Binding of netropsin and 4,6-diamidino-2-phenylindole to an A2T2 DNA hairpin: a comparison of biophysical techniques

Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies.     

A comparative study of DNA complexation with Mg(II) and Ca(II) in aqueous solution: major and minor grooves bindings

Although structural differences for the Mg-DNA and Ca-DNA complexes are provided in the solid state, such comparative study in aqueous solution has been less investigated. The aim of this study was to examine the bindings of Mg and Ca cations with calf thymus DNA in aqueous solution at physiological pH, using constant concentration of DNA (1.25 or 12.5 mM) and various concentrations of metal ions (2 microM-650 microM). Capillary electrophoresis, UV-visible, and Fourier transform infrared spectroscopic methods were used to determine the cation-binding modes, the binding constants, and DNA structural variations in aqueous solution. Direct Ca-PO(2) binding was evident by major spectral changes (shifting and splitting) of the backbone PO(2) asymmetric stretching at 1222 cm(-1) with K = 4.80 x 10(5) M(-1), whereas an indirect Mg-phosphate interaction occurred (due to the lack of shifting and splitting of the phosphate band at 1222 cm(-1)) with K = 5.6 x 10(4) M(-1). The metal-base bindings were directly for the Mg with K = 3.20 x 10(5) M(-1) and indirectly for the Ca cation with K = 3.0 x 10(4) M(-1). Both major and minor groove bindings were observed with no alteration of the B-DNA conformation.     

Tuning of intercalation and electron-transfer processes between DNA and acridinium derivatives through steric effects

A series of acridinium derivatives 1-6, wherein steric factors have been varied systematically through substitution at the 9 position of the acridine ring, have been synthesized and their DNA interactions have been investigated by various biophysical techniques. The unsubstituted and methylacridinium derivatives 1 and 2 and the o-tolylacridinium derivative 6 exhibited high fluorescence quantum yields (Phi(f)() congruent with 1) and lifetimes (tau = 35, 34, and 25 ns, respectively), when compared with the arylacridinium derivatives 3-5. The acridinium derivatives 1 and 2 showed high DNA binding affinity (K = 7.3-7.7 x 10(5) M(-)(1)), when compared to the arylacridinium derivatives 3-5 (K = 6.9-10 x 10(4) M(-)(1)). DNA melting and viscosity studies establish that in the case of the aryl-substituted systems, the efficiency of DNA binding is in the order, phenyl > p-tolyl > m-tolyl > o-tolyl derivative. The increase in steric crowding around the acridine ring hinders the DNA binding interactions and thereby leads to negligible binding as observed in the case of 6 (o-tolyl derivative). These results indicate that a subtle variation in the substitution pattern has a profound influence on the photophysical and DNA interactions. Further, they demonstrate that pi-stacking interactions of the ligands with DNA are essential for efficient electron transfer between the DNA bases and the ligands. These water soluble and highly fluorescent molecules which differ in their DNA binding mode can act as models to study various DNA-ligand interactions.     

Structural analysis of DNA interactions with biogenic polyamines and cobalt(III)hexamine studied by Fourier transform infrared and capillary electrophoresis

Biogenic polyamines, such as putrescine, spermidine, and spermine are small organic polycations involved in numerous diverse biological processes. These compounds play an important role in nucleic acid function due to their binding to DNA and RNA. It has been shown that biogenic polyamines cause DNA condensation and aggregation similar to that of inorganic cobalt(III)hexamine cation, which has the ability to induce DNA conformational changes. However, the nature of the polyamine.DNA binding at the molecular level is not clearly established and is the subject of much controversy. In the present study the effects of spermine, spermidine, putrescine, and cobalt(III)hexamine on the solution structure of calf-thymus DNA were investigated using affinity capillary electrophoresis, Fourier transform infrared, and circular dichroism spectroscopic methods. At low polycation concentrations, putrescine binds preferentially through the minor and major grooves of double strand DNA, whereas spermine, spermidine, and cobalt(III)hexamine bind to the major groove. At high polycation concentrations, putrescine interaction with the bases is weak, whereas strong base binding occurred for spermidine in the major and minor grooves of DNA duplex. However, major groove binding is preferred by spermine and cobalt(III)hexamine cations. Electrostatic attractions between polycation and the backbone phosphate group were also observed. No major alterations of B-DNA were observed for biogenic polyamines, whereas cobalt(III)hexamine induced a partial B --> A transition. DNA condensation was also observed for cobalt(III)hexamine cation, whereas organic polyamines induced duplex stabilization. The binding constants calculated for biogenic polyamines are K(Spm) = 2.3 x 10(5) M(-1), K(Spd) = 1.4 x 10(5) M(-1), and K(Put) = 1.02 x 10(5) M(-1). Two binding constants have been found for cobalt(III)hexamine with K(1) = 1.8 x 10(5) M(-1) and K(2) = 9.2 x 10(4) M(-1). The Hill coefficients indicate a positive cooperativity binding for biogenic polyamines and a negative cooperativity for cobalt(III)hexamine.     

Binding of distamycin A and netropsin to the 12mer DNA duplexes containing mixed AT.GC sequences with at most five or three successive AT base pairs

Circular dichroism (CD), isothermal calorimetric titrations (ITC), and temperature-dependent UV spectroscopy were used to investigate binding of the minor groove-directed ligands distamycin A (Dst) and netropsin (Net) to the following duplexes: d(GTTAGTATTTGG). d(CCAAATACTAAC), d(GTTAGTATATGG).d(CCATATACTAAC), d(GTTAGTACTTGG). d(CCAAGTACTAAC), and d(GTTAGTAGTTGG).d(CCAACTACTAAC). Our results reveal that Dst binds within the minor grooves of these dodecamers that contain five-AT and/or four-AT.GC binding sites exclusively in a dimeric high-affinity 2:1 binding mode (K approximately 10(16) M(-)(2)). By contrast, Net exhibits high-affinity binding only when it binds in a 1:1 mode (K(1) approximately 10(9) M(-)(1)) to the two duplexes that contain five-AT sites (5'-TATTT-3' and 5'-TATAT-3'). Its further binding to these two duplexes occurs in a low-affinity mode (K(2) approximately 10(6) M(-)(1)) and results in the formation of 2:1 Net-DNA complexes. To the other two duplexes that contain sequences with at most three AT consecutive base pairs Net binds in two distinctive low-affinity 1:1 binding modes (K(1) approximately 10(7) M(-)(1), K(2) approximately 10(6) M(-)(1)). Competition experiments (CD and ITC titrations) reveal that Dst entirely displaces Net from its 1:1 and 2:1 complexes with any of the four duplexes. We discuss and interpret our optical and calorimetric results in the context of the available structural information about the complexes between DNA and the sequence-specific minor groove binders Dst and Net.     

Molecular recognition between oligopeptides and nucleic acids. DNA sequence specificity and binding properties of an acridine-linked netropsin hybrid ligand

The binding to DNA of a mixed function ligand (NETGA) is described, in which a potential intercalating group, an acridine moiety, is incorporated at the carboxyl terminus of the minor groove binding oligopeptide netropsin skeleton. Scatchard analysis of absorption data provided evidence of two modes of binding to DNA with K1 = 9.1 x 10(5) M-1 at low r values (0.003-0.1), and a binding site size n = 10, indicative of binding of both moeities. At high binding ratios (greater than 0.1), K2 = 0.9 x 10(5) M-1 and n = 5 corresponding to external binding. Complementary strand MPE footprinting on a pBR322 restriction fragment showed NETGA binds to 5'-AAAT like netropsin. It causes enhanced cleavage by MPE, particularly at G-C rich sequences and remote from the preferred binding sites. Viscometry measurements provided evidence for biphasic modes of the two binding portions of NETGA. Fluorescence polarization and linear dichroism measurements were in accord with distinct modes of interaction of the acridine (intercalation) and oligopeptide (minor groove binding) portions of NETGA. LD measurements on NETGA indicate that the oligopeptide moiety (netropsin-like) has an orientation typical of minor groove binders, whereas the degree of intercalation of the acridine group is decreased by association of the oligopeptide moiety.     

Influence of surface shape on DNA binding of bimetallo helicates

In order to probe the DNA-helicate interactions responsible for the DNA binding and remarkable changes of the DNA secondary structure induced by a tetracationic bi-metallo helicate [Fe(2)(L(1))(3)](4+) (L(1)=C(25)H(20)N(4)), we have designed and synthesised derivatives with hydrophobic methyl groups at different positions on the ligand backbone. Two dimetallo helicates [Fe(2)(L(i))(3)](4+) were prepared using ligands L(3) and L(5) with the methyl substituent on, respectively, the 3 and 5 positions of the pyridyl ring thus producing a wider or slightly longer tetracationic DNA binder. UV/visible absorbance, circular and linear dichroism spectroscopies have been used to characterize the interactions of the cylinders with DNA with the aim of investigating any sequence preference or selectivity upon binding. Competitive binding studies using fluorescent dyes Hoechst 33258 (a minor groove binder), ethidium bromide (an intercalator) and a major groove binding cation (cobalt (III) hexammine) which induces the B-->Z transition have been employed to determine the binding geometries of the enantiomers of two methylated helicates (L(3) and L(5)) to DNA and compare with the data obtained previously for the unmethylated analogue (L(1)). The results demonstrate that the racemic mixtures and the resolved enantiomers of all helicates bind to DNA inducing structural changes. The overall conclusion from the effect of adding these groups to the surface of the parent helicate is that increasing the width (L(3)) reduces the DNA binding strength, the bending and coiling effect and the groove selectivity of the enantiomers compared with the parent compound. There is limited evidence to suggest a slight GC sequence preference. Lengthening the helicate (L(5)) results in DNA interactions similar to those of the parent compounds, with an increased preference of the P enantiomer for the minor groove indicating an enhancement of mode selectivity.     

Substituent control of DNA binding modes in a series of chalcogenoxanthylium photosensitizers as determined by isothermal titration calorimetry and topoisomerase I DNA unwinding assay

The DNA binding efficacy and preferred mode of binding of a series of rhodamine-related chalcogenoxanthylium dyes was investigated by isothermal titration calorimetry (ITC) using ctDNA, [poly(dCdG)](2) and [poly(dAdT)](2), and by a topoisomerase I DNA unwinding (Topo I) assay. The dyes of this study showed tight binding to ctDNA with binding constants, K(b), on the order of 10(6)-10(7)M(-1). The ITC and Topo I assay studies suggested that the 9-substituent has a strong impact on binding modes ranging from an apparent preference for intercalation with a 9-2-thienyl substituent (similar binding to [poly(dCdG)](2) and [poly(dAdT)](2), re-supercoiling of DNA in the Topo I assay at <10(-5)M dye), to mixed binding modes with 9-phenyl derivatives (2- to 3-fold preference for binding to [poly(dAdT)](2), re-supercoiling of DNA in the Topo I assay at approximately 2 x 10(-5)M dye), to minor groove binding in a 9-(2-thienyl-5-diethylcarboxamide) derivative (strong preference for binding to [poly(dAdT)](2), did not show complete re-supercoiling in the Topo I assay). No binding to ctDNA was observed in one derivative with a 9-(3-thienyl-2-diethylcarboxamide) substituent, which cannot be co-planar with the xanthylium core. In series of dyes where the chalcogen atom was varied, the selenoxanthylium derivatives had 2- to 3-fold higher values of K(b) than the corresponding xanthylium, thioxanthylium, or telluroxanthylium derivatives, which all showed comparable values of K(b). The chalcogen atom appeared to have little influence on binding mode.     

Aminoglycoside binding to Oxytricha nova telomeric DNA

Telomeric DNA sequences have been at the center stage of drug design for cancer treatment in recent years. The ability of these DNA structures to form four-stranded nucleic acid structures, called G-quadruplexes, has been perceived as target for inhibiting telomerase activity vital for the longevity of cancer cells. Being highly diverse in structural forms, these G-quadruplexes are subjects of detailed studies of ligand-DNA interactions of different classes, which will pave the way for logical design of more potent ligands in future. The binding of aminoglycosides was investigated with Oxytricha nova quadruplex forming DNA sequence (GGGGTTTTGGGG)(2). Isothermal titration calorimetry (ITC) determined ligand to quadruplex binding ratio shows 1:1 neomycin:quadruplex binding with association constants (K(a)) ～ 10(5) M(-1) while paromomycin was found to have a 2-fold weaker affinity than neomycin. The CD titration experiments with neomycin resulted in minimal changes in the CD signal. FID assays, performed to determine the minimum concentration required to displace half of the fluorescent probe bound, showed neomycin as the best of the all aminoglycosides studied for quadruplex binding. Initial NMR footprint suggests that ligand-DNA interactions occur in the wide groove of the quadruplex. Computational docking studies also indicate that aminoglycosides bind in the wide groove of the quadruplex.     

The binding of guanine-guanine mismatched DNA to naphthyridine dimer immobilized sensor surfaces: kinetic aspects

Naphthyridine dimer composed of two naphthyridine chromophores and a linker connecting them strongly, and selectively, binds to the guanine-guanine mismatch in duplex DNA. The kinetics for the binding of the G-G mismatch to the naphthyridine dimer was investigated by surface plasmon resonance assay. The sensor surface was prepared by immobilizing naphthyridine dimer through a long poly(ethylene oxide) linker with the ligand density of 9.1 x 10(-12) fmolnm(-2). The kinetic analyses revealed that the binding of the G-G mismatch was sequence dependent on the flanking base pairs, and the G-G mismatches flanking at least one G-C base pair bound to the surface via a two-step process with a 1:1 DNA-ligand stoichiometry. The first association rate constant for the binding of the G-G mismatch in the 5'-CGG-3'/3'-GGC-5' sequence to the naphthyridine dimer-immobilized sensor surface was 3.2 x 10(3)M(-1)s(-1) and the first dissociation rate constant was 1.4 x 10(-2)s(-1). The association and dissociation rate constants for the second step were insensitive to the flanking sequences, and were almost of the same order of magnitude as the first dissociation rate constant. This indicates that the second step had only a small energetic contribution to the binding. The association constant calculated from kinetic parameters was 2.7 x 10(5)M(-1), which is significantly smaller than the apparent association constants obtained from experiments in solution. Electrospray ionization time-of-flight (ESI-TOF) mass spectrometry on the complex produced from the G-G mismatch and naphthyridine dimer showed the formation of the 1:1 complex and a 1:2 DNA-ligand complex in solution. The latter complex became the dominant complex when a six-fold excess of naphthyridine dimer was added to DNA.     

Enantioselective plasma protein binding of bimoclomol

The binding of bimoclomol enantiomers to human plasma, its components, as well as to plasma from monkey, dog, rat, and mouse was investigated by ultrafiltration and equilibrium dialysis. The considerably stronger binding of the (-)-(S)-enantiomer found in human plasma is due to the alpha(1)-acid glycoprotein (AAG) component. The binding parameters for AAG (n(R)K(R) = 1.3 x 10(4) M(-1) and n(S)K(S) = 1.0 x 10(5) M(-1)) revealed high enantioselectivity, while the binding to human serum albumin was found to be weak (nK = 5 x 10(3) M(-1)) and not stereoselective. (-)-(S)-Bimoclomol was extensively displaced in the presence of specific marker ligands for the "FIS" subfraction of human AAG. Comparative binding studies indicated considerable differences between plasma of the five species investigated.     

Intercalative DNA binding of model compounds derived from metabolites of 7,12-dimethylbenz[a]anthracene

The DNA binding of nonreactive model compounds of metabolites of 7,12-dimethylbenz[a]-anthracene (DMBA)1 was studied in fluorescence quenching and fluorescence lifetime experiments. The model compounds examined were DMA and 8,9,10,11-tetrahydro-BA. DMA is a pi electron model of a highly carcinogenic bay region epoxide of DMBA, 8,9,10,11-tetrahydro-BA is a model compound of a less carcinogenic DMBA epoxide. The results indicate that the binding of DMA occurs primarily via intercalation. In 15% methanol the binding constant is 3.1 x 10(3) M-1. In 15% methanol and at DNA phosphate levels of 5.0 x 10(-4) M the intercalative binding of DMA is reduced by a factor of 6.2 when 5.0 x 10(-4) M Mg+2 is added. The DMA binding constant for intercalation is reduced by more than a factor of 4 when the methanol content of the solvent is increased from 0% to 20%. Finally DMA binding arising from pi interactions with the DNA bases is reduced more than 15 times when the DNA is denatured. For 8,9,10,11-tetrahydro-BA in 15% methanol the binding constant for intercalation is 6 times lower than that for DMA. These results along with previously reported binding data on other model compounds suggest that bay region metabolites of DMBA readily participate in physical pi stacking interactions with DNA.     

Identification of binding mechanisms in single molecule-DNA complexes

Changes in the elastic properties of single deoxyribonucleic acid (DNA) molecules in the presence of different DNA-binding agents are identified using atomic force microscope single molecule force spectroscopy. We investigated the binding of poly(dG-dC) dsDNA with the minor groove binder distamycin A, two supposed major groove binders, an alpha-helical and a 3(10)-helical peptide, the intercalants daunomycin, ethidium bromide and YO, and the bis-intercalant YOYO. Characteristic mechanical fingerprints in the overstretching behavior of the studied single DNA-ligand complexes were observed allowing the distinction between different binding modes. Docking of ligands to the minor or major groove of DNA has the effect that the intramolecular B-S transition remains visible as a distinct plateau in the force-extension trace. By contrast, intercalation of small molecules into the double helix is characterized by the vanishing of the B-S plateau. These findings lead to the conclusion that atomic force microscope force spectroscopy can be regarded as a single molecule biosensor and is a potent tool for the characterization of binding motives of small ligands to DNA.     

DNA interaction with naturally occurring antioxidant flavonoids quercetin, kaempferol, and delphinidin

Flavonoids are strong antioxidants that prevent DNA damage. The anticancer and antiviral activities of these natural products are implicated in their mechanism of actions. However, there has been no information on the interactions of these antioxidants with individual DNA at molecular level. This study was designed to examine the interaction of quercetin (que), kaempferol (kae), and delphinidin (del) with calf-thymus DNA in aqueous solution at physiological conditions, using constant DNA concentration (6.5 mmol) and various drug/DNA(phosphate) ratios of 1/65 to 1. FTIR and UV-Visible difference spectroscopic methods are used to determine the drug binding sites, the binding constants and the effects of drug complexation on the stability and conformation of DNA duplex. Structural analysis showed quercetin, kaempferol, and delphinidin bind weakly to adenine, guanine (major groove), and thymine (minor groove) bases, as well as to the backbone phosphate group with overall binding constants K(que) = 7.25 x 10(4)M(-1), K(kae) = 3.60 x 10(4)M(-1), and K(del) = 1.66 x 10(4)M(-1). The stability of adduct formation is in the order of que>kae>del. Delphinidin with a positive charge induces more stabilizing effect on DNA duplex than quercetin and kaempferol. A partial B to A-DNA transition occurs at high drug concentrations.     

DNA interaction with antitumor polyamine analogues: a comparison with biogenic polyamines

Biogenic polyamines, putrescine, spermidine, and spermine, are ubiquitous cellular cations and exert multiple biological functions. Polyamine analogues mimic biogenic polyamines at macromolecular level but are unable to substitute for natural polyamines and maintain cell proliferation, indicating biomedical applications. The mechanistic differences in DNA binding mode between natural and synthetic polyamines have not been explored. The aim of this study was to examine the interaction of calf thymus DNA with three polyamine analogues, 1,11-diamino-4,8-diazaundecane (333), 3,7,11,15-tetrazaheptadecane x 4 HCl (BE-333), and 3,7,11,15,19-pentazahenicosane x 5 HCl (BE-3333), using FTIR, UV-visible, and CD spectroscopy. Polyamine analogues bind with guanine and backbone PO2 group as major targets in DNA, whereas biogenic polyamines bind to major and minor grooves as well as to phosphate groups. Weaker interaction with DNA was observed for analogues with respect to biogenic polyamines, with K(333) = 1.90 (+/-0.5) x 10(4) M(-1), K(BE-333) = 6.4 (+/-1.7) x 10(4) M(-1), K(BE-3333) = 4.7 (+/-1.4) x 10(4) M(-1) compared to K(Spm) = 2.3 (+/-1.1) x 10(5) M(-1), K(Spd) = 1.4 (+/-0.6) x 10(5) M(-1), and K(Put) = 1.02 (+/-0.5) x 10(5) M(-1). A partial B- to A-DNA transition was also provoked by analogues. These data suggest distinct differences in the binding of natural and synthetic polyamines with DNA.     

DNA helicase RepA: cooperative ATPase activity and binding of nucleotides

The steady-state kinetic parameters of the ATPase activity of the homohexameric DNA helicase RepA and the binding of the fluorescent analogue epsilonADP to RepA have been studied. ssDNA stimulates RepA ATPase activity optimally at acidic pH 5.3-6.0. The sigmoidal kinetic curves in both the absence and presence of ssDNA show strong positive cooperativity for ATP hydrolysis, with oligonucleotides longer than 10mer optimal for ssDNA-stimulated ATPase activity. Fluorescence titrations show that, at 25 degrees C and in the absence of DNA, the binding of epsilonADP to RepA is biphasic with three high (K(1) = 1.54 x 10(6) M(-1)) and three low (K(2) = 4.71 x 10(4) M(-)(1)) affinity binding sites differing by 30-40-fold in binding constants. In the absence of cofactors, RepA melts cooperatively at T(m) = 65.8 +/- 0.1 degrees C and is more stable in the presence of ATPgammaS, T(m) = 68.1 +/- 0.2 degrees C (DeltaDeltaG 0.95 kcal/mol), than in the presence of ADP, T(m) = 66. 5 +/- 0.1 degrees C (DeltaDeltaG 0.29 kcal/mol), indicating that the additional phosphate group in ATPgammaS has a significant influence on RepA structure. A model is proposed in which individual subunits of RepA sequentially and cooperatively perform a multistep ATP hydrolytic cycle.     

DNase I - DNA interaction alters DNA and protein conformations.

Human DNase I is an endonuclease that catalyzes the hydrolysis of double-stranded DNA predominantly by a single-stranded nicking mechanism under physiological conditions in the presence of divalent Mg and Ca cations. It binds to the minor groove and the backbone phosphate group and has no contact with the major groove of the right-handed DNA duplex. The aim of this study was to examine the effects of DNase I - DNA complexation on DNA and protein conformations.We monitored the interaction of DNA with DNase I under physiological conditions in the absence of Mg2+, with a constant DNA concentration (12.5 mmol/L; phosphate) and various protein concentrations (10-250 micromol/L). We used Fourier transfrom infrared, UV-visible, and circular dichroism spectroscopic methods to determine the protein binding mode, binding constant, and effects of polynucleotide-enzyme interactions on both DNA and protein conformations. Structural analyses showed major DNase-PO2 binding and minor groove interaction, with an overall binding constant, K, of 5.7 x 10(5) +/- 0.78 x 10(5) (mol/L)-1. We found that the DNase I - DNA interaction altered protein secondary structure, with a major reduction in alpha helix and an increase in beta sheet and random structures, and that a partial B-to-A DNA conformational change occurred. No DNA digestion was observed upon protein-DNA complexation.     

Base-sequence specificity of Hoechst 33258 and DAPI binding to five (A/T)4 DNA sites with kinetic evidence for more than one high-affinity Hoechst 33258-AATT complex

The binding of Hoechst 33258 and DAPI to five different (A/T)4 sequences in a stable DNA hairpin was studied exploiting the substantial increase in dye fluorescence upon binding. The two dyes have comparable affinities for the AATT site (e.g. association constant K(a)=5.5 x 10(8) M(-1) for DAPI), and their affinities decrease in the series AATT > TAAT approximately equal to ATAT > TATA approximately equal to TTAA. The extreme values of K(a) differ by a factor of 200 for Hoechst 33258 but only 30 for DAPI. The binding kinetics of Hoechst 33258 were measured by stopped-flow under pseudo-first order conditions with an (A/T)4 site in excess. The lower-resolution experiments can be well represented by single exponential processes, corresponding to a single-step binding mechanism. The calculated association-rate parameters for the five (A/T)4 sites are similar (2.46 x 10(8) M(-1) s(-1) to 0.86 x 10(8) M(-1) s(-1)) and nearly diffusion-controlled, while the dissociation-rate parameters vary from 0.42 s(-1) to 96 s(-1). Thus the association constants are kinetically controlled and are close to their equilibrium-determined values. However, when obtained with increased signal-to-noise ratio, the kinetic traces for Hoechst 33258 binding at the AATT site reveal two components. The concentration dependencies of the two time constants and amplitudes are consistent with two different kinetically equivalent two-step models. In the first model, fast bimolecular binding is followed by an isomerization of the initial complex. In the second model, two single-step associations form two complexes that mutually exclude each other. For both models the four reaction-rate parameters are calculated. Finally, specific dissociation kinetics, using poly[d(A-5BrU)], show that the kinetics are even more complex than either two-step model. We correlate our results with the different binding orientations and locations of Hoechst 33258 in the DNA minor groove found in several structural studies in the literature.     

Investigation of DNA binding modes for a symmetrical cyanine dye trication: effect of DNA sequence and structure.

The DNA binding behavior of a tricationic cyanine dye (DiSC3+(5)) was studied using the [Poly(dA-dT)]2, [Poly(dI-dC)]2 and Poly(dA) x Poly(dT) duplex sequences and the Poly(dA) x 2Poly(dT) triplex. Optical spectroscopy and viscometry results indicate that the dye binds to the triplex structure by intercalation, to the nonalternating Poly(dA) x Poly(dT) duplex through minor groove binding and to the alternating [Poly(dA-dT)]2 duplex by a combination of two binding modes: intercalation at low concentration and dimerization within the minor groove at higher concentration. Dimerization occurs at lower dye concentrations for the [Poly(dI-dC)]2 sequence, consistent with our previous investigations on an analogous monocationic cyanine dye. [Seifert, J.L., et al. (1999) J. Am. Chem. Soc. 121, 2987-2995] These studies illustrate the diversity of DNA binding modes that are available to a given ligand structure.