Random amplification of polymorphic DNA with conserved sequences reveals genome-specific monomorphic amplicons: Implications in clad identification

The enzymatic amplification of genomic DNA with an arbitrary primer generates informative band profile useful for genome analysis. We used a set of synthetic oligodeoxyribonucleotide primers OAT15.2 (GACA)_3.75, OAT18. 2 (GACA)_4.5, OAT24.2 (GACA)₆, OAT36 (GACA)₉, comprising 4–9 consecutive units of GACA repeat, O33.15 (CACCTCTCCACCTGCC) and 033.6 (CCTCCAGCCCTCCTCCAGCCCT) for RAPD reactions of genomic DNA from different sources. The GACA based oligos of 15 and 18 base residues generated discernible genome specific amplicons whereas primers larger than 18 bases revealed smeary signals. The other oligos O33.15 and O33.6 also generated genome specific amplicons with more bands compared with those obtained from OAT15.2 or OAT18.2. The presence of OAT15.1 (GATA)_3.75 and OAT15.2 (GACA)_3.75 sequences in different genomes were ascertained by independent dot-blot hybridization prior to using them for RAPD reactions. The RAPD amplicons generated by evolutionarily conserved primer(s) or sequences shared by many species may be useful for clad identification in controversial systematics, comparative genome analysis, and for establishing the phylogenetic status of an organism.     

The level and composition of free fatty acids in the plasma of freshwater fish in a post-absorptive condition

The level and fatty acid composition of plasma free fatty acids (FFA) were determined in four important aquaculture teleost species: goldfish (Carassius auratus), common carp (Cyprinus carpio), rainbow trout (Oncorhynchus mykiss) and tilapia (Oreochromis mossambicus). Plasma was obtained from animals after a 3 day fast in order to study the mobilization of fatty acids in a post-absorptive condition. Plasma [FFA] amounted to 0.95 in goldfish, 0.77 in both carp and rainbow trout and 0.30 μmol/ml in tilapia. The fatty acid composition was dominated by mono-unsaturates in goldfish and carp, whereas saturates were the main fatty acids in tilapia. The largest amount of PUFA was observed in rainbow trout (41%) which was considerably higher than in the other species (27–29%). The interspecies differences of plasma FFA levels and patterns are discussed in relation to the site of lipid storage, mobility and other factors.     

Parentage assessment of an IVF calf from Bubalus bubalis by DNA fingerprinting

We used two synthetic oligodeoxyribonucleotide probes, OAT18 and OMS1 comprising (TGG)₆ and (GGTA)₄ repeat motifs, respectively, in combination with HinfI enzyme for DNA fingerprinting of a calf born from embryo transfer technology, its surrogate mother (SM) and the sperm donor (bull). Of the two polymorphic probes, OAT18 was found to be more informative for correctly establishing the parentage status of the in-vitro fertilized (IVF) calf and demonstrated the genetic relationship of the SM with the bull. Two types of cluster analysis, SAHN clustering and neighbour joining tree, performed with similarity indices of these individuals produced by OAT18 probe were found to be different. Using the SAHN cluster method, SM was found to be genetically closer to the bull than to IVF calf, whereas using the neighbour joining method, IVF was closer to bull than SM. A similar result was obtained by SAHN clustering with OMS1 probe. The relevance of this approach for parentage control in the context of animal biotechnology is described.     

Identification,characterization and genetic mapping of TLR1 loci in rainbow trout (Oncorhynchus mykiss)

Induction of innate immune pathways is critical for early anti-microbial defense but there is limited understanding of how teleosts recognize microbial molecules and activate these pathways. In mammals, Toll-like receptors (TLR) 1 and 2 form a heterodimer involved in recognizing peptidoglycans and lipoproteins of microbial origin. Herein, we identify and describe the rainbow trout (Oncorhynchus mykiss) TLR1 gene ortholog and its mRNA expression. Two TLR1 loci were identified from a rainbow trout bacterial artificial chromosome (BAC) library using DNA sequencing and genetic linkage analyses. Full length cDNA clone and direct sequencing of four BACs revealed an intact omTLR1 open reading frame (ORF) located on chromosome 14 and a second locus on chromosome 25 that contains a TLR1 pseudogene. The duplicated trout loci exhibit conserved synteny with other fish genomes that extends beyond the TLR1 gene sequences. The omTLR1 gene includes a single large coding exon similar to all other described TLR1 genes, but unlike other teleosts it also has a 5′ UTR exon and intron preceding the large coding exon. The omTLR1 ORF is predicted to encode an 808 amino-acid protein with 69% similarity to the Fugu TLR1 and a conserved pattern of predicted leucine-rich repeats (LRR). Phylogenetic analysis grouped omTLR1 with other fish TLR1 genes on a separate branch from the avian TLR1 and mammalian TLR1, 6 and 10. omTLR1 expression levels in rainbow trout anterior kidney leukocytes were not affected by the human TLR2/6 and TLR2/1 agonists diacylated lipoprotein (Pam₂CSK₄) and triacylated lipoprotein (Pam₃CSK₄). However, due to the lack of TLR6 and 10 genes in teleost genomes and up-regulation of TLR1 mRNA in response to LPS and bacterial infection in other fish species we hypothesize an important role for omTLR1 in anti-microbial immunity. Therefore, the identification of a TLR2 ortholog in rainbow trout and the development of assays to measure ligand binding and downstream signaling are critical for future elucidation of omTLR1 functions.     

Environmental and anthropogenic correlates of hybridization between westslope cutthroat trout (Oncorhynchus clarkii lewisi) and introduced rainbow trout (O. mykiss)

Hybridization with introduced taxa is one of the major threats to the persistence of native biodiversity. The westslope cutthroat trout (Oncorhynchus clarkii lewisi) is found in southeastern British Columbia and southwestern Alberta, Canada, and adjacent areas of Montana, Idaho, and Washington State, USA. Through much of this area, native populations are threatened by hybridization with introduced rainbow trout (O. mykiss). We surveyed 159 samples comprising over 5,000 fish at 10 microsatellite DNA loci to assess the level of admixture between native westslope cutthroat trout (wsct) and introduced rainbow trout in southwestern Alberta. Admixture levels (q_wsct of 0 = pure rainbow trout, q_wsct of 1.0 = pure westslope cutthroat trout) ranged from <0.01 to 0.99 and averaged from 0.72 to 0.99 across seven drainage areas. Regression tree analyses indicated that water temperature, elevation, distance to the nearest stocking site, and distance to the nearest railway line were significant components of a model that explained 34 % of the variation across sites in q_wsct across 58 localities for which habitat variables were available. Partial dependence plots indicated that admixture with rainbow trout increased with increasing water temperature and distance to the nearest railway line, but decreased with increasing elevation and distance from stocking site to sample site. Our results support the hypothesis that westslope cutthroat trout may be less susceptible to hybridization with rainbow trout in colder, higher elevation streams, and illustrate the interaction between abiotic and anthropogenic factors in influencing hybridization between native and introduced taxa.     

Role of genetic background in the introgressive hybridization of rainbow trout (<Emphasis Type="Italic">Oncorhynchus mykiss</Emphasis>) with Westslope cutthroat trout (<Emphasis Type="Italic">O. clarkii lewisi</Emphasis>)

Conservation and management of endemic species may increasingly involve efforts to prevent hybridization with other species. Native westslope cutthroat trout (Oncorhynchus clarkii lewisi) management in western North America is based largely on admixture estimates with introduced rainbow trout (O. mykiss), with the highest conservation priority given to cutthroat populations that do not exhibit admixture. This study examined the hypothesis that such ancestry quotients are dependent upon the genetic background of reference rainbow trout populations. We used 10 microsatellite loci to estimate admixture within westslope cutthroat trout collected from 39 sites from Alberta, Canada, using three genetically distinct (pairwise F_ST = 0.100–0.281) rainbow trout genetic backgrounds: a wild (introduced) population from Alberta, two wild (native) populations from British Columbia, and a present-day hatchery broodstock line. Ancestry quotients were significantly impacted by genetic background, whereby the extent of admixture was highest with locally introduced (wild, naturalized) rainbow trout lines and lowest with the hatchery lines. Our results suggest that future studies ought to explore the possibility that local adaptation or drift in introduced rainbow trout populations may contribute to decreased reproductive isolation with geographically proximal cutthroat trout populations.     

Detection of QTL in Rainbow Trout Affecting Survival When Challenged with Flavobacterium psychrophilum

Bacterial cold water disease (BCWD) causes significant economic loss in salmonid aquaculture. We previously detected genetic variation in survival following challenge with Flavobacterium psychrophilum (Fp), the causative agent of BCWD in rainbow trout (Oncorhynchus mykiss). A family-based selection program to improve resistance was initiated in 2005 at the USDA National Center for Cool and Cold Water Aquaculture. Select crosses were made in 2007 and 2009 to evaluate family-based disease survival using Fp injection challenges. From each putative F₂/BC₁ family generated in 2009, 200–260 fish were challenged in 4–7 replicates per family. Whole genome QTL scans of three F₂/BC₁ families were conducted with about 270 informative microsatellite loci per family spaced at an average interval size of 6 cM throughout the rainbow trout genome. Markers on chromosomes containing QTL were further evaluated in three additional F₂/BC₁ families. The additional F₂/BC₁ families were sire or dam half-sibs (HS) of the initially genome scanned families. Overall, we identified nine major QTL on seven chromosomes that were significant or highly significant with moderate to large effects of at least 13 % of the total phenotypic variance. The largest effect QTL for BCWD resistance explaining up to 40 % of the phenotypic variance was detected on chromosome OMY8 in family 2009070 and in the combined dam HS family 2009069–070. The nine major QTL identified in this study are candidates for fine mapping to identify new markers that are tightly linked to disease resistance loci for using in marker assisted selection strategies.     

Analysis of microsatellite variation in the rainbow trout <Emphasis Type="Italic">Parasalmo (Oncorhynchus) mykiss</Emphasis> from Kamchatka

Genetic variation of Kamchatka rainbow trout Parasalmo (O.) mykiss was examined using 10 microsatellite DNA loci, and phylogeographic comparison with other representatives of the species across the distribution range was performed. It was demonstrated that Kamchatka populations differed from other geographic groups of rainbow trout in a number of microsatellite loci. These populations also displayed distinct clustering and were characterized by lower genetic diversity. Analysis of a set of 26 different microsatellite loci (personal and literature data) demonstrated that most of the populations within the Kamchatka region were separated from one another, characterized by marked geographic differentiation, and affiliation to certain river basins. In Kamchatka rainbow trout, with high degree of probability, three geographic clusters (northwestern, southwestern, and eastern) were identified. In general, analysis of microsatellite DNA supported the data on low genetic diversity of the Kamchatka group Parasalmo (O.) mykiss, based on the variation estimates for a number of genes of nuclear and mitochondrial DNA, and allozyme loci.     

Analysis of microsatellite DNA of rainbow trout (<Emphasis Type="Italic">Parasalmo</Emphasis> (<Emphasis Type="Italic">Oncorhynchus</Emphasis>) <Emphasis Type="Italic">mykiss</Emphasis>) of Kamchatka: Selection of loci and optimization of the method

The variation of a sample of rainbow trout (Parasalmo (Oncorhynchus) mykiss) from natural populations of several rivers of the Kamchatka Peninsula with respect to 43 microsatellite DNA loci has been studied. These loci were earlier used for analysis of Asian populations of closely related salmonids. Ten of them may be regarded as markers and seen promising for further studies on intraspecific relationships of rainbow trout of Kamchatka. Their use in studies on more numerous samples from different localities and populations of Parasalmo (O.) mykiss in the Asian part of the species range will ensure efficient population genetic analysis of the Kamchatka population group of this species.     

Diagnostic single nucleotide polymorphisms for identifying westslope cutthroat trout (Oncorhynchus clarki lewisi), Yellowstone cutthroat trout (Oncorhynchus clarkii bouvieri) and rainbow trout (Oncorhynchus mykiss)

We describe 12 diagnostic single nucleotide polymorphism (SNP) assays for use in species identification among rainbow and cutthroat trout: five of these loci have alleles unique to rainbow trout (Oncorhynchus mykiss), three unique to westslope cutthroat trout (O. clarkii lewisi) and four unique to Yellowstone cutthroat trout (O. clarkii bouvieri). These diagnostic assays were identified using a total of 489 individuals from 26 populations and five fish hatchery strains.     

Characterization of tetranucleotide microsatellites for Rio Grande cutthroat trout and rainbow trout,and their cross‐amplification in other cutthroat trout subspecies

We describe the isolation and characterization of 12 tetranucleotide microsatellites for Rio Grande cutthroat trout (Oncorhynchus clarkii virginalis) and rainbow trout (Oncorhynchus mykiss), and subsequently investigate their performance in Colorado River cutthroat trout (Oncorhynchus clarkii pleuriticus), greenback cutthroat trout (Oncorhynchus clarkii stomias) and Yellowstone cutthroat trout (Oncorhynchus clarki bouvieri). All 12 loci are polymorphic in all subspecies of O. clarkii examined.     

Effect of Hydrogen Peroxide on Immersion Challenge of Rainbow Trout Fry with Flavobacterium psychrophilum

An experimental model for immersion challenge of rainbow trout fry (Oncorhynchus mykiss) with Flavobacterium psychrophilum, the causative agent of rainbow trout fry syndrome and bacterial cold water disease was established in the present study. Although injection-based infection models are reliable and produce high levels of mortality attempts to establish a reproducible immersion model have been less successful. Various concentrations of hydrogen peroxide (H₂O₂) were evaluated before being used as a pre-treatment stressor prior to immersion exposure to F. psychrophilum. H₂O₂ accelerated the onset of mortality and increased mortality approximately two-fold; from 9.1% to 19.2% and from 14.7% to 30.3% in two separate experiments. Clinical signs observed in the infected fish corresponded to symptoms characteristically seen during natural outbreaks. These findings indicate that pre-treatment with H₂O₂ can increase the level of mortality in rainbow trout fry after exposure to F. psychrophilum.     

Rapid parallel evolution of standing variation in a single,complex, genomic region is associated with life history in steelhead/rainbow trout

Rapid adaptation to novel environments may drive changes in genomic regions through natural selection. Such changes may be population-specific or, alternatively, may involve parallel evolution of the same genomic region in multiple populations, if that region contains genes or co-adapted gene complexes affecting the selected trait(s). Both quantitative and population genetic approaches have identified associations between specific genomic regions and the anadromous (steelhead) and resident (rainbow trout) life-history strategies of Oncorhynchus mykiss. Here, we use genotype data from 95 single nucleotide polymorphisms and show that the distribution of variation in a large region of one chromosome, Omy5, is strongly associated with life-history differentiation in multiple above-barrier populations of rainbow trout and their anadromous steelhead ancestors. The associated loci are in strong linkage disequilibrium, suggesting the presence of a chromosomal inversion or other rearrangement limiting recombination. These results provide the first evidence of a common genomic basis for life-history variation in O. mykiss in a geographically diverse set of populations and extend our knowledge of the heritable basis of rapid adaptation of complex traits in novel habitats.     

Hybridization and phylogeography of the Mozambique tilapia <Emphasis Type="Italic">Oreochromis mossambicus</Emphasis> in southern Africa evidenced by mitochondrial and microsatellite DNA genotyping

Many Oreochromis species utilized in aquaculture were extensively introduced outside their native range in Africa. Given their recent evolutionary radiation, these species hybridize easily, posing a threat to the integrity of local adaptation. The objective of this work was to study the genetic diversity of the Mozambique tilapia (Oreochromis mossambicus) in its native range, southern Africa, and provide a method for identifying hybrids with genetic markers. We genotyped the mitochondrial DNA (mtDNA) control region (385 bp) of wild and farmed O. mossambicus, wild and farmed O. niloticus and morphologic wild hybrids. These data were complemented with published sequences of parapatric and sympatric Oreochromis taxa. Phylogeographic analysis showed the presence of two O. mossambicus lineages, the southernmost representing a recent Holocene radiation. Hybridization of O. mossambicus was indicated by the presence of O. niloticus and O. mortimeri–andersonii mtDNA specimens in the Limpopo basin and of O. karongae mtDNA in specimens from Malawi. We also genotyped seven suspected hybrid individuals from the Limpopo River, and 137 wild and farmed Mozambique and Nile tilapia samples with five microsatellite markers. Factorial Component Analysis, Bayesian clustering and assignment analyses consistently delineated an O. mossambicus and an O. niloticus group, with the putative hybrids positioned in between. Different levels of hybridization were detected by the Bayesian assignment. The complex nature of hybridization and introgression between cichlid species raises major concerns for the long-term integrity of Mozambique tilapia.     

Identifications of Captive and Wild Tilapia Species Existing in Hawaii by Mitochondrial DNA Control Region Sequence

Background

The tilapia family of the Cichlidae includes many fish species, which live in freshwater and saltwater environments. Several species, such as O. niloticus, O. aureus, and O. mossambicus, are excellent for aquaculture because these fish are easily reproduced and readily adapt to diverse environments. Historically, tilapia species, including O. mossambicus, S. melanotheron, and O. aureus, were introduced to Hawaii many decades ago, and the state of Hawaii uses the import permit policy to prevent O. niloticus from coming into the islands. However, hybrids produced from O. niloticus may already be present in the freshwater and marine environments of the islands. The purpose of this study was to identify tilapia species that exist in Hawaii using mitochondrial DNA analysis.

Methodology/Principal Findings

In this study, we analyzed 382 samples collected from 13 farm (captive) and wild tilapia populations in Oahu and the Hawaii Islands. Comparison of intraspecies variation between the mitochondrial DNA control region (mtDNA CR) and cytochrome c oxidase I (COI) gene from five populations indicated that mtDNA CR had higher nucleotide diversity than COI. A phylogenetic tree of all sampled tilapia was generated using mtDNA CR sequences. The neighbor-joining tree analysis identified seven distinctive tilapia species: O. aureus, O. mossambicus, O. niloticus, S. melanotheron, O. urolepies, T. redalli, and a hybrid of O. massambicus and O. niloticus. Of all the populations examined, 10 populations consisting of O. aureus, O. mossambicus, O. urolepis, and O. niloticus from the farmed sites were relatively pure, whereas three wild populations showed some degree of introgression and hybridization.

Conclusions/Significance

This DNA-based tilapia species identification is the first report that confirmed tilapia species identities in the wild and captive populations in Hawaii. The DNA sequence comparisons of mtDNA CR appear to be a valid method for tilapia species identification. The suspected tilapia hybrids that consist of O. niloticus are present in captive and wild populations in Hawaii.     

Complete mitochondrial DNA sequences of the Nile tilapia (<Emphasis Type="Italic">Oreochromis niloticus</Emphasis>) and Blue tilapia (<Emphasis Type="Italic">Oreochromis aureus</Emphasis>): genome characterization and phylogeny applications

Cichlid fishes have played an important role in evolutionary biology and aquaculture industry. Nile tilapia (Oreochromis niloticus), blue tilapia (Oreochromis aureus) and Mozambique tilapia (Oreochromis mossambicus), the useful models in studying evolutionary biology within Cichlid fishes, are also mainly cultured species in aquaculture with great economic importance. In this paper, the complete nucleotide sequence of the mitochondrial genome for O. niloticus and O. aureus were determined and phylogenetic analyses from mitochondrial protein-coding genes were conducted to explore their phylogenetic relationship within Cichlids. The mitogenome is 16,625 bp for O. niloticus and 16,628 bp for O. aureus, containing the same gene order and an identical number of genes or regions with the other Cichlid fishes, including 13 protein-coding genes, two rRNA genes, 22 tRNA genes and one putative control region. Phylogenetic analyses using three different computational algorithms (maximum parsimony, maximum likelihood and Bayesian method) show O. niloticus and O. mossambicus are closely related, and O. aureus has remotely phylogenetic relationship from above two fishes.     

Genetic Integrity and Microgeographic Population Structure of Westslope Cutthroat Trout, Oncorhynchus clarki lewisi, in the Pend Oreille Basin in Washington

Five microsatellite DNA loci (Ots-101 ^*,Ots-107 ^*,Oki-10 ^*, Ogo-3 ^*, and FGT-3 ^*) were screened to evaluate the genetic characteristics and population structure for cutthroat trout from eight tributaries of the Pend Oreille River in northeastern Washington and to compare these collections with two hatchery stocks of westslope cutthroat trout, Oncorhynchus clarki lewisi, Yellowstone cutthroat trout, Oncorhynchus clarki bouvieri and a hatchery rainbow trout, Oncorhynchus mykiss, strain that have been stocked in northeastern Washington. Relatively high levels of variation (numbers of alleles and heterozygosity) were observed in all collections and allele frequencies were quite variable among collections. Evidence of limited introgression by rainbow and/or Yellowstone cutthroat was found at several locations. Both F_ST values and tests of genetic differentiation indicated the existence of numerous, reproductively isolated populations. The population in Slate Creek was very similar to the Kings Lake Hatchery strain, and we conclude that this similarity is the result of historical introductions of this hatchery strain into what was presumably a stream without a native cutthroat population. In one stream, differences in introgression and allele frequencies were found above and below a barrier falls. Because of the substantial level of population differentiation observed among the various collections, we recommend that management and conservation actions be focused at the level of individual streams in order to maintain the productivity and genetic character of the existing populations of cutthroat trout.     

DNA fingerprinting in sugar beet (Beta vulgaris) — identification of double-haploid breeding lines

Summary The distribution and abundance of simple repetitive sequences complementary to the synthetic oligonucleotides (GACA)₄, (GATA)₄, (GTG)₅ and (CA)₈ in the genomes of several cultivars of Beta vulgaris and in the wild beet B. vulgaris ssp. maritima were investigated. Hybridization experiments revealed that all four motifs were present, though at different abundances, in the genomes of all of the investigated beet cultivars. Considerable intraspecific variation of the resulting DNA fingerprints was observed. The extent of polymorphism depends on the oligonucleotide probe. The most informative banding patterns were obtained with the (GATA)₄ probe hybridized to HinfI-, HaeIII-, or RsaI-restricted DNA, respectively. DNA fingerprinting with (GATA)₄ allowed a clear differentiation of double-haploid breeding lines (DH lines). We demonstrated that the application of oligonucleotide probes for DNA fingerprinting is a sensitive tool for genome diagnosis in cultivated beet.     

Characterization and expression of gamma-interferon-inducible lysosomal thiol reductase (GILT) gene in rainbow trout (Oncorhynchus mykiss) with implications for GILT in innate immune response

The interferon-γ-inducible lysosomal thiol reductase (GILT) has been demonstrated to play an important role in the processing and presentation of MHC class II-restricted antigen (Ag) by catalyzing disulfide bond reduction. In this study, a rainbow trout cDNA (designated as rGILT) was cloned and identified from Oncorhynchus mykiss. The open reading frame of rGILT consists of 759 bases encoding a protein of 253 amino acids with an estimated molecular mass of 28.23 kDa and a theoretical isoelectric point of 4.94. The rGILT exhibited a characteristic GILT signature sequence CQHGX₂ECX₂NX₄C and CXXC motif. Phylogenetic analysis suggested that rGILT had been derived from a common ancestor with other GILT proteins. RT-PCR results showed that rGILT and rIFN-γ (rainbow trout IFN-γ) mRNA was expressed in a tissue-specific manner and obviously up-regulated in splenocytes and the cells from head kidney after induction with LPS. Recombinant rGILT fused with His6 tag was efficiently expressed in Escherichia coli BL21 (DE3) and purified by Ni-NTA affinity chromatography. Further study revealed that rGILT was capable of catalyzing the reduction of the interchain disulfide bonds from intact IgG. This study shows that rGILT may be involved in the immune response to bacteria challenge and maintain first line of innate immune defense at basal level in O. mykiss. It also provides the basis for investigating on the role of GILT using O. mykiss as an animal model for related studies.