共查询到20条相似文献,搜索用时 46 毫秒
1.
Alisson L. da Rocha Bruno C. Pereira José R. Pauli Dennys E. Cintra Claudio T. de Souza Eduardo R. Ropelle Adelino S. R. da Silva 《PloS one》2015,10(10)
The purpose of this study was to verify the effects of overtraining (OT) on insulin, inflammatory and gluconeogenesis signaling pathways in the livers of mice. Rodents were divided into control (CT), overtrained by downhill running (OTR/down), overtrained by uphill running (OTR/up) and overtrained by running without inclination (OTR). Rotarod, incremental load, exhaustive and grip force tests were used to evaluate performance. Thirty-six hours after a grip force test, the livers were extracted for subsequent protein analyses. The phosphorylation of insulin receptor beta (pIRbeta), glycogen synthase kinase 3 beta (pGSK3beta) and forkhead box O1 (pFoxo1) increased in OTR/down versus CT. pGSK3beta was higher in OTR/up versus CT, and pFoxo1 was higher in OTR/up and OTR versus CT. Phosphorylation of protein kinase B (pAkt) and insulin receptor substrate 1 (pIRS–1) were higher in OTR/up versus CT and OTR/down. The phosphorylation of IκB kinase alpha and beta (pIKKalpha/beta) was higher in all OT protocols versus CT, and the phosphorylation of stress-activated protein kinases/Jun amino-terminal kinases (pSAPK-JNK) was higher in OTR/down versus CT. Protein levels of peroxisome proliferator-activated receptor-gamma coactivator 1alpha (PGC-1alpha) and hepatocyte nuclear factor 4alpha (HNF-4alpha) were higher in OTR versus CT. In summary, OTR/down improved the major proteins of insulin signaling pathway but up-regulated TRB3, an Akt inhibitor, and its association with Akt. 相似文献
2.
Luciana da C. Oliveira Gustavo P. de Morais Alisson L. da Rocha Giovana R. Teixeira Ana P. Pinto Larissa G. de Vicente José R. Pauli Leandro P. de Moura Rania A. Mekary Eduardo R. Ropelle Dennys E. Cintra Adelino S. R. da Silva 《Journal of cellular biochemistry》2019,120(2):1304-1317
Exhaustive and chronic physical exercise leads to peripheral inflammation, which is one of the molecular mechanisms responsible for the impairment of the insulin signaling pathway in the heart. Recently, 3 different running overtraining models performed downhill (OTR/down), uphill (OTR/up), and without inclination (OTR) increased the serum levels of proinflammatory cytokines. This proinflammatory status induced insulin signaling impairment in the skeletal muscle; however, the response of this signaling pathway in the cardiac muscle of overtrained mice was still unknown. Thus, we investigated the effects of OTR/down, OTR/up, and OTR protocols on the protein levels of phosphorylation of insulin receptor β (pIRβ) (Tyr), phosphorylation of protein kinase B (pAkt) (Ser473), plasma membrane glucose transporter-1 (GLUT1) and GLUT4, phosphorylation of insulin receptor substrate-1 (pIRS-1) (Ser307), phosphorylation of IκB kinase α/β) (pIKKα/β (Ser180/181), phosphorylation of p38 mitogen-activated protein kinase (p-p38MAPK) (Thr180/Tyr182), phosphorylation of stress-activated protein kinases-Jun amino-terminal kinases (pSAPK-JNK) (Thr183/Tyr185), and glycogen content in mice hearts. The rodents were divided into naïve (N, sedentary mice), control (CT, sedentary mice submitted to performance evaluations), trained (TR, performed the training protocol), OTR/down, OTR/up, and OTR groups. After the grip force test, the cardiac muscles (ie, left ventricle) were removed and used for immunoblotting and histology. Although the OTR/up and OTR groups exhibited higher cardiac levels of pIRβ (Tyr), only the OTR group exhibited higher cardiac levels of pAkt (Ser473) and plasma membrane GLUT4. On the contrary, the OTR/down group exhibited higher cardiac levels of pIRS-1 (Ser307). The OTR model enhanced the cardiac insulin signaling pathway. All overtraining models increased the left ventricle glycogen content, with this probably acting as a compensatory organ in response to skeletal muscle insulin signaling impairment. 相似文献
3.
Yang M Wang W Zhong M Philippi A Lichtarge O Sanborn BM 《Molecular endocrinology (Baltimore, Md.)》2002,16(4):814-823
To identify structural elements important to specific G alpha(q) coupling in the oxytocin receptor (OTR), intracellular domains were exchanged between OTR and G alpha(s)-coupled vasopressin V(2) receptors (V(2)Rs). Substitution of sequence from the second (2i) and third (3i) intracellular domains of V(2)R into comparable positions in OTR markedly reduced ligand affinity and resulted in a loss of G alpha(q) coupling. Substitution of the 2i domain of OTR into V(2)R decreased ligand affinity and vasopressin-stimulated adenylyl cyclase activity and only slightly increased phosphatidylinositide turnover. In contrast, substitution of the OTR3i domain into V(2)R produced a receptor chimera with high ligand affinity, decreased vasopressin-stimulated adenylyl cyclase activity, and markedly enhanced ligand-stimulated phosphatidylinositide turnover. The C-terminal 36 amino acids, but not the N-terminal 13 amino acids, of the OTR3i domain contained the determinants critical for enhanced activation of PLC. Mutation of a single lysine in the C-terminal OTR3i sequence to the corresponding V(2)R residue (valine) eliminated the enhanced ability of the V(2)R chimera to stimulate PLC but did not affect maximal adenylyl cyclase stimulation. Furthermore, mutation of this residue (K270) in wild-type OTR completely abolished the ability of the receptor to stimulate phosphatidylinositide turnover, with only a small reduction in ligand affinity. These data demonstrate that OTR K270 is critically important in the stimulation by OTR of phosphatidylinositide turnover and that this determinant can also increase this activity in the V(2)R chimera. Mutation of K270 also adversely affects the ability of OTR to stimulate ERK1/2 phosphorylation. Therefore, this residue plays an important role in the specificity of OTR/G alpha(q)/PLC coupling. 相似文献
4.
Human ribosomal protein S3a: cloning of the cDNA and primary structure of the protein. 总被引:2,自引:0,他引:2
The amino acid (aa) sequence of human ribosomal protein S3a (hRPS3a) was deduced partially from the nucleotide sequence of the corresponding cDNA and confirmed by direct aa sequencing from the N terminus of the purified hRPS3a protein. The cDNA clone was isolated from a cDNA expression library in the pEX vector using antibodies. The hRPS3a protein has 263 aa and its calculated M(r) is 29 813. 相似文献
5.
The present study was conducted to determine if progesterone (P4) would inhibit oxytocin-stimulated phosphoinositide hydrolysis in COS-7 cells expressing transfected ovine oxytocin receptor (OTR) with little or no nuclear P4 receptor (nPR) protein present. The relative absence of nPR in these cells was confirmed by immunocytochemistry and RT-PCR. To investigate the effects of P4 on oxytocin (OT) signaling, cells were transiently transfected with the ovine OTR. Radioreceptor assay for [(3)H]-OT binding confirmed the presence of a high affinity binding site for OT in transfected cells, while treatment with P4 and GTPgammaS (which uncouples the OTR from the heterotrimeric G-protein) increased the K(d) for OT binding slightly. Cells were then assayed for inositol phosphate hydrolysis 48 h post-transfection. Pre-treatment of cells with P4 for 10 min significantly interfered with rapid (20 min) OT-stimulated inositol trisphosphate (IP(3)) production. This inhibition was specific to P4, because pre-treatment of cells with promegestone (R5020), testosterone, mifepristone (RU 486), or cortisol did not decrease OT-stimulated IP(3) levels. By radioreceptor assay for PR, no measurable specific binding of R5020 was observed for either transfected or non-transfected cells. We conclude that P4 can inhibit OTR-mediated phosphoinositide hydrolysis in COS-7 cells that express little or no nPR protein. These data support a role for a non-genomic action for P4 in OTR signaling via some mechanism other than by binding to a membrane progestin receptor in an immortalized, transfected cell. 相似文献
6.
7.
Zhong M Parish B Murtazina DA Ku CY Sanborn BM 《American journal of physiology. Endocrinology and metabolism》2007,292(4):E977-E984
Previously, residue K6.30 in the COOH-terminal region of the third intracellular domain (3iC) of the oxytocin (OT) receptor (OTR) was identified as important for receptor function leading to phospholipase C activation in both OTR and the vasopressin V(2) receptor (V(2)R) chimera V(2)ROTR3iC. Substitution of either A6.28K or V6.30K in wild-type V(2)R did not recapitulate the increase in phosphatidylinositide (PI) turnover observed in V(2)ROTR3iC. Hence, the role of K6.30 may be context-specific. Deletion of two NH(2)-terminal OTR3iC segments in the V(2)ROTR3iC chimera did not diminish vasopressin-stimulated PI turnover, whereas deletion of RVSSVKL (residues 6.19-6.25) reduced receptor expression. Deletion of this sequence in wild-type OTR reduced expression by 50% without affecting affinity for [(3)H]OT. This OTR mutant was unable to activate PI turnover or extracellular signal-regulated kinase 1/2 phosphorylation. The effects of alanine substitution for individual residues in RVSSVKL indicated differential importance for OTR function. The R6.19A substitution lost high-affinity sites for [(3)H]OT and the ability to stimulate PI turnover. Affinity for [(3)H]OT and membrane expression was not affected by any other substitutions. OTR-V6.20A and OTR-K6.24A mutants functioned as well as wild-type OTR, whereas OTR S6.21A, S6.22A, and V6.23A mutants exhibited impaired abilities to activate PI turnover (20-40% of OTR), and the OTR-L6.25A mutant exhibited constitutive activity. In conclusion, specific amino acids in the RVSSVKL segment in the COOH-terminal region of the third intracellular domain of OTR influence the ability of OTR to activate G protein-mediated actions. 相似文献
8.
Kinsey CG Bussolati G Bosco M Kimura T Pizzorno MC Chernin MI Cassoni P Novak JF 《Journal of cellular and molecular medicine》2007,11(1):96-110
Oxytocin receptor (OTR) is a membrane protein known to mediate oxytocin (OT) effects, in both normal and neoplastic cells. We report here that human osteosarcoma (U2OS, MG63, OS15 and SaOS2), breast cancer (MCF7), and primary human fibroblastic cells (HFF) all exhibit OTR not only on the cell membrane, but also in the various nuclear compartments including the nucleolus. Both an OTR-GFP fusion protein and the native OTR appear to be localized to the nucleus as detected by transfection and/or confocal immunofluorescence, respectively. Treatment with oxytocin causes internalization of OTR and the resulting vesicles accumulate in the vicinity of the nucleus and some of the perinuclear OTR enters the nucleus. Western blots indicate that OTR in the nucleus and on the plasma membrane are likely to be the same biochemical and immunological entities. It appears that OTR is first visible in the nucleoli and subsequently disperses within the nucleus into 4-20 spots while some of the OTR diffuses throughout the nucleoplasm.The behaviour and kinetics of OTR-GFP and OTR are different, indicating interference by GFP in both OTR entrance into the nucleus and subsequent relocalization of OTR within the nucleus. There are important differences among the tested cells, such as the requirement of a ligand for transfer of OTR in nuclei. A constitutive internalization of OTR was found only in osteosarcoma cells, while the nuclear localization in all other tested cells was dependent on ligand binding. The amount of OTR-positive material within and in the vicinity of the nucleus increased following a treatment with oxytocin in both constitutive and ligand-dependent type of cells. The evidence of OTR compartmentalization at the cell nucleus (either ligand-dependent or constitutive) in different cell types suggests still unknown biological functions of this protein or its ligand and adds this G-protein-coupled receptor to other heptahelical receptors displaying this atypical and unexpected nuclear localization. 相似文献
9.
Friebe-Hoffmann U Baston DM Chiao JP Winebrenner LD Krüssel JS Hoffmann TK Hirchenhain J Rauk PN 《Regulatory peptides》2007,138(2-3):74-81
Experimental objectives: Activation of the oxytocin receptor (OTR) induces phospholipase C induced PIP(2) turnover in the human uterus. Relaxin (RLX), a polypeptide hormone produced in the corpus luteum of pregnancy as well as in the placenta and decidua inhibits PIP(2) turnover and subsequent signaling in human myometrium. The purpose of this study was to evaluate a possible effect of RLX on OTR regulation in human uterine smooth muscle cells. Primary cultures of myometrium from term pregnant women undergoing elective caesarean section were incubated for different time periods (0-96 h) and with different concentrations of RLX [10 pg/ml-20 microg/ml]. The effects on OTR binding, mRNA and protein expression were evaluated by means of (125)I-OVT binding assay, RT-PCR and flow cytometry. RESULTS: Prolonged RLX incubation was able to inhibit 30-40% of OTR binding while binding affinity remained unchanged. Oxytocin receptor mRNA and protein expression were down regulated by RLX about 50% and 35% respectively. CONCLUSION: We report for the first time an effect of RLX on OTR regulation in human uterine myometrial cells. The above results indicate that high local uterine RLX concentrations may be involved in uterine quiescence during human pregnancy by down regulating the OTR. 相似文献
10.
Myometrial quiescence during pregnancy is maintained by progesterone, which suppresses the expression of labor-associated genes such as connexin 43 (Cx43) and the oxytocin receptor (OTR). Parathyroid hormone-related protein (PTHrP) is a smooth muscle relaxant that inhibits myometrial contractions and therefore may act in synergy with progesterone to maintain myometrial quiescence during late pregnancy. We investigated the possibility that PTHrP, like progesterone, could act to suppress the expression of labor-associated genes. Pregnant rats were treated starting on Day 19 with daily i.p. injections of 100 microg/kg PTHrP (human synthetic fragment 1-34). On Day 22 of gestation, there was a significant reduction in the expression of Cx43 (mRNA and protein) and OTR (mRNA) in the myometrium of PTHrP-treated animals, whereas on Day 23 (labor) the expression of both Cx43 and OTR was unchanged by PTHrP treatment. Treatment of pregnant rats with PTHrP did not affect the time of delivery, concentrations of progesterone in maternal plasma, or levels of c-fos, fra-2, or parathyroid hormone/PTHrP receptor mRNA on any gestational day. Because PTHrP treatment delayed the dramatic increase in the expression of Cx43 and OTR, it may be an important factor in the maintenance of the quiescent state of the myometrium at a time when the concentrations of progesterone in maternal circulation decrease. PTHrP treatment did not prevent the increase in Cx43 and OTR gene expression on Day 23 or the timing of labor, suggesting that the effects of PTHrP signaling are overridden with the onset of labor. 相似文献
11.
Favre N Fanelli F Missotten M Nichols A Wilson J di Tiani M Rommel C Scheer A 《Biochemistry》2005,44(30):9990-10008
The human oxytocin receptor is known to exhibit promiscuous activity by coupling to both Galpha(q) and Galpha(i) G proteins to activate distinct signaling pathways. A single-amino acid substitution within the highly conserved E/DRY motif at the cytosolic extension of helix 3 [i.e., D136(3.49)N] increased the rate of both basal and agonist-stimulated inositol phosphate (IP(3)) accumulation of the receptor. Furthermore, like for a typical constitutively active receptor, the partial agonist arginine vasopressin behaved as a full agonist for the D136(3.49)N mutant. Subsequently, both oxytocin and arginine vasopressin showed an increased potency in stimulating IP3 accumulation as compared to the wild-type receptor. Very interestingly, our experiments provide strong evidence that the D136(3.49)N mutant inhibits receptor signaling via Galpha(i)-mediated pathways while increasing the activity through the Galpha(q)-mediated pathways. Molecular simulations of the free and OT-bound forms of wild-type OTR and of the D136(3.49)N constitutively active mutant suggest that the receptor portions close to the E/DRY and NPxxY motifs are particularly susceptible to undergoing structural modification in response to activating mutations and agonist binding. Furthermore, computational modeling suggests that the OT-bound form of wild-type OTR is able to explore more states than the OT-bound form of the D136(3.49)N constitutively active mutant, consistent with its G protein promiscuity. Taken together, these observations emphasize the important role of the E/DRY motif not only in receptor activation but also in the promiscuity of G protein coupling. Knowledge of the mechanism of selective G protein coupling could aid drug discovery efforts to identify signaling specific therapies. 相似文献
12.
T Kimura R Ivell W Rust Y Mizumoto K Ogita C Kusui Y Matsumura C Azuma Y Murata 《Biochemical and biophysical research communications》1999,264(1):86-92
The US-2 DNA-binding element (ggaatgattactcagctaga) in the promoter of the human oxytocin receptor (OTR) gene has been shown to bind specifically nuclear proteins from human myometrium at parturition. To elucidate the molecular mechanisms involved in OTR gene upregulation at term, the US-2 element was used in a yeast one-hybrid system to screen a cDNA library derived from term human myometrium. Positive clones were further screened by electrophoretic mobility shift assay for their ability to bind the human OTR gene promoter, containing the US-2 motif. A 2.3-kb full-length cDNA encoding a human homologue of chicken MafF (hMafF) was isolated. hMafF represents an 18-kDa protein and contains an extended leucine zipper structure, but lacks a transactivation domain. Furthermore, Northern hybridization showed strong hMafF mRNA expression in the kidney and in term myometrium only, but not in nonpregnant myometrium. The hMafF protein is also preferentially expressed in term myometrium, as shown by specific binding to the OTR promoter. The highly specific binding of hMafF to the US-2 motif in the human OTR gene, together with its pattern of expression, supports a role for hMafF in OTR gene upregulation at term. 相似文献
13.
Smith MP Ayad VJ Mundell SJ McArdle CA Kelly E López Bernal A 《Molecular endocrinology (Baltimore, Md.)》2006,20(2):379-388
Oxytocin (OT) has long been used as an uterotonic during labor management in women, and yet responses to OT infusion remain variable and unpredictable among patients. The investigation of oxytocin receptor (OTR) regulation will benefit labor management, because the clinical practice of continuous iv infusion of OT is not optimal. As with other G protein-coupled receptors, it is likely that the OTR internalizes and/or desensitizes upon continuous agonist exposure. The mechanisms by which this might occur, however, are unclear. Here we explore OTR internalization and desensitization in human embryonic kidney cells by utilizing inhibitors of heterologous second messenger systems and recently available mutant cDNA constructs. We report rapid and extensive internalization and desensitization of the OTR upon agonist exposure. Internalization was unaffected by inhibitors of protein kinase C or Ca(2+) calmodulin-dependant kinase II but was significantly reduced after transfection with dominant-negative mutant cDNAs of G protein-coupled receptor kinase 2, beta-Arrestin2, Dynamin, and Eps15 (a component of clathrin-coated pits). Moreover, desensitization of the OTR, measured by a calcium mobilization assay, was also inhibited by the aforementioned cDNA constructs. Thus, our data demonstrate, for the first time, the importance of the classical clathrin-mediated pathway during agonist-induced OTR internalization and desensitization. 相似文献
14.
Although the oxytocin receptor (OTR) mediates many important functions including uterine contractions, milk ejection, and maternal behavior, the mechanisms controlling agonist-induced OTR desensitization have remained unclear, and attempts to demonstrate involvement of a G protein-coupled receptor kinase (GRK) have so far failed. Using the OTR as a model, we demonstrate here directly for the first time the dynamics of agonist-induced interactions of a GRK with a G protein-coupled receptor in real time, using time-resolved bioluminescence resonance energy transfer. GRK2/receptor interactions started within 4 sec, peaked at 10 sec, and decreased to less than 40% within 8 min. By contrast, beta-arrestin/OTR interactions initiated only at 10 sec, reached plateau levels at 120 sec, but remained stable with little decrease thereafter. Physical GRK2/OTR association was further demonstrated by coimmunoprecipitation of endogenous GRK2 with activated OTR. In COS-7 cells, which express low levels of GRK2 and beta-arrestin, overexpression of GRK2 and beta-arrestin increased receptor phosphorylation, desensitization, and internalization to the high levels observed in human embryonic kidney 293 cells. By contrast, specific inhibition of endogenous GRK2 by dominant-negative mutants robustly inhibited OTR phosphorylation and internalization as well as arrestin/OTR interactions. These data characterize the temporal and causal relationship of GRK-2/OTR and beta-arrestin/OTR interactions and establish GRK/OTR interaction as a prerequisite for beta-arrestin-mediated OTR desensitization. 相似文献
15.
The effects of the peptide hormone oxytocin (OT) are mediated by the oxytocin receptor, which is a member of the G-protein-coupled receptor family. Defining differences between the binding of agonists and antagonists to the OTR, at the molecular level, is of fundamental importance to understanding OTR activation and to rational drug design. Previous reports have indicated that the N-terminus of the OTR is required for OT binding. The aim of this study was to identify which individual residues within the N-terminal domain of the human OTR provided these OT binding epitopes. A series of truncated OTRs and mutant receptor constructs with systematic alanine substitution were characterized with respect to their pharmacological profile and intracellular signaling capability. Although a number of residues within the OTR will be required for optimal OT-OTR interaction, our data establish that Arg(34) within the N-terminal domain contributes to high-affinity OT binding. Removal of Arg(34) by truncation or substitution resulted in a 2000-fold decrease in OT affinity. In addition, we show that the arginyl at this locus is required for high-affinity binding of agonists in general. However, the importance of Arg(34) is restricted to agonist interaction with the OTR, as it was not required for binding peptide antagonist or non-peptide antagonist. It is noteworthy that the corresponding Arg in the related rat V(1a) vasopressin receptor is also required for high-affinity agonist binding. This study defines, at the molecular level, the role of the N-terminus of the OTR in high-affinity agonist binding and identifies a key residue for this function. 相似文献
16.
A fundamental issue in molecular pharmacology is to define how agonist:receptor interaction differs from that of antagonist:receptor. The V(1a) receptor (V(1a)R) is a member of a family of related G-protein-coupled receptors that are activated by the neurohypophysial peptide hormone arginine-vasopressin (AVP). Here we define a short subdomain of the N-terminus of the V(1a)R from Glu(37) to Asn(47) that is an absolute requirement for binding AVP and other agonists. In marked contrast to the situation for agonists, deleting this segment has little or no effect on the binding of either peptide or non-peptide antagonists. In addition, we established that this subdomain was crucial for receptor activation and second messenger generation. The oxytocin receptor (OTR) also binds AVP with high affinity but exhibits a different pharmacological profile to the V(1a)R. Substitution of the N-terminus of the V(1a)R with the corresponding sequence from the OTR generated a chimeric receptor (OTR(N)-V(1a)R). The presence of the OTR N-terminus recovered high affinity agonist binding such that the OTR(N)-V(1a)R possessed almost wild-type V(1a)R pharmacology and signaling. Consequently, a domain within the N-terminus is required for agonist binding but it does not provide the molecular discriminator for subtype-selective agonist recognition. Cotransfection and peptide mimetic studies demonstrated that this N-terminal subdomain had to be contiguous with the receptor polypeptide to be functional. This study establishes that a segment of the V(1a)R N-terminus has a pivotal role in the mechanism of agonist binding and provides molecular insight into key differences between the interaction of agonists and antagonists with a peptide receptor family. 相似文献
17.
18.
E Politowska R Ka?mierkiewicz V Wiegand F Fahrenholz J Ciarkowski 《Acta biochimica Polonica》2001,48(1):83-93
Cholesterol, an integral component of membranes in Eucaryota, is a modifier of membrane properties. In vivo studies have demonstrated that cholesterol can also modulate activities of some G protein-coupled receptors (GPCRs), which are integral membrane proteins. This can result either from an effect of cholesterol on the membrane fluidity or from specific interactions of the membrane cholesterol with the receptor, as recently demonstrated for the cholecystokinin type beta (CCKRbeta) or the oxytocin receptor (OTR). Using molecular modelling, we studied conformational preferences of cholesterol and several of its analogues. Subsequently, we simulated the distributions of their preferred conformations around the surface of OTR, CCKRbeta and a chimeric oxytocin/cholecystokinin receptor. Consequently, we suggest residues on the surface of OTR which are potentially significant in the OTR/cholesterol interaction. 相似文献
19.
Nucleotide sequence of the alkaline phosphatase gene of Escherichia coli 总被引:33,自引:0,他引:33
The nucleotide sequence of the alkaline phosphatase (APase) gene (phoA) of Escherichia coli strain 294 has been determined. Pre-APase has a total of 471 amino acids (aa) including a signal sequence of 21 aa. The derived aa sequence differs from that obtained by protein sequencing by the presence of aspartic acid instead of asparagine at positions 16 and 36, and glutamic acid instead of glutamine at position 197. Two open reading frames (ORF1 and ORF2) located downstream from phoA or upstream from proC have been found. ORF1 encodes a putative presecretory protein of 106 aa with a signal sequence of 21 or 22 aa. If this protein is actually produced, it may be one of the smallest periplasmic proteins in E. coli. 相似文献
20.
Non-peptide antagonists of the oxytocin receptor (OTR) have been developed to prevent pre-term labour. The benzoxazinone-based antagonists L-371,257 and L-372,662 display pronounced species-dependent pharmacology with respect to selectivity for the OTR over the V(1a) vasopressin receptor. Examination of receptor sequences from different species identified Ala(318) in helix 7 of the human OTR as a candidate discriminator required for high affinity binding. The mutant receptor [A318G]OTR was engineered and characterised using ligands representing many different chemical classes. Of all the ligands investigated, only the benzoxazinone-based antagonists had decreased affinity for [A318G]OTR. Molecular modelling revealed that Ala(318) provides a direct hydrophobic contact with a methoxy group of L-371,257 and L-372,662. 相似文献