Priming affects the activity of a specific region of the promoter of the human beta interferon gene.

Treatment of Daudi or HeLa cells with human interferon (IFN) alpha 8 before induction with either poly(I)-poly(C) or Sendai virus resulted in an 8- to 100-fold increase in IFN production. The extent of priming in Daudi cells paralleled the increase in the intracellular content of IFN-beta mRNA. IFN-alpha mRNA remained undetectable in poly(I)-poly(C)-treated Daudi cells either before or after priming. An IFN-resistant clone of Daudi cells was found to produce 4- to 20-fold more IFN after priming, indicating that priming was unrelated to the phenotype of IFN sensitivity. IFN treatment of either Daudi or HeLa cells transfected with the human IFN-beta promoter (-282 to -37) linked to the chloramphenicol acetyltransferase (CAT) gene resulted in an increase in CAT activity after induction with poly(I)-poly(C) or Sendai virus. A synthetic double-stranded oligonucleotide corresponding to an authentic 30-base-pair (bp) region of the human IFN-beta promoter between positions -91 and -62 was found to confer virus inducibility upon the reporter CAT gene in HeLa cells. IFN treatment of HeLa cells transfected with this 30-bp region of the IFN-beta promoter in either the correct or reversed orientation also increased CAT activity upon subsequent induction. IFN treatment alone had no detectable effect on the activity of either the 30-bp region or the complete human IFN promoter.     

Modulation of astrocyte inducible nitric oxide synthase and cytokine expression by interferon beta is associated with induction and inhibition of interferon gamma-activated sequence binding activity

Although interferon (IFN)-beta is firmly established as a therapeutic agent for multiple sclerosis, information regarding its role in astrocyte cytokine production is limited. In primary cultures of human astrocytes, we determined the effects of IFN-beta on astrocyte cytokine [tumor necrosis factor-alpha (TNF-alpha) and interleukin (IL)-6] and inducible nitric oxide synthase (iNOS) expression by ribonuclease protection assay and ELISA. We found that IFN-beta inhibited astrocyte cytokine/iNOS induced by IL-1 plus IFN-gamma, but in the absence of IFN-gamma, IFN-beta enhanced IL-1-induced cytokine/iNOS expression. Electrophoretic mobility shift analysis (EMSA) demonstrated that IFN-gamma induced sustained IFN-gamma-activated sequence (GAS) binding, while IFN-beta induced transient GAS binding. When used together, IFN-beta inhibited IFN-gamma-induced GAS binding activity. Nuclear factor-kappa B (NF-kappaB) activation was not altered by either IFNs, whereas IFN stimulated response element (ISRE) was only activated by IFN-beta and not IFN-gamma. These results suggest that IFN-beta can both mimic and antagonize the effect of IFN-gamma by modulating induction of nuclear GAS binding activity. Our results demonstrating differential regulation of astrocyte cytokine/iNOS induction by IFN-beta are novel and have implications for inflammatory diseases of the human CNS.     

Novel cAMP regulatory elements in the promoter region of bovine P-450(11 beta) gene

In order to elucidate the cAMP regulatory elements in the promoter region of bovine P-450(11 beta) genes, we analyzed the promoter region using chloramphenicol acetyltransferase (CAT) gene as the reporter. Various deletion plasmids were constructed using the promoter region of CB11 beta-7, which is one of the two normal genes. Examination of the effects of Bt2cAMP on the CAT activities of mouse adrenal tumor cells (Y-1 cells) transfected with these deletion plasmids suggested that two elements named Ad3 and Ad4 play major roles in the induction by cAMP. Ad3(AAGATAAGGCACCCATCCATCTT) is located at -306 bp to -284 bp and Ad4 (CCAAGGTC) is located at -331 bp to -324 bp in the promoter region of the P-450(11 beta) gene. Deletions of both Ad3 and Ad4 resulted in a large decrease of the induction ratio from 9- to 3-fold. Coexistence of Ad3 and Ad4 is essential for their function, because any mutations introduced into either one of them resulted in a decrease of the cAMP induction ratio. These two elements are highly conserved among bovine, mouse, and human P-450(11 beta) genes and have no similarity with known cAMP regulatory elements. DNase I footprint analysis indicated that factors which specifically bind to the two elements exist in the nuclear extract of bovine adrenal cortex cells. Ad3 and Ad4 showed different patterns in gel shift analysis using probes which contained Ad3 or Ad4 sequence, suggesting their interaction with different nuclear factors. We also found two other protected regions by DNase I footprint analysis of the promoter regions of P-450(11 beta) gene, and named them Ad5 and Ad6.(ABSTRACT TRUNCATED AT 250 WORDS)     

Differential effects of type I IFN and IFN-gamma on the binding of tumor necrosis factor to receptors in two human cell lines

The effect of IFN-alpha and IFN-beta on the expression of cell surface receptors for tumor necrosis factor (TNF) was examined in two human cell lines. In HeLa cells, IFN-alpha and IFN-beta increased 125I-TNF binding, whereas in HT-29 cells these two IFN either slightly decreased or had no effect on 125I-TNF binding. In contrast, IFN-gamma increased 125I-TNF binding in both cell lines. Both IFN-alpha and IFN-beta exerted an antagonistic effect on IFN-gamma-induced stimulation of TNF receptor expression in HT-29 cells, but did not inhibit TNF receptor induction by IFN-gamma in HeLa cells. IFN-gamma and, to a lesser extent, IFN-beta were synergistic with TNF in producing cytotoxic/cytostatic activity in HT-29 cells. Despite the inhibitory effect of IFN-beta on the IFN-gamma-induced stimulation of TNF receptor expression, IFN-beta did not inhibit the synergistic enhancement of TNF cytotoxicity by IFN-gamma in HT-29 cells. The dissociation between the effects of IFN-beta on TNF receptor expression and on the cytotoxic activity of TNF in HT-29 cells suggests that TNF receptor modulation is not a major mechanism of synergism between IFN and TNF.     

Complex formation of the interferon (IFN) consensus sequence-binding protein with IRF-1 is essential for murine macrophage IFN-gamma-induced iNOS gene expression

This study describes the role of the interferon (IFN) consensus sequence-binding protein (ICSBP or IRF-8) in iNOS gene expression by murine macrophages. An ICSBP binding site in the iNOS promoter region (-923 to -913) was identified using an electrophoretic mobility shift assay and chromatin co-immunoprecipitation. Overexpression of ICSBP greatly enhanced IFN-gamma-induced iNOS promoter activation in RAW264.7 cells, and IFN-gamma-induced iNOS promoter activation was abolished in ICSBP-/- macrophages. Furthermore, transduction of retrovirus-ICSBP in ICSBP-/- macrophages rescued IFN-gamma-induced iNOS gene expression. However, transduction of retrovirus-ICSBP in the absence of IFN-gamma activation did not induce iNOS expression in either RAW264.7 cells or ICSBP-/- macrophages. Interestingly, ICSBP alone transduced into ICSBP-/- macrophages did not bind to IFN-stimulated response element site (-923 to -913) of the iNOS promoter region, although following activation with IFN-gamma, a DNA.protein complex was formed that contains ICSBP and IRF-1. Co-transduction of ICSBP with IRF-1 clearly induces nitric oxide production. In addition, interleukin-4 inhibits IFN-gamma-induced iNOS gene expression by attenuating the physical interaction of ICSBP with IRF-1. Complex formation of ICSBP with IRF-1 is essential for iNOS expression, and interleukin-4 attenuates the physical interaction of ICSBP with IRF-1 resulting in the inhibition of INOS gene expression.