Nucleotide sequence of a wheat mitochondrial lysine tRNA gene

We present the sequence of a wheat mitochondrial (mt) lysine tRNA gene (trnK-UUU). This gene more closely resembles its E. coli counterpart than it does the corresponding gene in fungal or mammalian mtDNA. Hybridization experiments with a trnK-specific probe suggest that at least two copies of this tRNALys gene are present in the wheat mitochondrial genome.     

Nucleotide sequence of human placenta cytoplasmic initiator tRNA

Cytoplasmic initiator tRNA from human placenta has been purified. The nucleotide sequence of this tRNA has been determined and found identical to that of initiator tRNA from mammalian cytoplasm.     

Euglena gracilis chloroplast transfer RNA transcription units. Nucleotide sequence analysis of a tRNAThr-tRNAGly-tRNAMet-tRNASer-tRNAGln gene cluster

The arrangement and the nucleotide sequence of the tRNA genes in the 2.0-kilobase-pair EcoRI restriction fragment EcoQ of Euglena gracilis Klebs, strain Z Pringsheim chloroplast DNA have been determined. This fragment, cloned in pBR325 to form the plasmid pEZC300, contains five tRNA genes. The DNA insert of this plasmid, a known tRNA gene locus (Orozco, E.M., Jr., and Hallick, R.B. (1982) J. Biol. Chem. 257, 3258-3264) has been mapped by Southern gel analysis using a 32P-labeled oligodeoxynucleotide tRNA gene probe. The DNA sequence of 870 base pairs (bp) from EcoQ containing the entire tRNA gene locus was determined. The organization of this tRNA gene cluster on the E. gracilis chloroplast chromosome is tRNAUUGGln-14-BP spacer-RNAGCUSer-175-bp spacer-tRNACAUMet-12-bp spacer-tRNAGCCGly-5-bp spacer-tRNAUGUThr. The tRNAUUGGln and tRNAGCUSer gene sequences are of the opposite polarity as the other three gene sequences, but of the same polarity as the rRNA genes. The tRNAMet gene is a putative initiator tRNA. The five tRNA genes are separated and flanked by A-T-rich spacer sequences. This gene arrangement is consistent with the model that E. gracilis chloroplast tRNA genes are transcribed into multicistronic tRNA precursors. The DNA sequences have been used to deduce the primary and secondary structures of the tRNAs.     

Nucleotide sequence of a portion of human chromosome 9 containing a leukocyte interferon gene cluster

The nucleotide sequence of a 9937 base-pair portion of human chromosome 9, which contains two complete leukocyte interferon genes (LeIF-L and J), the complete intergenic region, and part of a third related possible pseudogene (LeIF-M), has been determined. The coding regions of the L and J genes are separated by 4363 nucleotides. The coding regions for the putative L and J interferons are 96% homologous and are each surrounded by about 3500 nucleotides of flanking sequences, which are also highly homologous. The L and J genes and their respective flanking sequences comprise a 4000 nucleotide leukocyte interferon gene repeat unit; the L gene repeat unit contains two major insertions not present in the J gene repeat unit. The J gene repeat unit is flanked by sequence features reminiscent of those found surrounding transposable elements. Both the L and J gene repeat units are embedded within sequences that are highly repeated in the human genome. Structural features identified within this portion of chromosome 9 may have been important for the generation of this interferon gene cluster.     

Euglena gracilis chloroplast transfer RNA transcription units. II. Nucleotide sequence analysis of a tRNAVal-tRNAAsn-tRNAArg-tRNALeu gene cluster

The tRNA-coding locus of the 8.2-kilobase pair (kbp) Eco RI fragments Eco G of Euglena gracilis Klebs, strain Z Pringsheim chloroplast DNA was chosen for detailed analysis. Two recombinant plasmids, pPG14, containing Eco G and the vector pMB9, and pEZC23, containing the chloroplast DNA fragment HindIII B cloned in pBR322 were employed for the study. The tRNA locus was mapped to an 0.8-kbp region of Eco G also present in HindIII B. The DNA sequence of a 1.6 kbp from HindIII B, containing the entire tRNA gene locus was determined. Four tRNA genes were identified from the DNA sequence. The gene organization is tRNAVal-16 bp spacer-tRNAAsn-3 bp spacer-tRNAArg-45 bp spacer-tRNALeu. The tRNALeu gene is of the opposite polarity as the other three genes. This is the first evidence of such a tRNA cluster for a chloroplast genome. Also evident from the DNA sequence, 132 bp from the 5'-end of the tRNALeu gene, is a putative gene or pseudogene for a chloroplast protein.     

Nucleotide sequence of the Acinetobacter calcoaceticus trpGDC gene cluster

A plasmid library of Acinetobacter calcoaceticus HindIII fragments was constructed, and clones that complemented an Escherichia coli pabA mutant were selected. Plasmids containing a 3.9-kb fragment of A. calcoaceticus DNA that also complemented E. coli trpD and trpC-(trpF+) mutants were obtained. We infer that complementation of E. coli pabA mutants was the result of the expression of the amphibolic anthranilate- synthase/p-aminobenzoate-synthase glutamine-amidotransferase gene and that the plasmid insert carried the entire trpGDC gene cluster. In E. coli minicells, the plasmid insert directed the synthesis of polypeptides of 44,000, 33,000, and 20,000 daltons, molecular masses that are consistent with the reported molecular masses of phosphoribosylanthranilate transferase, indoleglycerol-phosphate synthase, and anthranilate-synthase component II, respectively. A 3,105- bp nucleotide sequence was determined. Comparison of the A. calcoaceticus trpGDC sequences with other known trp gene sequences has allowed insight into (1) the evolution of the amphibolic trpG gene, (2) varied strategies for coordinate expression of trp genes, and (3) mechanisms of gene fusions in the trp operon.      

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCA-DAGCGCAψUUGUUUUGGNψFACAAAAUmsu7GUCACGGGTψCAAAUCCUGUCAUCCUUACCA_OH. It shows 93% homology with spinach chloroplast tRNA^Pro (UGG) and 72% homology with bean mitochondrial tRNA^Pro (UGG), the other two known plant organellar tRNAs^Pro.