Interactions of molecules with nucleic acids. I. An algorithm to generate nucleic acid structures with an application to the B-DNA structure and a counterclockwise helix.

An algorithm is developed that enables the routine determination of backbone conformations of nucleic acids. All atomic positions including hydrogen are specified in accord with experimental bond lengths and angles but with theoretically determined conformational angles. For two Watson-Crick base pairs at a separation of 3.38 Å, and perpendicular to a common helical axis, minimum energy configurations are found for all 10 combinations at helical angles of α ～ 36°–38°, corresponding to the B-DNA structure with C(2′)-endo sugar puckers. Backbone configurations exist only within the range 35.5° ? α ? 42°, which suggests the origin of the 10-fold helix. Calculated stacking energies for the B-DNA structure increases for each of the clustered groups of base pairs: G·C with G·C, G·C with A·T, and A·T with A·T, and they are in approximate agreement with experimental observations. The counter-clockwise helix is examined, and physically meaningful structures are found only when the helical axes of successive base pairs are disjointed.     

Specific induction of transitions and transversions of G-C base pairs by 4-nitroquinoline-1-oxide in iso-1-cytochrome c mutants of yeast

The base-pair changes induced by the highly carcinogenic agent, 4-nitroquinoline-1-oxide, have been determined from the reversion rates of defined tester strains and from the amino acid replacements of revertant iso-1-cytochromes c. The mutant codons and the base-pair changes of reverse mutations of 14 cyc1 mutants were previously determined from alterations of iso-1-cytochromes c in intragenic revertants. These 14 cyc1 mutants, which were used as tester strains, included nine mutants with altered AUG initiation codons, an ochre (UAA) mutant, an amber (UAG) mutant and three frameshift mutants (Stewart et al., 1971,1972; Stewart &; Sherman, 1972,1974; Sherman &; Stewart, 1973). NQO² induced a high rate of reversion in the initiation mutant cyc1-131, the only mutant in the group which reverts to normal iso-1-cytochrome c by a G · C → A · T transition. In addition, NQO produces a significant rate of reversion of all cyc1 mutants which revert by G · C transversions, e.g. the amber (UAG) mutant and the initiation mutants containing AGG, and probably CUG mutant codons. It did not revert the ochre mutant which contains no G · C base pairs. Ten NQO-induced revertants of the amber mutant cyc1-179 contained the expected replacements of residues of tyrosine, and ten NQO-induced revertants of each of the cyc1-131 and cyc1-133 initiation mutants all contained the expected normal iso-1-cytochrome c. The structures of these iso-1-cytochromes c and the pattern of reversion of the tester strains indicate that base-pair substitutions arise at G · C base pairs which are the site of NQO attack. Thus NQO induces G · C → A · T transitions, G · C → T · A transversions and possibly G · C → C · G transversions. Because of its mode of action, NQO may be useful in less-defined systems for identifying G · C base pairs in mutant codons.     

Theoretical studies on protein-nucleic acid interactions. II. Hydrogen bonding of amino acid side chains with bases and base pairs of nucleic acids

With a view to understanding the role of hydrogen bonds in the recognition of nucleic acids by proteins, hydrogen bonding between the bases and base pairs of nucleic acids and the amino acids (Asn, Gln, Asp and Glu, and charged residues Arg⁺, Glu^?, and Asp^?) has been studied by a second-order perturbation theory. Binding energies have been calculated for all possible configurations involving a pair of hydrogen bonds between the base (or base pair) and the amino acid residue. Our results show that the hydrogen bonding in these cases has a large contribution from electrostatic interaction. In general, the charged amino acids, compared to the uncharged ones, form more stable complexes with bases or base pairs. The hydrogen-bond energies are an order of magnitude smaller than the Coulombic interaction energies between basic amino acids (Lys⁺, Arg⁺, and His⁺) and the phosphate groups of nucleic acids. The stabilities of the complexes of amino acids Asn, Gln, Asp, and Glu with bases are in the order: G–X > C–X > A–X U–X or T–X, and G · C–X > A · T(U)–X, where X is one of these amino acid residues. It has been shown that Glu^? and Asp^? can recognize guanine in single-stranded nucleic acids; Arg⁺ can recognize G · C base pairs from A · T base pairs in double-stranded structures.     

Isolation and cell-free translation of immunoglobulin messenger RNA.

The mRNA's for both the heavy chain (H³¹⁵) and the light chain (L³¹⁵) of the mineral oil-induced plasmacytoma-315 myeloma protein have been isolated and partially purified from both total cellular RNA and RNA derived from membrane-bound polysomes. The yields of both L³¹⁵ mRNA and, in particular, of H³¹⁵ mRNA were increased when total cellular RNA was used as starting material. Total poly(A)-containing mRNA and partially purified mRNA obtained by preparative sucrose gradient sedimentation stimulated protein synthesis in cell-free extracts derived from Ehrlich ascites tumor cells or wheat germ. Cell-free products antigenically and structurally related to both the authentic L³¹⁵ and H³¹⁵ secreted by intact cells were synthesized in the Ehrlich ascites cell-free system in response to the appropriate mRNA's. Only the L³¹⁵ mRNA was efficiently translated in the cell-free system derived from wheat germ.     

The Role of Structural Water in the Formation of Nucleotide Mispairs

Abstract

The results of NMR investigation of the double-helical nucleic acid fragments containing A · C, C · U, m⁶G · U and m⁶G · G mispairs can be explained on the assumption that the bases in such pairs being in usual tautomeric forms are linked via water bridges. A computer analysis of intermolecular interactions in the systems containing two bases and one or two water molecules shows that these pairs correspond to the energy minima. The formation of pairs with water bridges can be considered an intermediate step in mutagenesis caused by some spontaneous errors arising during nucleic acid biosynthesis as well in mutagenesis induced by alkylating agents.     

Spatial translational motions of base pairs in DNA molecules: Application of the extended matrix generator method

We have used the elementary generator matrices outlined in the preceding paper to examine the conformational plasticity of the nucleic acid double helix. Here we investigate kinked DNA structures made up of alternating B- and A-type helices and intrinsically curved duplexes perturbed by the intercalation of ligands. We model the B-to-A transition by the lateral translation of adjacent base pairs, and the intercalation of ligands by the vertical displacement of neighboring residues. We report a complete set of average configuration-dependent parameters, ranging from scalars (i.e., persistence lengths) to first- and second-order tensor parameters (i.e., average second moments of inertia), as well as approximations of the associated spatial distributions of the DNA and their angular correlations. The average structures of short chains (of lengths less than 100 base pairs) with local kinks or intrinsically curved sequences are essentially rigid rods. At the smallest chain lengths (10 base pairs), the kinked and curved chains exhibit similar average properties, although they are structurally perturbed compared to the standard B-DNA duplex. In contrast, at lengths of 200 base pairs, the curved and kinked chains are more compact on average and are located in a different space from the standard B- or A-DNA helix. While A-DNA is shorter and thicker than B-DNA in x-ray models, the long flexible A-DNA helix is thinner and more extended on average than its B-DNA counterpart because of more limited fluctuations in local structure. Curved polymers of 50 base pairs or longer also show significantly greater asymmetry than other DNAs (in terms of the distribution of base pairs with respect to the center of gravity of the chain). The intercalation of drugs in the curved DNA straightens and extends the smoothly deformed template. The dimensions of the average ellipsoidal boundaries defining the configurations of the intercalated polymers are roughly double those of the intrinsically curved chain. The altered proportions and orientations of these density functions reflect the changing shape and flexibility of the double helix. The calculations shed new light on the possible structural role of short A-DNA fragments in long B-type duplexes and also offer a model for understanding how GC-specific intercalative ligands can straighten naturally curved DNA. The mechanism is not immediately obvious from current models of DNA curvature, which attribute the bending of the chain to a perturbed structure in repeating tracts of A · T base pairs. © 1994 John Wiley & Sons, Inc.     

Interactions of Quinoxaline Antibiotic and DNA.: The Molecular Structure of a Triostin A—d(GCGTACGC) Complex

Abstract

The crystal structure of a DNA. octamer d(GCGTA.CGC) complexed to an antitumor antibiotic, triostin A, has been solved and refined to 2.2 Å resolution by x-ray diffraction analysis. The antibiotic molecule acts as a true bis intercalator surrouding the d(CpG) sequence at either end of the unwound right-handed DNA. double helix. A.s previously observed in the structure of triostin A.—d(CGTA.CG) complex (A.H.-J. Wang, et. al., Science, 225,1115–1121 (1984)), the alanine amino acid residues of the drug molecule form sequence-specific hydrogen bonds to guanines in the minor groove. The two central A · T base pairs are in Hoogsteen configuration with adenine in the syn conformation. In addition, the two terminal G · C base pairs flanking the quinoxaline rings are also held together by Hoogsteen base pairing. This is the first observation in an oligonucleotide of. Hoogsteen G · C base pairs where the cytosine is protonated. The principal functional components of a bis-intercalative compound are discussed.     

Selection of optimal set of wavelengths for analysis of hyperchromic spectra.

The formulae of mean-square deviations of fractions of denatured base pairs in dependence of temperature have been used for selection of optimal set of wave-lengths suited for the study of thermal denaturation dispersion of DNA and DNA complexes. A method is described, which enables the study of the first stage of thermal denaturation of complexes of DNA with basic polypeptides in terms of A · T and G · C base pairs.     

Analysis of an RNA Pseudoknot Structure by CD Spectroscopy

Abstract

The RNA PK5 (GCGAUUUCUGACCGCUUUUUUGUCAG) forms a pseudoknotted structure at low temperatures and a hairpin containing an A · C opposition at higher temperatures (J. Mol. Biol. 214, 455–470 (1990)). CD and absorption spectra of PK5 were measured at several temperatures. A basis set of spectra were fit to the spectra of PK5 using a method that can provide estimates of the numbers of A · U, G · C, and G · U base pairs as well as the number of each of 11 nearest-neighbor base pairs in an RNA (Biopolymers 31, 373–384 (1991)). The fits were close, indicating that PK5 retained the A conformation in the pseudoknot structure and that the fitting technique is not hindered by pseudoknots or A · C oppositions. The results from the analysis were consistent with the pseudoknotted structure at low temperatures and with the hairpin structure at higher temperatures. We concluded that the method of spectral analysis should be useful for determining the secondary structures of other RNAs containing pseudoknots and A · C oppositions.     

Asymmetry in forming 2-aminopurine . hydroxymethylcytosine heteroduplexes; A model giving misincorporation frequencies and rounds of DNA replication from base-pair populations in vivo

We present the first direct measurement of a transient mismatched base-pair in a 2-aminopurine-induced mutagenic pathway. We provide a model to calculate misincorporation rates in vivo from measured base-pair populations. The population of 2-aminopurine · hydroxymethylcytosine (AP · C²) base-pairs at a marker locus in T4 bacteriophage is measured as rII-r⁺ heteroduplex-heterozygotes in a modified single burst experiment after 2-aminopurine mutagenesis. This completes the determination of each of the base-pairs in the 2-aminopurine-induced A · T → G · C transition pathway for the marker rUV199. The observed AP · C population confirms a surprising model prediction that the probability of incorporating HMdCTP opposite a template 2-aminopurine is very large, approximately 2% per round of replication. AP induces A · T → G · C and G · C → A · T transitions at roughly the same rates. A quantitative comparison of 2-aminopurine-induced A · T → G · C and G · C → A · T transition pathways shows a marked asymmetry in the formation of AP · C base-pairs; the probability of forming AP · C base-pair intermediates in the A · T → G · C transition pathway is several orders of magnitude larger than in the G · C → A · T pathway. A set of analytic equations giving the population of each state of an allele undergoing 2-aminopurine mutagenesis (A · T, AP · T, AP · C and G · C) as a function of interstate (e.g. A · T → AP · T) and intrastate (e.g. A · T → A · T) transition rate constants and the number of rounds of replication is derived. The equations also demonstrate that a determination of $\text{AP}\text{·}\text{C}\text{G}\text{·}\text{C}$ base-pair ratios is a direct measure of the number of rounds of replication; thus the value of 0.35 AP · C per G · C base-pair as measured in this experiment reveals that there were eight to nine rounds of DNA replication during the mutagenesis treatment.     

High resolution nuclear magnetic resonance study of base pairing in the native and denaturated conformers of transfer RNA Leu 3

The hydrogen-bonded protons of the base pairs in the native and denatured conformers of transfer RNA₃^Leu from bakers' yeast have been investigated by high resolution proton nuclear magnetic resonance at 220 MHz. Widespread changes in the nuclear magnetic resonance spectrum observed on going from the denatured to the native state indicate a change from 18 base pairs in the former conformer to 22 in the latter, corresponding to a gain of 3 to 5 G · C pairs, and a loss of 0 to 2 A · U pairs. These changes are compared with other data on the two conformers, affording further insight into their differences.     

Sequence-dependence of the CD of synthetic double-stranded RNAs containing inosinate instead of guanylate subunits

The CD spectra and melting profiles have been measured for nine synthetic double-stranded RNAs containing I · C instead of G · C base pairs: poly[r(I) · r(C)], poly[r(I-C) · r(I-C)], poly[r(A-I-C) · r(I-C-U)], poly[r(A-C) · r(I-U)], poly[r(A-I) · r(C-U)], poly[r(A-C-C) · r(I-I-U)], poly[r(A-A-C) · r(I-U-U)], poly[r(A-C-U) · r(A-I-U)], and poly[r(A-U-C) · r(I-A-U)]. CD spectra have not previously been reported for the latter six of these polymers. The substitution of inosinate for guanylate led to recognizable CD differences, with all but two of the polymers having two resolved positive bands above 230 nm. Also, the I-containing RNAs differed from their G-containing counterparts in the almost complete absence of negative CD bands at long wavelengths and in the reduction of negative CD bands near 210 nm. First-neighbor comparisons showed that the CD spectra of the I-containing RNAs were consistent with the nearest-neighbor sequences of the polymers, as previously shown for G-containing RNAs (D. M. Gray, J.-J. Liu, R. L. Ratliff, and F. S. Allen, Biopolymers (1981) 20 , 1337–1382). Moreover, two of the first-neighbor comparisons involved spectra of poly[r(A) · r(U)] and poly[r(I) · r(C)], polymers known to be in the A family of conformations in fibers (S. Arnott, D. W. L. Hukins, S. D. Dover, W. Fuller, and A. Hodgson, (1973) J. Mol. Biol. 81 , 107–122). Thus, differences in the CD spectra of I- and G-containing RNAs could be simply explained as resulting from differences in the hypoxanthine and guanine chromophores, without invoking differences in conformation. Finally, melting temperatures of the I-containing RNAs were found to vary much less with base composition than do the melting temperatures of G-containing RNAs, since A · U base pairs are closer to I · C than to G · C base pairs in stability.     

Parallel-stranded duplex DNA containing dA · dU base pairs

DNA oligonucleotides with dA and dU residues can form duplexes with trans d(A · U) base pairing and the sugar-phosphate backbone in a parallel-stranded orientation, as previously established for oligonucleotides with d(A · T) base pairs. The properties of such parallel-stranded DNA (ps-DNA) 25-mer duplexes have been characterized by absorption (uv), CD, ir, and fluorescence spectroscopy, as well as by nuclease sensitivity. Comparisons were made with duplex molecules containing (a) dT in both strands, (b) dU in one strand and dT in the second, and (c) the same base combinations in reference antiparallel-stranded (aps) structures. Thermodynamic analysis revealed that total replacement of deoxythymine by deoxyuridine was accompanied by destabilization of the ps-helix (reduction in T_m by −13°C in 2 mM MgGl₂, 10 mM Na-cacodylate). The U-containing ps-helix (U1 · U2) also melted 14°C lower than the corresponding aps-helix under the same ionic conditions; this difference was very close to that observed between ps and aps duplexes with d(A · T) base pairs. Force field minimized structures of the various ps and aps duplexes with either d(A · T) or d(A · U) base pairs ps/aps and dT/dU combinations are presented. The energy-minimized helical parameters did not differ significantly between the DNAs containing dT and dU. © 1996 John Wiley & Sons, Inc.     

Targeting different RNA motifs by beta carboline alkaloid,harmalol: a comparative photophysical,calorimetric, and molecular docking approach

RNA has attracted recent attention for its key role in gene expression and targeting by small molecules for therapeutic intervention. This work focuses towards understanding interaction of harmalol, a DNA intercalator, with RNAs of different motifs viz. single-stranded A-form poly(A), double-stranded A-form of poly(C)·poly(G), and clover leaf tRNA^phe by different spectroscopic, calorimetric, and molecular modeling techniques. Results of this study converge to suggest that (i) binding constant varied in the order poly(C)·poly(G)?>?tRNA^phe > poly(A), (ii) non-cooperative binding of harmalol to poly(C)·poly(G) and poly(A) and cooperative binding with tRNA^phe, (iii) significant structural changes of poly(C)·poly(G) and tRNA^phe with concomitant induction of optical activity in the bound achiral alkaloid molecules, while with poly(A) no induced Circular dichroism (CD) perturbation was observed, (iv) the binding was predominantly exothermic, enthalpy-driven, entropy-favored with poly(C)·poly(G), while it was entropy driven with tRNA^phe and poly(A), (v) a hydrophobic contribution and comparatively large role of non polyelectrolytic forces to Gibbs energy changes with poly(C)·poly(G) and tRNA^phe and (vi) intercalated state of harmalol inside poly(C)·poly(G) structure as revealed from molecular docking was supported by the viscometric and ferrocyanide quenching data. All these findings unequivocally pointed out that harmalol prefers binding with poly(C)·poly(G), compared to tRNA^phe and poly(A); this results serve as data for the development of RNA-based antiviral drugs.     

Psi compaction of poly[d(AT)].poly[d(AT)]

The compaction of poly[d(A–T)] · poly[d(A–T)] by Co(III) is accompanied by the formation of ψ(+)- and ψ(-)-structures. The chirality of the ψ-structure depends on the Co(III) concentration, ionic strength, temperature, pH, and the chain length of the polymer. The two forms can be readily interconverted by manipulating these factors. Phase diagrams have been constructed that demonstrate the regions of stability of the enantiomers as a function of two variables, while other factors are held constant. At critical points in the phase diagram the two forms are in such unstable equilibrium that mechanical motion will cause ψ(+) ? ψ(-) interconversion. The formation of both ψ(+)- and ψ(-)-structures by the action of Co(III) on poly[d(A–T)] · poly[d(A–T)] contrasts markedly with the behavior of poly[d(G–C)] · poly[d(G–C)] in similar circumstances by forming only the ψ(+)-structure and that of native DNA to produce no ψ at all. Thus the base sequence is important in determining the structure of chirally associated DNA molecules.     

Letter: The isolation and properties of the specific binding sites for Escherichia coli RNA polymerase on T4 and T7 bacteriophage DNAs.

RNA polymerase of Escherichia coli was allowed to bind to labeled T4 or T7 bacteriophage DNA. The unbound and “weakly” bound polymerase molecules were removed by adding an excess of poly(I) which has a high affinity for the enzyme (Bautz et al., 1972). After the unbound DNA regions were digested with pancreatic DNAase and snake venom phosphodiesterase, the “protected” DNA-RNA polymerase complexes were isolated by Sephadex G200 column chromatography. The protected DNA sites were then isolated by phenol extraction and hydroxylapatite chromatography. Studies of the DNA recognition regions led to the following conclusions. (1) No binding is observed in the absence of the sigma subunit or at low temperatures. (2) The amount of protection ranges from 0·18% to 0·24% of T4 DNA and from 0·25% to 0·34% of T7 DNA. In the absence of poly(I), higher protections are observed and the protected regions display heterogeneity in size and secondary structure. (3) The protected regions are double-stranded, as shown by hydroxylapatite chromatography, base composition analysis, and thermal chromatography. (4) The length of the protected regions comprise about 50 to 55 nucleotide pairs, as suggested by end-group analysis, sucrose density-gradient centrifugation, and polyacrylamide gel electrophoresis. (5) The results suggest the interaction of dimeric polymerase molecules at these sites. On the basis of DNA sizes, there are 7 to 9 such sites on T4 DNA and 2 to 3 on T7 DNA. (6) The protected regions are high in (A + T): 68% for T4 and 62% for T7 DNA. (7) Thermal chromatograms reflect these base compositions and suggest the homogeneity of these regions with respect to size and base composition.     

Identification and assignment of base pairs in the "tuned helix" of intact and ribonuclease T1 cleavage fragments of wheat germ ribosomal 5S RNA via 500-MHz proton homonuclear Overhauser enhancements

Wheat germ has been chosen as a representative eukaryote for study of ribosomal 5S RNA secondary structure. Proton homonuclear Overhauser enhancements (NOE's) at 500 MHz for the hydrogen-bonded base-pair protons in the 10-15 ppm region are used to establish the identity (A X U, G X C, or G X U) and base-pair sequence (e.g., G X C-A X U-C X G) within a given helical segment. Assignment of that segment to particular base pairs in the secondary structure is based upon NOE's conducted at different temperatures (to determine which signals "melt" together), variation of salt conditions (to produce differential chemical shifts in order to better distinguish components of an unresolved spectral envelope), and isolation and purification of RNase T1 cleavage fragments (in order to reduce the spectrum to just a few base pairs). The NOE patterns for the RNase T1 fragments are the same as in the intact 5S RNA, supporting the assumption that structural features of this region in the intact 5S RNA are preserved in the fragment. Chemical shifts predicted from ring current induced effects for a proposed base-pair sequence are then compared to experimental chemical shifts. By these methods, a portion of the "tuned helix" segment (namely, the base-pair sequence C18G60-A19U59-C20G58) is demonstrated spectroscopically for the first time in any 5S RNA. The tuned helix and common arm segments are less stable than the rest of the molecule. Variation of sodium and magnesium levels reveals multiple configurations of the wheat germ 5S RNA in solution.     

Structure of azurin from Alcaligenes denitrificans refinement at 1.8 A resolution and comparison of the two crystallographically independent molecules

The structure of the blue copper protein azurin, from Alcaligenes denitrificans, has been refined crystallographically by restrained least-squares methods. The final crystallographic R value for 21,980 observed reflections to 1.8 A (1 A = 0.1 nm) resolution is 0.157. The asymmetric unit of the crystal contains two independent azurin molecules, the model for which comprises 1973 protein atoms, together with three SO2-4 ions, and 281 water molecules. Comparison of the two molecules shows very high correspondence. For 125 out of 129 residues (excluding only the chain termini, residues 1 to 2 and 128 to 129) the root-mean-square (r.m.s.) deviation in main-chain atom positions is 0.27 A. For other structural parameters r.m.s. deviations are also low; torsion angles 6.5 degrees, hydrogen bond lengths 0.12 A, bonds to copper 0.04 A and bond angles at the copper 3.9 degrees. The only significant differences are at the chain termini and in several loops. Some of these can be attributed to crystal packing effects, others to genuine structural microheterogeneity. Refinement has confirmed that the copper co-ordination is best described as distorted trigonal planar, with strong in-plane bonds to His46 N delta 1, His117 N delta 1 and Cys112 S gamma, and much weaker axial interactions with Met121 S delta and Gly45 C = O. Two N-H...S hydrogen bonds characterize Cys112 S gamma as a thiolate (S-) sulphur and may influence the visible absorption maximum. Atoms in and around the copper site have very low mobility, whereas the most mobile regions of the molecule are the chain termini and some of the connecting loops between secondary structure elements, especially those at the "southern" end, remote from the copper site. Main-chain to side-chain hydrogen bonds supply important stabilizing interactions at the "northern" end. Surface features include the hydrophobic patch around His117, probably important for electron transfer, the SO2-4 site at His83, and the general absence of ion pairs, despite the presence of many charged amino acid residues. The 281 water molecules include 182 that occur as approximately twofold-related pairs. There are no internal water molecules. The water sites common to both azurin molecules include those in surface pockets and some in intermolecular contact regions. They are characterized by relatively low thermal parameters and numerous protein contacts.     

Insight of Endo-1,4-Xylanase II from Trichoderma reesei: Conserved Water-Mediated H-Bond and Ion Pairs Interactions

Endo-1,4-Xylanase II is an enzyme which degrades the linear polysaccharide beta-1,4-xylan into xylose. This enzyme shows highest enzyme activity around 55 °C, even without being stabilized by the disulphide bridges. A set of nine high resolution crystal structures of Xylanase II (1.11–1.80 Å) from Trichoderma reesei were selected and analyzed in order to identify the invariant water molecules, ion pairs and water-mediated ionic interactions. The crystal structure (PDB-id: 2DFB) solved at highest resolution (1.11 Å) was chosen as the reference and the remaining structures were treated as mobile molecules. These structures were then superimposed with the reference molecule to observe the invariant water molecules using 3-dimensional structural superposition server. A total of 37 water molecules were identified to be invariant molecules in all the crystal structures, of which 26 invariant molecules have hydrogen bond interactions with the back bone of residues and 21 invariant water molecules have interactions with side chain residues. The structural and functional roles of these water molecules and ion pairs have been discussed. The results show that the invariant water molecules and ion pairs may be involved in maintaining the structural architecture, dynamics and function of the Endo-1,4-Xylanase II.