A general method for the direct isolation of the 3'-terminal fragments derived from transfer RNA molecules

A general procedure for the isolation of 3′-linked fragments derived from tRNA molecules is described. Purified N-2-naphthoxyacetylglycyl derivatives of the $\text{tRNA}{}_1{}^{\mathrm{Gly}}$ and $\text{tRNA}{}_2{}^{\mathrm{Gly}}$ of yeast were exhaustively digested with RNase T₁ and the 3′-linked fragments (bearing the derivative) were separated from other degradation products (lacking the derivative) by stepwise chromatography on BD-cellulose. Subsequent chromatographic resolution and base-composition analysis allowed tentative identification of the 3′-terminals of $\text{tRNA}{}_1{}^{\mathrm{Gly}}$ and $\text{tRNA}{}_2{}^{\mathrm{Gly}}$ as Gp(Cp,Ap)CpCpA and Gp(Cp,Cp,Up,Ap)CpCpA, respectively. The potential utility of this procedure for development of a novel approach to nucleic acid sequence analysis is discussed.     

The aminoacyl-tRNA synthetase-tRNA complex: detection by differential labelling of lysine residues involved in complex formation

The interaction of tRNA^Tyr with tyrosyl-tRNA synthetase from Bacillus stearothermophilus was studied by differential acetylation of lysine residues. The synthetase was trace-labelled in the free form and as the synthetase-tRNA^Tyr complex with [³H]acetic anhydride. In a second step the two ³H-labelled enzyme preparations were fully acetylated with cold reagent under denaturing conditions and were mixed with synthetase that had been homogeneously labelled with excess [¹⁴C]acetic anhydride. Peptides containing labelled lysine residues were isolated after chymotryptic digestion and their ${}^{14}\text{C}{}^3\text{H}$ ratios were determined. These ratios reflect the reactivity of primary amino groups towards acetic anhydride.Involvement of lysine side-chains in complex formation with tRNA^Tyr was suggested from altered ${}^{14}\text{C}{}^3\text{H}$ ratios. Out of the 22 primary amino groups of tyrosyl-tRNA synthetase at least three showed reduced reactivities towards acetic anhydride in the synthetase-tRNA^Tyr complex by factors of 1.6, 1.9 and 6.8, respectively. The sequences around these lysine residues have been determined enabling their placement when the primary and tertiary structure of the enzyme are available (G. L. E. Koch, to be published). No lysine residue of increased reactivity in the synthetase-tRNA^Tyr complex has been detected.Only one molecule of tRNA^Tyr binds to the dimeric synthetase molecule under the conditions of the differential labelling. If the binding site for the tRNA is on one of the two identical subunits, any observed decrease in chemical reactivity of a particular lysine residue should not exceed a factor of two. The detection of a lysine residue which reacts about seven times more slowly in the synthetase-tRNA complex could therefore indicate that the single binding site is formed by both enzyme subunits.     

A comparison between inosine- and guanosine-containing anticodons in ribosome-free codon-anticodon binding

Binding of the ribooligomers, AUC, AUU, AUA, AUCA, AUUA, and AUAA to the isoleucine-accepting tRNAs, tRNA${}_{\mathrm{<mtext>T.\; utilis</mtext>}}{}^{\mathrm{Ile}}$ (anticodon, -IAU-) and tRNA${}_{\mathrm{<mtext>E.\; coli</mtext>}}{}^{\mathrm{Ile}}$ (anticodon, -GAU-) was measured by equilibrium dialysis. With the aid of Scatchard plots, AUCA was shown to bind to one site per tRNA molecule, presumably the anticodon. AUA and AUAA did not measurably attach to either anticodon in the ribosome-free system. All other oligomers were bound to tRNA${}_{\mathrm{<mtext>E.\; coli</mtext>}}{}^{\mathrm{Ile}}$ about 5 to 13 times stronger than to tRNA${}_{\mathrm{<mtext>T.\; utilis</mtext>}}{}^{\mathrm{Ile}}$.     

Properties of the 5'-terminus of tRNAHis: kinetics of polynucleotide kinase catalyzed exchange and effect of dephosphorylation on the aminoacylation reaction.

Bacteriophage T₄ induced polynucleotide kinase was found to be ineffective in transferring ³²P from [γ-³²P]ATP to the 5′-terminus of 5′-phosphorylated $\text{E. coli}$ tRNA^His using the ADP mediated exchange reaction. However, prior dephosphorylation with alkaline phosphatase allowed polynucleotide kinase catalyzed phosphorylation of tRNA^His. Contrary to reports for other tRNA species, alkaline phosphatase catalyzed 5′-terminus dephosphorylation destroys the amino acid accepting ability of tRNA^His. Aminoacylation competency of the tRNA^His is restored after phosphorylation with polynucleotide kinase.     

A new assay for ATP sulfurylase based on differential solubility of the sodium salts of adenosine 5′-phosphosulfate and sulfate

A new assay for ATP sulfurylase (ATP:sulfate adenylyltransferase, EC 2.7.7.4) has been devised, the key feature of which is the quantitative precipitation of the unreacted substrate as Na₂SO₄, in ethanol:water (5:1), leaving the product adenosine 5′-phosphosulfate (APS) in solution with an 80% yield. This separation procedure, coupled with the use of $\text{[}{}^{35}\text{S]SO}{}_4{}^{\mathrm{2?}}$, makes it possible to assay the synthesis of picomole amounts of [³⁵S]APS and thereby determine accurately the initial velocity of the forward reaction catalyzed by ATP sulfurylase. Extracts from tobacco cells synthesized [³⁵S]APS and a negligible amount of one unknown sulfur compond, but they did not synthesize 3′-phosphoadenosine 5′-[³⁵S]phosphosulfate (PAPS) under the assay conditions adopted, so that the ³⁵S remaining in solution after ethanol precipitation of $\text{[}{}^{35}\text{S]SO}{}_4{}^{\mathrm{2?}}$ is a valid assay of the ATP sulfurylase reaction in these extracts. This assay is simple, rapid, and suitable for assaying multiple samples. Extracts of four additional species of plants were incubated under the same conditions, and each catalyzed the synthesis of [³⁵S]APS according to this assay. The assay is suitable for use with the enzyme from any organism, provided that the product APS is not acted upon by another enzyme.     

Anticodon loop sequences of transfer RNACGASer and transfer RNAIGASer from the posterior silkgland of Bombyxmori L

The adaptive level of tRNAs to their use for synthesizing silk proteins involves three isoaccepting serine tRNAs. The two lipophilic tRNA_2a and tRNA_2b species from the posterior silkgland of the silkworm $\text{Bombyx}\text{mori}$, which are able to decode the UCG and UCU, UCC, UCA respectively, have been purified by counter-current distribution. They have been subjected to pancreatic and T₁ ribonucleases digestion. Resulting oligoribonucleotides have been analyzed and partially sequenced. The IGA anticodon found in the dodecanucleotide: $\text{Y-A-G-A-m}{}^3\text{C-U-}\text{I-G-A}\text{-i}{}^6\text{A-A-ψp}$ for the preponderant tRNA_2b is consistent with the occurrence of UCA as the main serine codon in fibroin mRNA. A CGA anticodon has been detected in the homologous fragment of a minor isoaccepting tRNA_2a.     

Activation of heart sarcolemmal Ca2+/Mg2+ ATPase by cyclic AMP-dependent protein kinase.

The sarcolemmal membrane obtained from rat heart by hypotonic shock-LiBr treatment method was found to incorporate ³²P from [γ-³²P] ATP in the absence and presence of cyclic AMP and protein kinase. The phosphorylated membrane showed an increase in Ca²⁺ ATPase and Mg²⁺ ATPase activities without any changes in Na⁺K⁺ ATPase activity. The observed increase in $\text{Ca}{}^{\mathrm{2+}}\text{Mg}{}^{\mathrm{2+}}$ ATPase activity was found to be associated with an increase in V_max value of the reaction whereas K_a value for $\text{Ca}{}^{\mathrm{2+}}\text{Mg}{}^{\mathrm{2+}}$ was not altered. These results provide information concerning biochemical mechanism for increased calcium entry due to hormones which are known to elevate cyclic AMP levels in myocardium and produce a positive inotropic effect.     

Non-sterol metabolism of mevalonate in vitro: artifacts and realities.

Commercial [5-¹⁴C]mevalonate is shown to contain several radioactive impurities, which give artifactually high amounts of Hyamine bound, volatile acidic radioactivity when incubated with killed or living rat renal cortex slices, as compared with [5-¹⁴C]mevalonate purified either by liquid-liquid partition chromatography or through the enzymically generated $\text{R}\text{-5-phospho-[5-}{}^{14}\text{C]mevalonate}$ by ion-exchange chromatography. The artifactual ${}^{14}\text{CO}{}_2$ results were not diluted by incubation with increasing amounts of unlabelled mevalonate, whereas the ${}^{14}\text{CO}{}_2$ and [${}^{14}\text{C}$]cholesterol produced by rat renal cortex slices incubated with purified [5-¹⁴C]mevalonate were both diluted to the same extent by unlabelled mevalonate. It is concluded that $\text{R}\text{[5-}{}^{14}\text{C]mevalonate}$ is genuinely oxidized to ${}^{14}\text{CO}{}_2\text{in}\text{vitro}$, and that purification of substrate before its use is necessary. Production of ${}^{14}\text{CO}{}_2$ and various [${}^{14}\text{C}$]lipids from purified [5-¹⁴C]mevalonate, as a function of time and substrate concentration, by renal cortex and liver slices, is described.     

Characterization of beta-adrenergic receptor and adenylate cyclase in canine cerebellum.

Binding of (?)-[${}^3\text{H}$]dihydroalprenolol to the synaptic membrane fractions of canine cerebellum was rapid and reversible with rate constants of 1.62 × 10⁸m^?1 min^?1 and 0.189 min^?1 for the forward and reverse reactions, respectively. The binding was of high affinity and saturable with an equilibrium dissociation constant (K_D) of 5 to 7 nm. Bound (?)-[${}^3\text{H}$]-dihydroalprenolol was displaceable with β-adrenergic agonists and antagonists, but not with a variety of other neuroactive substances such as acetylcholine, histamine, serotonin, dopamine, tyramine, (?)-phenylephrine, γ-aminobutyric acid, glycine, and glutamic acid. Adenylate cyclase of the membranes was stimulated at most three times by β-adrenergic agonists, but not significantly by the other neuroactive substances. Guanine nucleotides such as GTP and guanyl-5′-yl imidodiphosphate (Gpp(NH)p) were strictly required for β-adrenergic stimulation of adenylate cyclase with their optimum concentrations of 50 μm, although the nucleotides alone elevated virtually no basal activity. The affinities of β-adrenergic ligands including some stereoisomers for (?)-[${}^3\text{H}$]dihydroalprenolol binding sites were very similar to those for adenylate cyclase in the presence of GTP. Binding of β-adrenergic agonists to the membranes exhibited an apparent negative cooperativity as determined by displacement of (?)-[${}^3\text{H}$]dihydroalprenolol in the absence of purine nucleotides. This negative cooperativity was entirely abolished by addition of either GTP or Gpp(NH)p at 50 μm. Both (?)-isoproterenol-stimulated adenylate cyclase activity and binding of (?)-[${}^3\text{H}$]dihydroalprenolol were not affected by β₁-selective antagonists, (±)-atenolol, and (±)-practolol, at concentrations which completely inhibit peripheral β₁-responses in vitro, whereas β₂-selective agonists such as YM-08316 (BD-40A) and (±)-salbutamol not only stimulated adenylate cyclase but also competitively inhibited binding of (?)-[${}^3\text{H}$]dihydroalprenolol. These results indicate that canine cerebellar adenylate cyclase may be coupled specifically with β₂-adrenergic receptor.     

Comparison of the structures of the native form of rat liver 5S rRNA and yeast tRNAphe: small-angle and wide-angle X-ray scattering study

The small-angle and wide-angle X-ray scattering of tRNA^phe (yeast) and ribosomal 5S RNA (rat liver) in solution have been analysed and compared. tRNA^phe in solution is folded into a compact L-shaped structure similar to its structure in crystals. The geometry of the secondary structure of the double helical regions is also equivalent to the A-form in the crystalline state. Despite differences between the molar mosses of 5S rRNA (40 000 g mol^?1) and tRNA^phe (25 000 g mol^?1), and the fact that the 5S rRNA molecule is more anisometric than the tRNA^phe molecule, there are many structural similarities. The geometrical parameters of the secondary structure of double helical regions in both RNA molecules are almost identical; the mean rise per base pair is about 0.253–0.28 nm and the mean turn angle is about 32.5–33.5. Identical cross-sectional radii of gyration, R_sq,1 ≈ 1.16 nm and R_sq,2 = 0.92 nm, identical molar mass per unit length, , and a mean thickness of the molecules D ≈ 1.65 nm suggest a similar, nearly coplanar organization of isolated, double helical arms. Furthermore, there are compact regions in the central parts of both molecules, which are the sites of tertiary interactions in the tRNA^phe molecule and are a potential site of tertiary interactions in the SS rRNA molecule for stabilization of the complicated L-shape of the two molecules. Both molecules have a pseudo-twofold axis,w hich may play a role in recognition for binding of specific proteins.     

Calcium induction of transglutaminase and the formation of epsilon(gamma-glutamyl) lysine cross-links in cultured mouse epidermal cells

A lysine tRNA (anticodon U¹UU) was isolated from rat liver mitochondria and sequenced. The sequence, pCAUUGCGAm¹Am²GCUUAGAGCm²GUUAACCU$\text{U}{}^1\text{UU}$-t⁶AAGUUAAAGUUAGAGACAACAAAUCUCCACAAUGACCA_OH, can be written in cloverleaf form. It exhibits many unorthodox features, perhaps the most strikking of which is the small size of the D-arm consisting of only 9 nucleotides. The anticodon loop contains 2 hypermodified nucleotides, U¹27 (probably 5-methoxycarbonylmethyluridine) and t⁶A30 (N-[N-(9-β-D-ribofuranosylpurin-6-yl)carbamoyl]threonine). The presence of U¹ in the first (“wobble”) position of the anticodon probably prevents the lysine tRNA from reading asparagine (AAY) codons. t⁶A, which is 3′-adjacent to the anticodon in most tRNAs recognizing codons starting with A, and other modified nucleosides occupy expected positions. We hypothesize that enzymes modifying the wobble position and the position 3′-adjacent to the anticodon recognize specific nucleotides in the anticodon.     

An enzymatic method for [32P]phosphoenolpyruvate synthesis

A convenient method for the enzymatic synthesis of [³²P]phosphoenolpyruvate from [γ-³²P]ATP using partially pufified phosphoenolpyruvate carboxykinase from Escherichia coli is described. The synthesis was shown to convert essentially all the [γ-³²P]ATP to [³²P]phosphoenolpyruvate, which was subsequently separated from residual [γ-³²P]ATP and $\text{[}{}^{32}\text{P}\text{]P}{}_{\mathrm{<mtext>i</mtext>}}$ by chromatography on AG-1-X8-bicarbonate resin.     

The presence of two (Na+ + K+)-ATPase inhibitors in equine muscle ATP: Vanadate and a dithioerythritol-dependent inhibitor

A potent inhibitor of $\text{(Na}{}^{\mathrm{+}}\text{+ K}{}^{\mathrm{+}}\text{)-ATPase}$ activity was purified from Sigma equine muscle ATP by cation- and anion-exchange chromatography. The isolated inhibitor was identified by atomic absorption spectroscopy and proton resonance spectroscopy to be an inorganic vanadate. The isolated vanadate and a solution of V₂O₅ inhibit sarcolemma $\text{(Na}{}^{\mathrm{+}}\text{+ K}{}^{\mathrm{+}}\text{)-ATPase}$ with an $\text{I}{}_{50}$ of 1 μM in the presence of 1 mM $\text{ethyleneglycol-bis-(β-aminoethylether)}\text{-N,N′-}\text{tetraacetic}$ acid (EGTA), 145 mM NaCl, 6mM MgCl₂, 15 mM KCl and 2 mM synthetic ATP. The potency of the isolated vanadate in increased by free Mg²⁺. The inhibition is half maximally reversed by 250 μM epinephrine. Equine muscle ATP was also found to contain a second $\text{(Na}{}^{\mathrm{+}}\text{+ K}{}^{\mathrm{+}}\text{)-ATPase}$ inhibitor which depends on the sulfhydryl-reducing agent dithioerythritol for inhibition. This unknown inhibitor does not depend on free Mg²⁺ and is half maximally reversed by 2 μM epinephrine. Prolonged storage or freeze-thawing of enzyme preparations decreases the susceptibility of the $\text{(Na}{}^{\mathrm{+}}\text{+ K}{}^{\mathrm{+}}\text{)-ATPase}$ to this inhibitor. The adrenergic blocking agents, propranolol and phentolamine, do not block the catecholamine reactivation. The inhibitors in equine muscle ATP also inhibit highly purified $\text{(Na}{}^{\mathrm{+}}\text{+ K}{}^{\mathrm{+}}\text{)-ATPase}$ from shark rectal gland and eel electroplax. The inhibitors in equine muscle ATP have no effect on the other sarcolemmal ATPases, Mg²⁺-ATPase, Ca²⁺-ATPase and $\text{(Ca}{}^{\mathrm{2+}}\text{+ Mg}{}^{\mathrm{2+}}\text{)-ATPase}$.     

Ligand binding properties of the sarcoplasmic reticulum (Ca2+ + Mg2+)-ATPase labelled with N-cyclohexyl-N′-(4-dimethylamino-α-naphthyl)carbodiimide

The $\text{(Ca}{}^{\mathrm{2+}}\text{+ Mg}{}^{\mathrm{2+}}\text{)-ATPase}$ of rabbit sarcoplasmic reticulum, when labelled at two Ca²⁺-protected sites with $\text{N-}\text{cyclohexyl}\text{-N′-(4-}\text{dimethylamino}\text{-α-}\text{naphthyl}\text{)}\text{carbodiimide}$ (NCD-4) retains Ca²⁺ binding capacity at the sites with $\text{K}{}_{\mathrm{<mtext>d</mtext>}}$ values of approx. 3 μM and 0.12 mM as assessed by fluorescence titration. The sites correspond to the two high-affinity Ca²⁺ binding sites present in the native ATPase. The NCD-4 labelled ATPase exhibits slow conformational changes at each site on addition of Ca²⁺. It retains the ability to form phosphoenzyme, and can most likely translocate Ca²⁺.     

An overall radioassay for the first three reactions of de novo pyrimidine biosynthesis

A sensitive radioassay is described for the overall biosynthetic activity of the multienzymatic protein which catalyzes the first three reactions of de novo pyrimidine biosynthesis in mammals. The ability of the multienzymatic protein to synthesize dihydroorotate can be assayed using $\text{[}{}^{14}\text{C]HCO}{}_3{}^{\mathrm{?}}$, l-[¹⁴C]aspartate, or [${}^{14}\text{C}$] carbamyl phosphate as substrate. The synthesis of the final product, l-dihydroorotate, may be coupled to synthesis of orotidine 5′-monophosphate to overcome the unfavorable equilibrium existing between l-dihydroorotate and its precursor, N-carbamyl-l-aspartate, in the physiological pH range (Christopherson, R. I., and Jones, M. E., 1979, J. Biol. Chem.254, 12506–12512). l-Aspartate and all pyrimidine intermediates from carbamyl phosphate to orotidine 5′-monophosphate can be clearly separated by ion-exchange chromatography in a single dimension on polyethyleneimine-cellulose chromatograms and carbamyl phosphate and its degradation product cyanate may be quantitated directly along with the other intermediates.     

Author index

The ionic influence and ouabain sensitivity of lymphocyte Mg²⁺-ATPase and $\text{Mg}{}^{\mathrm{2+}}\text{-(Na}{}^{\mathrm{+}}\text{+ K}{}^{\mathrm{+}}\text{)-activated}$ ATPase were studied in intact cells, microsomal fraction and isolated plasma membranes. The active site of 5′-nucleotidase and Mg²⁺-ATPase seemed to be localized on the external side of the plasma membrane whereas the ATP binding site of $\text{(Na}{}^{\mathrm{+}}\text{+ K}{}^{\mathrm{+}}\text{)-ATPase}$ was located inside the membrane.Concanavalin A induced an early stimulation of Mg²⁺-ATPase and $\text{(Na}{}^{\mathrm{+}}\text{+ K}{}^{\mathrm{+}}\text{)-ATPase}$ both on intact cells and purified plasma membranes. In contrast, 5′-nucleotidase activity was not affected by the mitogen. Although the thymocyte Mg²⁺-ATPase activity was 3–5 times lower than in spleen lymphocytes, it was much more stimulated in the former cells (about 40 versus 20 %). $\text{(Na}{}^{\mathrm{+}}\text{+ K}{}^{\mathrm{+}}\text{)-ATPase}$ activity was undetectable in thymocytes. However, in spleen lymphocytes $\text{(Na}{}^{\mathrm{+}}\text{+ K}{}^{\mathrm{+}}\text{)-ATPase}$ activity can be detected and was 30 % increased by concanavalin A. Several aspects of this enzymic stimulation had also characteristic features of blast transformation induced by concanavalin A, suggesting a possible role of these enzymes, especially Mg²⁺-ATPase, in lymphocyte stimulation.     

The influence of temperature and gamma-aminobutyric acid on benzodiazepine receptor subtypes in the hippocampus of the rat

The influence of GABA on the affinity of flunitrazepam (FLU) for benzodiazepine receptor subtypes (type I and II) was studied by measurement of the competitive inhibition of [³H]FLU and [³H]propyl beta-carboline-3-carboxylate ([³H]PCC) binding. When assays were carried out at 0°C using a low concentration (0.040 nM) of [³H]PCC so that the type I receptors were selectively labelled, no significant effect of GABA (10^?4 M) on the $\text{FLU}\text{[}{}^3\text{H]}\text{PCC}$ competition curve was detected. In contrast, when assays were carried out at 0°C using [³H]FLU or a high concentration of [³H]PCC to achieve [³H]ligand receptor occupancy of both type I and type II receptors, GABA (10^?4 M) caused a significant increase in the affinity of FLU as measured by $\text{FLU}\text{[}{}^3\text{H]}\text{FLU}$ and $\text{FLU}\text{[}{}^3\text{H]}\text{PCC}$ competition experiments. Collectively, these data suggest that the influence of GABA on benzodiazepine receptor binding is mediated, primarily, by the type II receptor. It was also noted that the $\text{PCC}\text{[}{}^3\text{H]}\text{FLU}$ competition curve had a Hill coefficient of approximately 1 at 37°C as compared to the results of experiments at 0°C during which a Hill coefficient of approximately 0.7 was calculated.     

Identification of Ca2+-pump-related phosphoprotein in plasma membrane vesicles of Ehrlich ascites carcinoma cells

Plasma membrane vesicles of Ehrlich ascites carcinoma cells have been isolated to a high degree of purity. In the presence of Mg²⁺, the plasma membrane preparation exhibits a Ca²⁺-dependent ATPase activity of 2 μmol P_i per h per mg protein. It is suggested that this $\text{(}\text{Ca}{}^{\mathrm{2+}}\text{+}\text{Mg}{}^{\mathrm{2+}}\text{)-}\text{ATPase}$ activity is related to the measured Ca²⁺ transport which was characterized by $\text{K}{}_{\mathrm{<mtext>m</mtext>}}$ values for ATP and Ca²⁺ of $\text{44 ± 9 μ}\text{M}$ and $\text{0.25 ± 0.10 μ}\text{M}$, respectively. Phosphorylation of plasma membranes with [γ-³²P]ATP and analysis of the radioactive species by polyacrylamide gel electrophoresis revealed a Ca²⁺-dependent hydroxylamine-sensitive phosphoprotein with a molecular mass of 135 kDa. Molecular mass and other data differentiate this phosphoprotein from the catalytic subunit of $\text{(}\text{Na}{}^{\mathrm{+}}\text{+}\text{K}{}^{\mathrm{+}}\text{)-}\text{ATPase}$ and from the catalytic subunit of $\text{(}\text{Ca}{}^{\mathrm{2+}}\text{+}\text{Mg}{}^{\mathrm{2+}}\text{)-}\text{ATPase}$ of endoplasmic reticulum. It is suggested that the 135 kDa phosphoprotein represents the phosphorylated catalytic subunit of the $\text{(}\text{Ca}{}^{\mathrm{2+}}\text{+}\text{Mg}{}^{\mathrm{2+}}\text{)-}\text{ATPase}$ of the plasma membrane of Ehrlich ascites carcinoma cells. This finding is discussed in relation to previous attempts to identify a Ca²⁺-pump in plasma membranes isolated from nucleated cells.     

Occurrence of passive furosemide-sensitive transmembrane potassium transport in cultured cells

Furosemide ($\text{1 · 10}{}^{\mathrm{?4}}\text{M}$) inhibits a proportion of the total passive (ouabain-insensitive) K⁺ influx into primary chick heart cell cultures (85%), BC₃H1 cells (75%), MDCK cells (40%) and HeLa cells (57%). This action of furosemide upon K⁺ influx is independent of ($\text{Na}{}^{\mathrm{+}}\text{+}\text{K}{}^{\mathrm{+}}\text{)-}\text{pump}$ inhibition since the furosemide-sensitive component of the K⁺ influx is identical in the presence and absence of ouabain ($\text{1 · 10}{}^{\mathrm{?3}}\text{M}$). For HeLa cells the passive, furosemide-sensitive component of K⁺ influx is markedly dependent upon the external K⁺, Na⁺ and Cl^? content. Acetate, iodide and nitrate are ineffective as substitutes for Cl^?, whereas Br^? is partially effective. Partial Cl^? replacement by NO₃^? gave an apparent affinity of 100 mM [Cl]. Na⁺ replacement by choline⁺ abolishes the furosemide-sensitive component, whereas Li⁺ replacement reduces this component by 48%. Partial Na⁺ replacement by choline⁺ gives an apparent affinity of 25 mM [Na⁺]. Variation in the external K⁺ content gives an affinity for the furosemide-sensitive component of approx. 1.0 mM. Furosemide inhibition of the passive K⁺ inflúx is of high affinity, half-maximal inhibition being observed at $\text{5 · 10}{}^{\mathrm{?6}}\text{M}$ furosemide. Piretanide ($\text{1 · 10}{}^{\mathrm{?4}}\text{M}$) and phloretin ($\text{1 · 10}{}^{\mathrm{?4}}\text{M}$) inhibit the same component of passive K⁺ influx as furosemide; ethacrynic acid and amiloride ($\text{both}\text{1 · 10}{}^{\mathrm{?4}}\text{M}$) partially so. The stilbene, SITS ($\text{1 · 10}{}^{\mathrm{?6}}\text{M}$), was ineffective as an inhibitor of the furosemide-sensitive component.     

Ligand-dependent reactivity of (Na+ + K+)-ATPase with showdomycin

Showdomycin inhibited pig brain ($\text{Na}{}^{\mathrm{+}}\text{+}\text{K}{}^{\mathrm{+}}\text{)-}\text{ATPase}$ with pseudo first-order kinetics. The rate of inhibition by showdomycin was examined in the presence of 16 combinations of four ligands, i.e., Na⁺, K⁺, Mg²⁺ and ATP, and was found to depend on the ligands added. Combinations of ligands were divided into five groups in terms of the magnitude of the rate constant; in the order of decreasing rate constants these were: (1)$\text{Na}{}^{\mathrm{+}}\text{+}\text{Mg}{}^{\mathrm{2+}}\text{+}\text{ATP}$, (2) $\text{Mg}{}^{\mathrm{2+}}$, $\text{Mg}{}^{\mathrm{2+}}\text{+}\text{K}{}^{\mathrm{+}}$, $\text{K}{}^{\mathrm{+}}$ and none, (3) $\text{Na}{}^{\mathrm{+}}\text{+}\text{Mg}{}^{\mathrm{2+}}\text{,}\text{Na}{}^{\mathrm{+}}$, $\text{K}{}^{\mathrm{+}}\text{+}\text{Na}{}^{\mathrm{+}}$ and $\text{Na}{}^{\mathrm{+}}\text{+}\text{K}{}^{\mathrm{+}}\text{+}\text{Mg}{}^{\mathrm{2+}}$, (4) $\text{Mg}{}^{\mathrm{2+}}\text{+}\text{K}{}^{\mathrm{+}}\text{+}\text{ATP}\text{,}\text{K}{}^{\mathrm{+}}\text{+}\text{ATP}$ and $\text{Mg}{}^{\mathrm{2+}}\text{+}\text{ATP}\text{, (5)}\text{K}{}^{\mathrm{+}}\text{+}\text{Na}{}^{\mathrm{+}}\text{+}\text{ATP}$, $\text{Na}{}^{\mathrm{+}}\text{+}\text{ATP}$, $\text{Na}{}^{\mathrm{+}}\text{+}\text{ATP}$, $\text{Na}{}^{\mathrm{+}}\text{+}\text{K}{}^{\mathrm{+}}\text{+}\text{Mg}{}^{\mathrm{2+}}\text{+}\text{ATP}$ and ATP. The highest rate was obtained in the presence of Na⁺, Mg²⁺ and ATP. The apparent concentrations of Na⁺, Mg²⁺ and ATP for half-maximum stimulation of inhibition ($\text{K}{}_{0.5}{}^{\mathrm{<mtext>s</mtext>}}$) were 3 mM, 0.13 mM and 4μM, respectively. The rate was unchanged upon further increase in Na⁺ concentration from 140 to 1000 mM. The rates of inhibition could be explained on the basis of the enzyme forms present, including E₁, E₂, ES, E₁-P and E₂-P, i.e., E₂ has higher reactivity with showdomycin than E₁, while E₂-P has almost the same reactivity as E₁-P. We conclude that the reaction of ($\text{Na}{}^{\mathrm{+}}\text{+}\text{K}{}^{\mathrm{+}}\text{)-}\text{ATPase}$ proceeds via at least four kinds of enzyme form (E₁, E₂, E₁ · nucleotide and EP), which all have different conformations.