The NGFI-B protein, an inducible member of the thyroid/steroid receptor family, is rapidly modified posttranslationally.

The NGFI-B gene is rapidly activated by a variety of stimuli that induce cells to differentiate or proliferate. It encodes a protein with a predicted molecular mass of congruent to 61 kDa and is a member of the thyroid/steroid hormone receptor gene family. To characterize this protein, monoclonal antibodies were raised against a bacterial TrpE-NGFI-B fusion protein that encompasses a large portion (Glu-410 to Leu-527) of the carboxy-terminal domain of NGFI-B. These antibodies detected a protein that was rapidly synthesized in response to nerve growth factor (NGF) and migrated as a broad band on sodium dodecyl sulfate-polyacrylamide gels with an apparent molecular mass that ranged from 63 to 88 kDa. Pulse-chase analysis demonstrated that NGFI-B was rapidly posttranslationally modified and was a short-lived protein. NGFI-B was found to be a phosphorylated protein, and the multiple NGFI-B species coalesced into a single, more rapidly migrating species when treated with alkaline phosphatase. PC12 cells grown in the absence of NGF contained low levels of NGFI-B that was underphosphorylated. Epidermal growth factor, phorbol ester, and the calcium ionophore A23187 stimulated the synthesis of NGFI-B that was composed largely of underphosphorylated, rapidly migrating species. In contrast, basic fibroblast growth factor, which promotes differentiation of PC12 cells, induced the synthesis of NGFI-B species similar to those synthesized in response to NGF treatment. The underphosphorylated NGFI-B found in uninduced PC12 cells was found only in the nucleus, whereas NGFI-B in NGF-stimulated PC12 cells was present in approximately equal quantities in the cytoplasm and nucleus. Consistent with the cellular distribution observed in nonstimulated PC12 cells, the highly phosphorylated species were predominantly cytoplasmic whereas the more rapidly migrating forms were nuclear.     

Biochemical and immunological studies of bovine and porcine neurofilament triplet proteins by peptide mapping after cyanogen bromide cleavage

Peptide mapping of the three bovine and porcine neurofilament protein subunits ("L", "M" and "H") with apparent mol. wts of 70, 160 and 210 kDa were performed with CNBr, leading to the cleavage of methionyl bonds. We have obtained two characteristic large fragments with molecular weights of 85 kDa for the "M" bovine subunit and 135 kDa for the "H" subunit of bovine neurofilament. A comparison of the electrophoretic patterns of CNBr generated polypeptides of "L" subunit from beef and pig showed that they are highly related structures. The peptide mappings of CNBr peptides of "M" and "H" subunits from beef and pig were significantly different. Antibodies were raised against the 85 kDa and 135 kDa CNBr fragments. Immunoblotting results with anti-85 kDa and anti-135 kDa of beef are in favour of large differences of structure between the "M" subunits from pig and beef. The "H" proteins were very similar and they also showed that the C-terminal part of bovine "H" and "M" proteins share common antigenic determinants.     

Cell-cell interactions modulate the responsiveness of PC12 cells to nerve growth factor

The growth of PC12 cells on a collagen substratum or on monolayers of several non-neuronal cell types was studied by measuring nerve growth factor (NGF)-dependent increases in the expression of a 150 X 10(3) (Mr) neurofilament protein subunit and the membrane glycoprotein Thy-1. Both responses were found to be greatly suppressed in cultures of fibroblasts as compared to the C2 and G8-1 muscle cell lines and the C6 glioma cell line. This suppression was associated with an inhibition of NGF-dependent neuritic outgrowth from PC12 cells grown on fibroblast monolayers. There was no evidence that fibroblasts secrete soluble molecules that directly inhibit these responses or neutralize NGF. In addition, there was no difference in the neurofilament protein response from PC12 cells that had been treated with NGF prior to coculture, and the now primed PC12 cells readily extended axons over fibroblast monolayers. These data demonstrate that cell-cell and/or cell-matrix interactions can modulate biochemical responses to NGF and suggest that responsiveness of neuronal cells to environmental cues is not immutable. Control of the latter may be at the level of expression of receptor molecules for cell-surface- or matrix-associated macromolecules and a similar mechanism operating during development could play a role in growth cone guidance.     

Nerve Growth Factor-Induced Changes in the Structure of Sulfated Proteoglycans in PC 12 Pheochromocytoma Cells

Structural changes in proteoglycans (PGs) were examined during the neuritogenesis of PC12 cells induced by nerve growth factor (NGF). (1) A heparan sulfate (HS) PG and a chondroitin sulfate (CS) PG were synthesized by PC12 cells, irrespective of the presence of NGF or the duration of culture. PGs released from PC12 cells into the culture medium were mostly CSPGs. (2) In the absence of NGF, the apparent molecular mass of HSPG prepared from PC12 cells after 3 days of culture was in the range of 90-190 kDa for the intact form (Kav = 0.38 on Sepharose CL-6B), 12 kDa for HS, and 61 kDa for the core protein. In the presence of NGF, these values were 90-190 kDa, 10 kDa, and 51 kDa and 61 kDa, respectively. The intact forms of cell-associated CSPG had apparent molecular mass ranges of 120-150 kDa and 120-190 kDa (Kav = 0.38 and 0.34), with CSs of 15 kDa and 20 kDa in the presence and absence of NGF, respectively. The apparent molecular mass of the core protein of cell-associated CSPG was 92 kDa, irrespective of the presence of NGF. The molecular sizes of cell-associated PGs and their glycosaminoglycans remained unchanged during culture. (3) CSPGs released by PC12 cells into the culture medium were separated into two peaks (I and II) by column chromatography on DEAE-cellulose. The peak II fraction prepared from the medium with NGF after 3 days of culture consisted of CSPG with Kav = 0.22 on Sephacryl S-300 [40-84 kDa by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)].(ABSTRACT TRUNCATED AT 250 WORDS)     

Differential turnover of phosphate groups on neurofilament subunits in mammalian neurons in vivo

The phosphorylation and dephosphorylation of specific proteins was demonstrated directly in the intact vertebrate nervous system in vivo. By exploiting the neurons' ability to segregate a select group of cytoskeletal proteins from most other phosphorylated constituents of the cell by axoplasmic transport, we were able to examine the dynamics of phosphate turnover on neurofilament proteins in mouse retinal ganglion cell neurons simultaneously labeled with [32P]orthophosphate and [3H]proline in vivo. Three [3H]proline-labeled neurofilament protein (NFP) subunits, designated H (160-200 kDa), M (135-145 kDa), and L (68-70 kDa), entered optic axons in a mole:mole ratio similar to that of isolated axonal neurofilaments, supporting the notion that newly synthesized NFPs are transported along axons as assembled neurofilaments. NFP subunits incorporated high levels of 32P before reaching axonal sites at the level of the optic nerve. As neurofilaments were transported along axons, however, many initially incorporated [32P]phosphate groups were removed. Loss of these phosphate groups occurred to a different extent on each subunit. A minimum of 50-60 and 35-40% of the labeled phosphate groups was removed in a 5-day period from the L and M subunits, respectively. By contrast, the H subunit exhibited relatively little or no phosphate turnover during the same period. Dephosphorylation of L in axons is accompanied by a decrease in its net state of phosphorylation; changes in the phosphorylation state of H and M, however, also reflect ongoing addition of phosphates to these polypeptides during axonal transport (Nixon, R.A., Lewis, S.E., and Marotta, C.A. (1986) J. Neurosci., in press). The possibility is raised that dynamic rearrangements of phosphate topography on NFPs represent a mechanism to coordinate interactions of neurofilaments with other proteins as these elements are transported and incorporated into the stationary cytoskeleton along retinal ganglion cell axons.     

A Comparison of In Vitro- and In Vivo Phosphorylated Neurofilament Polypeptides

Abstract: Neurofilament polypeptides phosphorylated in vitro by incubation of neurofilament-enriched preparations from rat CNS with [γ-³²P]ATP were compared with the corresponding polypeptides labeled in vivo by injection of ³²P_i into the lateral ventricles of rats. Autoradiography of sodium dodecyl sulfate (SDS)-polyacrylamide gels revealed that the major phosphorylated species in both preparations were the three neurofilament subunits, which have molecular weights of 200K, 145K, and 68K. However, the relative levels of ³²P detected in the three in vitro -labeled subunits differed from the relative in vivo levels. The two larger neurofilament polypeptides displayed similar ³²P isoprotein distribution patterns on two-dimensional gels, whereas additional isoproteins were seen in the in vitro -labeled 68K species. Limited proteolysis in SDS-polyacrylamide gels revealed the presence of common phosphopeptides in the corresponding pairs of in vitro- and in vivo-labeled subunits, but the in vivo -labeled 145K and in vitro -labeled 200K polypeptides contained additional digestion products. Two-dimensional peptide mapping of the 68K polypeptide digested with a mixture of trypsin and chymotrypsin indicated that this component was phosphorylated at a single, identical site, both in vivo and in vitro. These results indicate that the protein kinase that copurifies with neurofilament preparations may be involved in their in vivo phosphorylation.     

Nerve growth factor regulates both the phosphorylation and steady-state levels of microtubule-associated protein 1.2 (MAP1.2)

This study characterizes effects of nerve growth factor (NGF) on the steady-state level and phosphorylation of a high molecular mass microtubule-associated protein in PC12 rat pheochromocytoma cells. Past work showed that NGF significantly raises the relative levels of this phosphoprotein, designated MAP1.2, with a time course similar to that of neurite outgrowth. To study this in greater detail, MAP1.2 in PC12 cell lysates was resolved by SDS-PAGE in gels containing 3.25% acrylamide/4 M urea and identified by comigration with material immunoprecipitated from the lysates by MAP1 antibodies. Quantification by metabolic radiolabeling with [35S]methionine or by silver staining revealed a 3.0-3.5-fold increase in MAP1.2 levels relative to total cell protein after NGF treatment for 2 wk or longer. A partial increase was detectable after 3 d, but not after 2 h of NGF exposure. As measured by incorporation of [32P]phosphate, NGF had a dual effect on MAP1.2. Within 15 min to 2 h, NGF enhanced the incorporation of phosphate into MAP1.2 by two- to threefold relative to total cell phosphoproteins. This value slowly increased thereafter so that by 2 wk or more of NGF exposure, the average enhancement of phosphate incorporation per MAP1.2 molecule was over fourfold. The rapid action of NGF on MAP1.2 could not be mimicked by either epidermal growth factor, a permeant cAMP derivative, phorbol ester, or elevated K+, each of which alters phosphorylation of other PC12 cell proteins. SDS-PAGE revealed multiple forms of MAP1.2 which, based on the effects of alkaline phosphatase on their electrophoretic mobilities, differ, at least in part, in extent of phosphorylation. Before NGF treatment, most PC12 cell MAP1.2 is in more rapidly migrating, relatively poorly phosphorylated forms. After long-term NGF exposure, most is in more slowly migrating, more highly phosphorylated forms. The effects of NGF on the rapid phosphorylation of MAP1.2 and on the long-term large increase in highly phosphorylated MAP1.2 forms could play major functional roles in NGF-mediated neuronal differentiation. Such roles may include effects on microtubule assembly, stability, and cross-linking and, possibly for the rapid effects, nuclear signaling.     

The Differential Role of Protein Kinase C Isozyme in the Rapid Induction of Neurofilament Phosphorylation by Nerve Growth Factor and Phorbol Esters in PC12 Cells

We examined the short-term regulation of the phosphorylation of the mid-sized neurofilament subunit (NF-M) by kinases which were activated in rat pheochromocytoma (PC12) cells by nerve growth factor (NGF) and/or 12-O-tetradecanoylphorbol 13-acetate (TPA). We found that NGF and TPA, alone or in combination, increased (a) the incorporation of [32P]Pi into NF-M and (b) the rate of conversion of NF-M from a poorly phosphorylated to a more highly phosphorylated form. This was not due to increased synthesis of NF-M, because NGF alone did not increase NF-M synthesis and TPA alone or TPA and NGF together inhibited the synthesis of NF-M. Further, an increase in calcium/phospholipid-dependent kinase (PKC) activity resulting from the treatment of PC12 cells with NGF and TPA was observed concomitant with the increased phosphorylation of NF-M. This PKC activity was determined to be derived from the PKC alpha and PKC beta isozymes. Finally, when PC12 cells were rendered PKC-deficient by treatment with 1 muM TPA for 24 h, NGF maintained the ability to induce an increase in NF-M phosphorylation, though not to the level attained in cells which were not PKC-deficient. These data suggest that NGF with or without TPA stimulates NF-M phosphorylation as a result of a complex series of events which include PKC-independent and PKC-dependent pathways.     

Cholera Toxin and Dibutyryl Cyclic AMP Inhibit the Expression of Neurofilament Protein Induced by Nerve Growth Factor in Cultures of Naive and Primed PC12 Cells

The effects of nerve growth factor (NGF), dibutyryl cyclic AMP (db cAMP), and cholera toxin on neurofilament protein expression in cultures of PC12 rat pheochromocytoma cells were examined using an enzyme-linked immunoadsorbent assay (ELISA). Morphological differentiation induced by NGF was associated with up to 30-fold increases in the level of neurofilament protein recognised by monoclonal antibody RT97. A more rapid response was apparent from primed as compared to naive PC12 cells. Cholera toxin and db cAMP both induced morphological differentiation of naive PC12 cells, but failed to promote neurite regeneration from primed cells. Neither response was associated with a significant induction of neurofilament protein. Both cholera toxin and db cAMP, but not B-cholera toxin nor antibodies to the toxin receptor, were found to inhibit the neurofilament protein response induced by NGF. Primed cells were more susceptible to this inhibition, and both cholera toxin and db cAMP inhibited neurite regeneration from these cells. These data suggest that increased intracellular cyclic AMP can suppress the expression of neuronal differentiation antigens induced by NGF, and are consistent with a role for neurofilament protein in promoting or facilitating the formation of a stable neuritic network.     

Isolation and characterization of a glycosylated form of beta nerve growth factor in mouse submandibular glands

In the course of characterizing polyclonal antibodies to beta nerve growth factor (NGF) on immunoblot replicas of sodium dodecyl sulfate gels, we observed a protein (designated C protein) migrating as two bands (14.0 and 13.5 kDa) that copurifies with NGF and reacts strongly with its antibodies. The molecule is detectable in the 7 S, beta, and 2.5 S forms of NGF, accounting in the latter two for approximately 2% of total protein. The C protein can be separated from the A and B chains of beta-NGF on acetic acid-urea gels and on two-dimensional gels but not by isoelectric focusing alone. The molecule has been isolated to near purity on reversed-phase high performance liquid chromatography. Amino acid analyses and sequencing through 49 Edman cycles revealed that the protein preparation is composed of the intact and desoctapeptide (des-(1-8] polypeptide chains and suggested a glycosylation site at Asn-45. Following digestion with N-glycanase, the chains migrated on sodium dodecyl sulfate gels identically with the A and B chains of beta-NGF. Although this was accompanied by some degree of proteolytic degradation, the presence of glucosamine (approximately 4 mol/mol of single chain) was confirmed in acid hydrolysates on the amino acid analyzer. No amino sugars were detected in hydrolysates of the A chain nor was galactosamine recovered in either preparation. Glycosylated NGF promotes neuronal growth and survival in a manner indistinguishable from native 2.5 S NGF when tested in the chick sensory ganglion assay and with rat postnatal sympathetic neurons in a dissociated culture cell survival assay or in a compartmentalized culture growth assay. These studies reveal that NGF can be modified by glycosylation in a manner that does not reduce its biological activity.     

Ecto-Protein Kinase and Surface Protein Phosphorylation in PC12 Cells: Interactions with Nerve Growth Factor

Abstract: The phosphorylation of surface proteins by ectoprotein kinase has been proposed to play a role in mechanisms underlying neuronal differentiation and their responsiveness to nerve growth factor (NGF). PC 12 clones represent an optimal model for investigating the mode of action of NGF in a homogeneous cell population. In the present study we obtained evidence that PC12 cells possess ectoprotein kinase and characterized the endogenous phosphorylation of its surface protein substrates. PC12 cells maintained in a chemically defined medium exhibited phosphorylation of proteins by [γ-³²P]ATP added to the medium at time points preceding the intracellular phosphorylation of proteins in cells labeled with ³²P_i. This activity was abolished by adding apyrase or trypsin to the medium but was not sensitive to addition of an excess of unlabeled P_i. As also expected from ecto-protein kinase activity, PC12 cells catalyzed the phosphorylation of an exogenous protein substrate added to the medium, dephospho-α-casein, and this activity competed with the endogenous phosphorylation for extracellular ATP. Based on these criteria, three protein components migrating in sodium dodecyl sulfate gels with apparent molecular weights of 105K, 39K, and 20K were identified as exclusive substrates of ecto-protein kinase in PC12 cells. Of the phosphate incorporated into these proteins from extracellular ATP, 75–87% was found in phosphothreonine. The phosphorylation of the 39K protein by ecto-protein kinase did not require Mg²⁺, implicating this activity in the previously demonstrated regulation of Ca²⁺-dependent, high-affinity norepinephrine uptake in PC12 cells by extracellular ATP. The protein kinase inhibitor K-252a inhibited both intra- and extracellular protein phosphorylation in intact PC12 cells. Its hydrophilic analogue K-252b, had only minimal effects on intracellular protein phosphorylation but readily inhibited the phosphorylation of specific substrates of ecto-protein kinase in PC12 cells incubated with extracellular ATP, suggesting the involvement of ecto-protein kinase in the reported inhibition of NGF-induced neurite extension by K-252b. Preincubation of PC12 cells with 50 ng/ml of NGF for 5 min stimulated the activity of ecto-protein kinase toward all its endogenous substrates. Exposure of PC12 cells to the same NGF concentration for 3 days revealed another substrate of ecto-protein kinase, a 53K protein, whose surface phosphorylation is expressed only after NGF-induced neuronal differentiation. In the concentration range (10–100 μM) at which 6-thioguanine blocked NGF-promoted neurite outgrowth in PC12 cells, 6-thioguanine effectively inhibited the phosphorylation of specific proteins by ecto-protein kinase. This study provides the basis for continued investigation of the involvement of ecto-protein kinase and its surface protein substrates in neuronal differentiation, neuritogenesis, and synaptogenesis.     

Isolation and purification of a Campylobacter upsaliensis autolysin.

Autolytic activity in the soluble and sediment fractions of sonicates of the spiral and the coccoid form of Campylobacter upsaliensis could not be demonstrated by native (nondenaturing) polyacrylamide gel electrophoresis (PAGE). Autolysins were detected, however, by using denaturing sodium dodecyl sulfate (SDS)-PAGE gels containing either purified Escherichia coli peptidoglycan or whole cells of Micrococcus luteus (Micrococcus lysodeikticus) as the turbid substrate, with subsequent renaturation by treatment with Triton X-100 buffer. In renaturing gels that contained Escherichia coli peptidoglycan, 14 putative autolytic bands ranging from 200 to 12 kDa were detected. In similar gels containing whole cells of M. luteus, only a single band appeared with a molecular mass of 34 kDa. This band corresponded to one of the bands present in the gels containing Escherichia coli peptidoglycan. This common autolysin was isolated by adsorbing it from Campylobacter upsaliensis soluble fractions onto M. luteus cells and then subjecting these cells to renaturing SDS-PAGE in gels containing Escherichia coli peptidoglycan. The 34-kDa autolysin differed from a single 51-kDa autolysin unique to the M. luteus cells, and when isolated from an SDS-PAGE gel, was pure when tested by isoelectric focusing. The N-terminal amino acid sequence analysis showed the first 15 amino acids of the 34-kDa autolysin to have 67% identity to a part of antigenic protein PEB4 of Campylobacter jejuni. The purified autolysin was used to immunize rabbits and the antibodies produced precipitated autolytic activity from cell lysates. The specificity of the antibodies was shown by Western blotting: only a single specific band occurred, with a molecular mass of 34 kDa, and thus it seems unlikely that the 34-kDa autolysin was derived from any of the other autolysins that were detected.     

Alterations in lipid-linked oligosaccharide metabolism in human melanoma cells concomitant with induction of stress proteins

Challenge of human A375 melanoma cells with sodium arsenite induced the synthesis of stress proteins and stimulated [3H]mannose incorporation into a novel component migrating on sodium dodecyl sulfate-polyacrylamide gel electrophoresis with an apparent molecular mass of 14 kDa (designated M14). Enhanced M14 expression was elicited by heavy metals (zinc, copper, cadmium, and nickel), thiol-reactive agents (iodoacetamide and auranofin), and hyperthermia. The kinetics of M14 induction and recovery from stress were similar to those of the stress proteins, but M14 half-life was only 15 min. Incorporation of [3H]mannose into M14 was inhibited by tunicamycin but not by cycloheximide or actinomycin D. M14 was metabolically labeled with [32P]orthophosphate but not by [35S] methionine or [3H]asparagine. Further studies revealed that M14 was selectively soluble in chloroform/methanol/water (10:10:3) and sensitive to both endo-beta-N-acetylglucosaminidase H digestion and mild acid hydrolysis. The latter released a water-soluble mannose-labeled moiety which eluted from Bio-Gel P-6 in a manner similar to Glc3Man9GlcNAc2. Together, these data suggest that M14 is a lipid-oligosaccharide intermediate of N-linked protein glycosylation and that enhanced expression of this class of molecule in response to chemical insults and hyperthermia is a newly described cellular reaction to stress.     

Hidden receptors for nerve growth factor in PC12 cells

The binding of nerve growth factor (NGF) to its receptors in PC12 cells was studied in two experimental conditions: (a) cell fixation with paraformaldehyde followed by permeabilization of the plasma membrane with methanol and (b) metabolic poisoning of living cells with sodium azide. Paraformaldehyde fixation of PC12 cells causes a 60-70% reduction of NGF binding capacity; the original binding capacity is restored following permeabilization with methanol. A kinetic analysis of NGF binding under these conditions reveals a single homogeneous population of receptors at variance with experiments performed in living cells where two kinetically distinct types of NGF receptors were demonstrated [Landreth, G. E. and Shooter, E. M. (1980) Proc. Natl Acad. Sci. USA, 77, 4751-4755; Schechter, A. L. and Bothwell, M. A. (1981) Cell, 24, 867-874]. Our results suggest that a proportion of the NGF receptors in PC12 cells is hidden, i.e. not available for binding to the ligand, and in a dynamic equilibrium with exposed receptors. The existence of hidden receptors is confirmed by treatment of PC12 cells with sodium azide, which causes a 50% reduction in NGF binding capacity and protection from trypsin digestion of the remaining pool of hidden receptors. The latter become exposed at the cell surface following removal of sodium azide. Our data provide an interpretation for the as yet unsatisfactorily explained data on NGF receptors.     

L cells potentiate the effect of the extracellular NGF activity in co-cultures with PC12 pheochromocytoma cells

Two mouse cell lines, 3T3 and L, reported to secrete an NGF-like activity in the culture medium were co-cultured with the pheochromocytoma cell line PC12 which responds to NGF in vitro. In these co-cultures mitomycin-treated L or 3T3 cells were employed at low cell density (1 000 cells/cm2). L cells, but not 3T3, promoted efficiently neurite outgrowth of PC12. The response of the PC12 cells was blocked by an antiserum to male mouse submaxillary gland beta NGF. The NGF secreted by the L cells and immunoprecipitated by this antiserum co-migrated with the submaxillary gland beta NGF monomer in SDS-polyacrylamide gels. Surprisingly the neurite-promoting activity of media conditioned by L or by L-PC12 co-cultures was at most one-tenth of that expected on the basis of the response of PC12 cells in the co-cultures. This was not due to proteolytic degradation of the NGF-like factor or to losses by manipulation of the media. It seems therefore that co-cultures provide conditions which enhance the effect of the factor. Possible mechanisms responsible for this effect are discussed.     

Nerve growth factor inhibits PC12 cell PDE 2 phosphodiesterase activity and increases PDE 2 binding to phosphoproteins

Nerve growth factor (NGF) has been shown to increase cyclic AMP in PC12 cells and to potentiate the actions of other agents that raise cyclic AMP. In our studies, NGF causes over 50% loss of PDE 2 activity (cyclic GMP-stimulated cyclic nucleotide phosphodiesterase) in PC12 cells within 24 h. After 72 h of NGF treatment, cyclic AMP hydrolysis in PC12 extracts is no longer cyclic GMP-stimulated. NGF deprivation increases the phosphodiesterase activity of treated cells. NGF does not decrease either PDE 2 mRNA or immunoreactivity of PDE 2A2 protein. Incubation of whole cells with micromolar Na(3)VO(4) mimics NGF treatment, reducing PDE 2 activity in PC12 cells by over 50% after 24 h, suggesting a phosphoprotein-mediated regulation of PDE 2 activity. Protein kinase inhibitor effects were difficult to assess due to their direct interaction with the PDE in cell lysates. To study phosphorylation in PDE 2 regulation, PDE 2A2 was epitope-tagged, and stable clonal PC12 cell transfectants were isolated (PC12B cells). When combined with metabolically labeled (32)P-phosphoproteins in vivo or in vitro, phosphoproteins of 108, 90, 64, 43, 33 and 19 kDa coprecipitated with epitope-tagged PDE 2A2 in an NGF sensitive manner. A 23-kDa phosphoprotein containing immunoreactive phosphoserine associated with the complex in an NGF independent manner. Phosphothreonine plus phosphotyrosine immunoreactivity at 23, 24, and 64 kDa as well as the phosphotyrosine immunoreactivity at 108, 90, 64, 43, 33, and 19 kDa required NGF or orthovanadate treatment. These proteins are hypothesized to be part of an NGF-regulated complex controlling PDE 2A2 activity.     

Quadruplex DNA formation in a region of the tRNA gene supF associated with hydrogen peroxide mediated mutations

A hot spot for H2O2/Fe-mediated mutation has been observed between bases 154 and 170 of the supF gene in the mutation reporter plasmid pZ189 [Moraes et al. (1990) Carcinogenesis 11, 283; Akman et al. (1991) Mutat. Res. (in press)]. To further characterize this hot spot, we synthesized the 33mer d(pAAAGTGATGGTGGTGGGGGAAGGATTCGAACCT) (pZ33), which is complementary to bases 159-191 of the supF gene. pZ33 annealed spontaneously in 10 mM Tris-HCl (pH 8.0)-1 mM EDTA-100 mM NaCl at 50 degrees C into two major forms, one of which migrates more slowly than does d(pT)33 on nondenaturing 12% polyacrylamide gels. We propose that this form is a four-stranded structure stabilized by Hoogsteen-type deoxyguanosine quartets involving all deoxyguanosines of the sequence d-(pGGTGGTGGGGG) because of the following. (1) pZ33 migrates as a single form that comigrates with d(pT)33 on denaturing 20% acrylamide-8 M urea gels. (2) Annealing an equimolar mixture of 5'-32P-labeled pZ33 and the oligodeoxynucleotide d(pTTTTTTTTpZ33TTTTTTTT) (pZ49), as well as 5'-32P-labeled pZ49 and pZ33, caused the formation of four, discreet slowly migrating bands on nondenaturing 12% polyacrylamide gels. Mixing 5'-32P-labeled pZ33 with 5'-32P-labeled pZ49 resulted in five slowly migrating bands. (3) An oligodeoxynucleotide identical with pZ33 except that every deoxyguanosine has been replaced with deoxyinosine did not anneal into a slowly migrating form. (4) Dimethyl sulfate protection studies demonstrated that all deoxyguanosines of the sequence d(pGGTGGTGGGGG) were protected at N-7 in the slowly migrating form but not in single-stranded pZ33. These data suggest that a hot spot for H2O2/Fe-mediated base substitutions is located adjacent to a sequence that can spontaneously adopt a quadruplex structure in which deoxyguanosine quartets are Hoogsteen bonded.     

Wheat Germ Agglutinin Inhibits the Effects of Nerve Growth Factor on the Phosphorylation of Proteins in PC12h Cells

Treatment of PC12h cells in tissue culture with nerve growth factor (NGF) led to an increased incorporation of [32P]orthophosphoric acid into specific proteins. The increased phosphorylation of 60,000-dalton and 20,000-dalton proteins in the 0.2% Triton X-100 detergent-soluble fraction, of 35,000-dalton protein in the 0.2% Triton X-100 detergent-insoluble fraction, and of slow migrating protein (SMP) in the nonhistone nuclear fraction was observed upon NGF treatment. On the other hand, wheat germ agglutinin (WGA) treatment of PC12h cells induced a slightly decreased phosphorylation of these NGF-responsive proteins. Incubation of cell-free extracts from PC12h cells with [gamma-32P]ATP led to the phosphorylation of a 100,000-dalton protein. In extracts from cells treated with NGF, the labeling of the 100,000-dalton protein was substantially and selectively reduced. In contrast, treatment of PC12h cells with WGA led to an increased phosphorylation of the 100,000-dalton protein in cell-free extracts. Thus, NGF and WGA showed opposite effects on the phosphorylation of specific proteins in both intact cells and cell-free extracts. In addition, it was also observed in both systems that pre- and posttreatment of PC12h cells with WGA abolished the effects of NGF on the phosphorylation and produced a phosphorylation pattern similar to that from PC12h cells treated only with WGA. In parent PC12 cells, it has been reported that the treatment of cells with WGA inhibits NGF binding to its receptors and converts the rapidly dissociating receptors to slowly dissociating receptors. Thus, WGA in conjunction with NGF, results in the practical disappearance of rapidly dissociating receptors on cells.(ABSTRACT TRUNCATED AT 250 WORDS)