S. D., Routh, E. D., Joyner-Butt, C., Jenkins, G. S., Pauli, S., Nagamine, Y., and Akman, S. A. (2005) J. Biol Chem. 280, 38117-38120), naming the enzyme G4 Resolvase 1 (G4R1). G4R1 is also known as RHAU, an RNA helicase associated with the AU-rich sequence of mRNAs. We now show that G4R1/RHAU binds to and resolves tetramolecular RNA quadruplex as well as tetramolecular DNA quadruplex structures. The apparent K(d) values of G4R1/RHAU for tetramolecular RNA quadruplex and tetramolecular DNA quadruplex were exceptionally low: 39 +/- 6 and 77 +/- 6 Pm, respectively, as measured by gel mobility shift assay. In competition studies tetramolecular RNA quadruplex structures inhibited tetramolecular DNA quadruplex structure resolution by G4R1/RHAU more efficiently than tetramolecular DNA quadruplex structures inhibited tetramolecular RNA quadruplex structure resolution. Down-regulation of G4R1/RHAU in HeLa T-REx cells by doxycycline-inducible short hairpin RNA caused an 8-fold loss of RNA and DNA tetramolecular quadruplex resolution, consistent with G4R1/RHAU representing the major tetramolecular quadruplex helicase activity for both RNA and DNA structures in HeLa cells. This study demonstrates for the first time the RNA quadruplex resolving enzymatic activity associated with G4R1/RHAU and its exceptional binding affinity, suggesting a potential novel role for G4R1/RHAU in targeting in vivo RNA quadruplex structures.     

The insertion of two 8-methyl-2'-deoxyguanosine residues in tetramolecular quadruplex structures: trying to orientate the strands

In this article, we report a structural study, based on NMR and CD spectroscopies, and molecular modelling of all possible d(TG(3)T) and d(TG(4)T) analogues containing two 8-methyl-2'-deoxyguanosine residues (M). Particularly, the potential ability of these modified residues to orientate the strands and then to affect the folding topology of tetramolecular quadruplex structures has been investigated. Oligodeoxynucleotides (ODNs) TMMGT (T12) and TMMGGT (F12) form parallel tetramolecular quadruplexes, characterized by an all-syn M-tetrad at the 5'-side stacked to all-anti M- and G-tetrads. ODNs TMGMT (T13) and TMGGMT (F14) form parallel tetramolecular quadruplexes, in which an all-anti G core is sandwiched between two all-syn M-tetrads at the 5'- and the 3'-side. Notably, the quadruplex formed by T13 corresponds to an unprecedented structure in which the syn residues exceed in number the anti ones. Conversely, ODN TGMGMT (F24) adopts a parallel arrangement in which all-anti G-tetrads alternate with all-syn M-tetrads. Most importantly, all data strongly suggest that ODN TMGMGT (F13) forms an unprecedented anti-parallel tetramolecular quadruplex in which G and M residues adopt anti and syn glycosidic conformations, respectively. This article opens up new understandings and perspectives about the intricate relationship between the quadruplex strands orientation and the glycosidic conformation of the residues.     

A comparison of DNA and RNA quadruplex structures and stabilities

Guanosine-rich sequences are prone to fold into four-stranded nucleic acid structures. Such quadruplex sequences have long been suspected to play important roles in regulatory processes within cells. Although DNA quadruplexes have been studied in great detail, four-stranded structures made up from RNA have received only minor attention, although it is known that RNA is able to form stable quadruplexes as well.Here, we compare quadruplex structures and stabilities of a variety of DNA and RNA sequences. We focus on well established DNA sequences and determine the topologies and stabilities of the corresponding RNA sequences by CD spectroscopy and CD thermal melting experiments. We find that the RNA sequences exclusively fold into the all-parallel conformation in contrast to the diverse topologies adopted by DNA quadruplexes. The thermal stabilities of the RNA structures rival those of the corresponding DNA sequences, often displaying enhanced stabilities compared to their DNA counterparts. Especially thermodynamically less stable sequences show a strong preference for potassium, with the RNA quadruplexes exhibiting much higher stabilities than the corresponding DNAs. The latter finding suggests that quadruplexes formed at critical positions in mRNAs might perturb gene expression to a larger extend than previously anticipated.     

Single strand targeted triplex-formation. Destabilization of guanine quadruplex structures by foldback triplex-forming oligonucleotides.

Oligonucleotides that can hybridize to single-stranded complementary polypurine nucleic acid targets by Watson-Crick base pairing as well as by Hoogsteen base pairing, referred to here as foldback triplex-forming oligonucleotides (FTFOs), have been designed. These oligonucleotides hybridize with target nucleic acid sequences with greater affinity than antisense oligonucleotides, which hybridize to the target sequence only by Watson-Crick hydrogen bonding [Kandimalla, E. R. and Agrawal, S. Gene(1994) 149, 115-121 and references cited therein]. FTFOs have been studied for their ability to destabilize quadruplexes formation by RNA or DNA target sequences. The influence of various DNA/RNA compositions of FTFOs on their ability to destabilize RNA and DNA quadruplexes has been examined. The ability of the FTFOs to destabilize quadruplex structures is related to the structurally and thermodynamically stable foldback triplex formed between the FTFO and its target sequence. Antisense oligonucleotides (DNA or RNA) that can form only a Watson-Crick double helix with the target sequence are unable to destabilize quadruplex structures of RNA and DNA target sequences and are therefore limited in their repertoire of target sequences. The quadruplex destabilization ability of FTFOs is dependent on the nature of the cation present in solution. The RNA quadruplex destabilization ability of FTFOs is -20% higher in the presence of sodium ion than potassium ion. The use of FTFOs, which can destabilize quadruplex structure, opens up new areas for development of oligonucleotide-based therapeutics, specifically, targeting guanine-rich sequences that exist at the ends of pro- and eukaryotic chromosomes and dimerization regions of retroviral RNA.     

Folding Topology of a Bimolecular DNA Quadruplex Containing a Stable Mini-hairpin Motif within the Diagonal Loop

We describe the NMR structural characterisation of a bimolecular anti-parallel DNA quadruplex d(G₃ACGTAGTG₃)₂ containing an autonomously stable mini-hairpin motif inserted within the diagonal loop. A folding topology is identified that is different from that observed for the analogous d(G₃T₄G₃)₂ dimer with the two structures differing in the relative orientation of the diagonal loops. This appears to reflect specific base stacking interactions at the quadruplex-duplex interface that are not present in the structure with the T₄-loop sequence. A truncated version of the bimolecular quadruplex d(G₂ACGTAGTG₂)₂, with only two core G-tetrads, is less stable and forms a heterogeneous mixture of three 2-fold symmetric quadruplexes with different loop arrangements. We demonstrate that the nature of the loop sequence, its ability to form autonomously stable structure, the relative stabilities of the hairpin loop and core quadruplex, and the ability to form favourable stacking interactions between these two motifs are important factors in controlling DNA G-quadruplex topology.     

Substitution of adenine for guanine in the quadruplex-forming human telomere DNA sequence G(3)(T(2)AG(3))(3)

We have studied the formation and structural properties of quadruplexes of the human telomeric DNA sequence G(3)(T(2)AG(3))(3) and related sequences in which each guanine base was replaced by an adenine base. None of these single base substitutions hindered the formation of antiparallel quadruplexes, as shown by circular dichroism, gel electrophoresis, and UV thermal stability measurements in NaCl solutions. Effect of substitution did differ, however, depending on the position of the substituted base. The A-for-G substitution in the middle quartet of the antiparallel basket scaffold led to the most distorted and least stable structures and these sequences preferred to form bimolecular quadruplexes. Unlike G(3)(T(2)AG(3))(3), no structural transitions were observed for the A-containing analogs of G(3)(T(2)AG(3))(3) when sodium ions were replaced by potassium ions. The basic quadruplex topology remained the same for all sequences studied in both salts. As in vivo misincorporation of A for a G in the telomeric sequence is possible and potassium is a physiological salt, these findings may have biological relevance.     

Heat capacity changes associated with guanine quadruplex formation: an isothermal titration calorimetry study

This study addresses the temperature dependence of the enthalpy of formation for several unimolecular quadruplexes in the presence of excess monovalent salt. We examined a series of biologically significant guanine-rich DNA sequences: thrombin binding aptamer (TBA) (d(G(2)T(2)G(2)TGTG(2)T(2)G(2)), PS2.M, a catalytically active aptamer (d(GTG(3)TAG(3)CG(3)T(2)G(2))), and the human telomere repeat (HT) (d(AG(3)(T(2)AG(3))(3))). Using CD spectra and UV melting, we confirmed the presence of quadruplex structures and established the temperature range in which quadruplex conformation is stable. We then performed ITC experiments, adding DNA to a solution containing excess NaCl or KCl. In this approach, only several additions are made, and only the enthalpy of quadruplex formation is measured. This measurement was repeated at different temperatures to determine the temperature dependence of the enthalpy change accompanying quadruplex formation. To control for the effect of nonspecific salt interactions during DNA folding, we repeated the experiment by replacing the quadruplex-forming sequences with a similar but nonfolding sequence. Dilution enthalpies were also subtracted to obtain the final enthalpy value involving only the quadruplex folding process. For all sequences studied, quadruplex formation was exothermic but with an increasing magnitude with increasing temperature. These results are discussed in terms of the change in heat capacity associated with quadruplex formation.     

Stability of intramolecular DNA quadruplexes: comparison with DNA duplexes

We have determined the stability of intramolecular quadruplexes that are formed by a variety of G-rich sequences, using oligonucleotides containing appropriately placed fluorophores and quenchers. The stability of these quadruplexes is compared with that of the DNA duplexes that are formed on addition of complementary C-rich oligonucleotides. We find that the linkers joining the G-tracts are not essential for folding and can be replaced with nonnucleosidic moieties, though their sequence composition profoundly affects quadruplex stability. Although the human telomere repeat sequence d[G(3)(TTAG(3))(3)] folds into a quadruplex structure, this forms a duplex in the presence of the complementary C-rich strand at physiological conditions. The Tetrahymena sequence d[G(4)(T(2)G(4))(3)], the sequence d[G(3)(T(2)G(3))(3)], and sequences related to regions of the c-myc promoter d(G(4)AG(4)T)(2) and d(G(4)AG(3)T)(2) preferentially adopt the quadruplex form in potassium-containing buffers, even in the presence of a 50-fold excess of their complementary C-rich strands, though the duplex predominates in the presence of sodium. The HIV integrase inhibitor d[G(3)(TG(3))(3)] forms an extremely stable quadruplex which is not affected by addition of a 50-fold excess of the complementary C-rich strand in both potassium- and sodium-containing buffers. Replacing the TTA loops of the human telomeric repeat with AAA causes a large decrease in quadruplex stability, though a sequence with AAA in the first loop and TTT in the second and third loops is slightly more stable.     

NMR solution structures of LNA (locked nucleic acid) modified quadruplexes

We have determined the NMR solution structures of the quadruplexes formed by d(TGLGLT) and d(TL₄T), where L denotes LNA (locked nucleic acid) modified G-residues. Both structures are tetrameric, parallel and right-handed and the native global fold of the corresponding DNA quadruplex is retained upon introduction of the LNA nucleotides. However, local structural alterations are observed owing to the locked LNA sugars. In particular, a distinct change in the sugar–phosphate backbone is observed at the G2pL3 and L2pL3 base steps and sequence dependent changes in the twist between tetrads are also seen. Both the LNA modified quadruplexes have raised thermostability as compared to the DNA quadruplex. The quadruplex-forming capability of d(TGLGLT) is of particular interest as it expands the design flexibility for stable parallel LNA quadruplexes and shows that LNA nucleotides can be mixed with DNA or other modified nucleic acids. As such, LNA-based quadruplexes can be decorated by a variety of chemical modifications. Such LNA quadruplex scaffolds might find applications in the developing field of nanobiotechnology.     

Effects of 8-methylguanine on structure, stability and kinetics of formation of tetramolecular quadruplexes

Tetramolecular G-quadruplexes result from the association of four guanine-rich strands. Modification of the backbone strand or the guanine bases of the oligonucleotide may improve stability or introduce new functionalities. In this regard, the 8 position of a guanosine is particularly suitable for introduction of modifications since as it is positioned in the groove of the quadruplex structure. Modifications at this position should not interfere with structural assembly as would changes at Watson-Crick and Hoogsteen sites. In this study, we investigated the effect of an 8-methyl-2′-deoxyguanosine residue (M) on the structure and stability of tetramolecular parallel G-quadruplexes. In some cases, the presence of this residue resulted in the formation of unusual quadruplex structures containing all-syn tetrads. Furthermore, the modified nucleoside M at the 5′-end of the sequence accelerated quadruplex formation by 15-fold or more relative to the unmodified oligonucleotide, which makes this nucleobase an attractive replacement for guanine in the context of tetramolecular parallel quadruplexes.     

Human werner syndrome DNA helicase unwinds tetrahelical structures of the fragile X syndrome repeat sequence d(CGG)n

Formation of hairpin and tetrahelical structures by a d(CGG) trinucleotide repeat sequence is thought to cause expansion of this sequence and to engender fragile X syndrome. Here we show that human Werner syndrome DNA helicase (WRN), a member of the RecQ family of helicases, efficiently unwinds G'2 bimolecular tetraplex structures of d(CGG)7. Unwinding of d(CGG)7 by WRN requires hydrolyzable ATP and Mg2+ and is proportional to the amount of added helicase and to the time of incubation. The efficiencies of unwinding of G'2 d(CGG)7 tetraplex with 7 nucleotide-long single-stranded tails at their 3' or 5' ends are, respectively, 3.5- and 2-fold greater than that of double-stranded DNA. By contrast, WRN is unable to unwind a blunt-ended d(CGG)7 tetraplex, bimolecular tetraplex structures of a telomeric sequence 5'-d(TAGACATG(TTAGGG)2TTA)-3', or tetramolecular quadruplex forms of an IgG switch region sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3'. The ability of WRN to selectively unwind specific tetrahelices may reflect a specific role of this helicase in DNA metabolism.     

Re-evaluation of G-quadruplex propensity with G4Hunter

Critical evidence for the biological relevance of G-quadruplexes (G4) has recently been obtained in seminal studies performed in a variety of organisms. Four-stranded G-quadruplex DNA structures are promising drug targets as these non-canonical structures appear to be involved in a number of key biological processes. Given the growing interest for G4, accurate tools to predict G-quadruplex propensity of a given DNA or RNA sequence are needed. Several algorithms such as Quadparser predict quadruplex forming propensity. However, a number of studies have established that sequences that are not detected by these tools do form G4 structures (false negatives) and that other sequences predicted to form G4 structures do not (false positives). Here we report development and testing of a radically different algorithm, G4Hunter that takes into account G-richness and G-skewness of a given sequence and gives a quadruplex propensity score as output. To validate this model, we tested it on a large dataset of 392 published sequences and experimentally evaluated quadruplex forming potential of 209 sequences using a combination of biophysical methods to assess quadruplex formation in vitro. We experimentally validated the G4Hunter algorithm on a short complete genome, that of the human mitochondria (16.6 kb), because of its relatively high GC content and GC skewness as well as the biological relevance of these quadruplexes near instability hotspots. We then applied the algorithm to genomes of a number of species, including humans, allowing us to conclude that the number of sequences capable of forming stable quadruplexes (at least in vitro) in the human genome is significantly higher, by a factor of 2–10, than previously thought.     

Effect of the incorporation of 2'-deoxy-8-(hydroxyl)adenosine on the stability of quadruplexes formed by modified human telomeric DNA

Differential scanning calorimetry (DSC) and circular dichroism (CD) techniques were used to investigate the physico-chemical properties of the quadruplexes formed by the two different truncations of human telomeric sequence d(TAGGGT) and d(AGGGT), where the adenines were substituted by 2'-deoxy-8-(hydroxyl)adenosine (A --> A OH). CD spectra show that the modified sequences are able to form parallel-stranded quadruplex structure. Analysis of the thermodynamic parameters reveals that the introduction of the modified adenine affects in different way the thermal stability of the [d(TAGGGT)]4 and [d(AGGGT)]4 quadruplexes.