Generalized structures of the 5S ribosomal RNAs.

The sequences of 5S ribosomal RNAs from a wide-range of organisms have been compared. All sequences fit a generalized 5S RNA secondary structural model. Twenty-three nucleotide positions are found universally, i.e., in 5S RNAs of eukaryotes, prokaryotes, archaebacteria, chloroplasts and mitochondria. One major distinguishing feature between the prokaryotic and eukaryotic 5S RNAs is the number of nucleotide positions between certain universal positions, e.g., prokaryotic 5S RNAs have three positions between the universal positions PuU40 and G44 (using the E. coli numbering system) and eukaryotic 5S RNAs have two. The archaebacterial 5S RNAs appear to resemble the eukaryotic 5S RNAs to varying degrees depending on the species of archaebacteria although all the RNAs conform with the prokaryotic "rule" of chain length between PuU40 and G44. The green plant chloroplast and wheat mitochondrial 5S RNAs appear prokaryotic-like when comparing the number of positions between universal nucleotides. Nucleotide positions common to eukaryotic 5S RNAs have been mapped; in addition, nucleotide sequences, helix lengths and looped-out residues specific to phyla are proposed. Several of the common nucleotides found in the 5S RNAs of metazoan somatic tissue differ in the 5S RNAs of oocytes. These changes may indicate an important functional role of the 5S RNA during oocyte maturation.     

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.     

Molecular evolution of 5S RNA

Summary Based on the comparative analyses of the primary structure of 5S RNAs from 19 organisms, a secondary structure model of 5S RNA is proposed. 5S RNA has essentially the same structure among all prokaryotic species. The same is true for eukaryotic 5S RNAs. Prokaryotic and eukaryotic 5S RNAs are also quite similar to each other, except for a difference in a specific region.By comparing the nucleotide alignment from the juxtaposed 5S RNA secondary structures, a phylogenic tree of nineteen organisms was constructed. The time of divergence between prokaryotes and eukaryotes was estimated to be 2.5×10⁹ years ago (minimum estimate: 2.1×10⁹).     

Evolutionary changes in the higher order structure of the ribosomal 5S RNA.

Comparative studies have been undertaken on the higher order structure of ribosomal 5S RNAs from diverse origins. Competitive reassociation studies show that 5S RNA from either a eukaryote or archaebacterium will form a stable ribonucleoprotein complex with the yeast ribosomal 5S RNA binding protein (YL3); in contrast, eubacterial RNAs will not compete in a similar fashion. Partial S1 ribonuclease digestion and ethylnitrosourea reactivity were used to probe the structural differences suggested by the reconstitution experiments. The results indicate a more compact higher order structure in eukaryotic 5S RNAs as compared to eubacteria and suggest that the archaebacterial 5S RNA contains features which are common to either group. The potential significance of these results with respect to a generalized model for the tertiary structure of the ribosomal 5S RNA and to the heterogeneity in the protein components of 5S RNA-protein complexes are discussed.     

Plant small nuclear RNAs. Nucleolar U3 snRNA is present in plants: partial characterization

Nuclei, isolated from a number of plant species by either of two independent, newly developed methods, regularly contained a common set of low-molecular-mass RNAs. Partial characterization of these RNAs, based on cell fractionation, polyacrylamide gel electrophoretic and chemical sequencing techniques, as well as comparison with literature data, revealed that, in addition to tRNA, 5S RNA and 5.8S RNA, plant nuclei contain two families of low-molecular-mass RNAs, that are counterparts of vertebrate U1 and U5 RNAs respectively, and three individual low-molecular-mass RNA species. One of these may be related to vertebrate U6 RNA. The two others are true eukaryotic U2 and U3 RNAs, respectively, on the basis of the following lines of evidence obtained from analyses of broad bean nuclear RNAs. The 3'-end portion (121 nucleotides sequenced) of broad bean U2 RNA shows a nearly perfect sequence homology with that of authentic pea U2 RNA. Broad bean U3 RNA is localized in the nucleolus and its 3'-end portion (164 nucleotides sequenced) (a) shows sequence homology with that of both rat U3 RNA (48%) and Dictyostelium D2 RNA (39%), (b) has a secondary structure which fits perfectly that proposed for both rat U3 RNA and Dictyostelium D2 RNA, and (c) contains the specific sequence which, in a model based on the primary structure of rat U3 RNA, is supposed to be involved in the processing of eukaryotic 32S pre-ribosomal RNA. This is the first report on the occurrence in plants of nucleolar U3 RNA.     

5S RNA may not have highly ordered structure like 4S RNAS

The rates of hydrolysis of the following polyribonucleotides as catalysed by RNase I, an enzyme specific for single stranded RNAs, follow the sequence shown; poly (A) > 23S RNA > 5S RNA ? 16S RNA > 4S RNA = poly (I). poly (C). The rates were measured by direct spectrophotometric as well as by trichloroacetic acid precipitation methods. The extents of inhibition of RNase I-catalysed hydrolysis of poly (A) by each of the above-mentioned polyribonucleotides follow the reverse order. Taking into account the fact that double stranded RNAs are inhibitory to RNase I it may be concluded from the above results that 5S RNA has much less ordered structure than 4S RNAs. This prediction is contrary to expectations and its validity will be known when the tertiary structure of 5S RNA will be worked out. These results also indicate that 16S RNA may have more folded structure than 23S RNA.     

5S rRNA is a leadzyme. A molecular basis for lead toxicity

This paper reports that the D-loop sequence of cellular mammalian ribosomal 5S RNAs is a natural leadzyme that specifically binds and cleaves in trans other RNA molecules in the presence of lead. The D-loops of these 5S rRNAs are similar in sequence to the active site of the leadzyme derived from tRNA(Phe), which cleaves a single bond in cis. We have devised a 12 nt model substrate based on the leadzyme sequence cleaved in trans by a 12 nt RNA molecule containing of the D-loop sequence. The model reaction occurs only at the appropriate concentration of lead and enzyme/substrate stoichiometry. The native 5S rRNA carries the same cleavage activity, although with different optimal lead concentration and stoichiometry. On the other hand, the isolated D-loop does not serve as a substrate when incubated with an RNA molecule with the potential to base pair with it and form the same internal loop (the bubble) present in the leadzyme-substrate complex. We show that the leadzyme cuts C-G, but not G-G or U-G linkages. The 5S rRNA leadzyme appears to have the shortest asymmetric pentanucleotide purine-rich loop flanked by two short double stranded RNAs. The leadzyme activity of native 5S rRNA may be an important aspect of lead toxicity in living cells. Because the leadzyme motif has been found in natural RNA species, its activity can be expressed in vivo even at a very low lead concentrations, of lead leading to the inactivation of other cellular RNAs. This might be one of the ways in which lead poisoning manifests itself at the molecular level. Lead toxicity is based not only on its binding to calcium and zinc binding proteins (such as Zn-fingers) and random hydrolysis of nucleic acids, but also, and most importantly, on the induction of the hydrolytic properties of RNA (RNA catalysis).     

Distances between 3' ends of ribosomal ribonucleic acids reassembled into Escherichia coli ribosomes

The three ribonucleic acids (RNAs) from Escherichia coli ribosomes were isolated and then labeled at their 3' ends by oxidation with periodate followed by reaction with thiosemicarbazides of fluorescein or eosin. Ribosomal subunits reconstituted with the labeled RNAs were active for polyphenylalanine synthesis. The distances between the 3' ends of the RNAs in 70S ribosomes were estimated by nonradiative energy transfer from fluorescein to eosin. The percentage of energy transfer was calculated from the decrease in fluorescence lifetime of fluorescein in the quenched sample compared to the unquenched sample. Fluorescence lifetime was measured in real time by using a mode-locked laser for excitation and a high-speed electrostatic photomultiplier tube for detection of fluorescence. The distances between fluorophores attached to the 3' ends of 16S RNA and 5S RNA or 23S RNA were estimated to be about 55 and 71 A, respectively. The corresponding distance between the 5S RNA and 23S RNA was too large to be measured reliably with the available probes but was estimated to be greater than 65 A. Comparison of the quantum yields of the labeled RNAs free in solution and reconstituted into ribosomal subunits suggests that the 3' end of 16S RNA does not interact appreciably with other ribosomal components and may be in a relatively exposed position, whereas the 3' ends of the 5S RNA and 23S RNA may be buried in the 70S ribosomal subunit.     

Nucleotide sequences of the 5.8S rRNAs of a mollusc and a porifer, and considerations regarding the secondary structure of 5.8S rRNA and its interaction with 28S rRNA

We report the primary structures of the 5.8 S ribosomal RNAs isolated from the sponge Hymeniacidon sanguinea and the snail Arion rufus. We had previously proposed (Ursi et al., Nucl. Acids Res. 10, 3517-3530 (1982)) a secondary structure model on the basis of a comparison of twelve 5.8 S RNA sequences then known, and a matching model for the interaction of 5.8 S RNA with 26 S RNA in yeast. Here we show that the secondary structure model can be extended to the 25 sequences presently available, and that the interaction model can be extended to the binding of 5.8 S RNA to the 5'-terminal domain of 28 S (26 S) RNA in three species.     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

Nucleotide sequence of 5S ribosomal RNA from rainbow trout (Salmo gairdnerii) liver.

Staring from low molecular weight RNA obtained from rainbow trout (Salmo gairdnerii) liver, 5S ribosomal RNA (rRNA) was highly purified by successive chromatography on columns of DEAE-Sephadex A50 and Sephadex G100. Products of complete and partial digestions on this RNA with pancreatic ribonuclease (RNase A) [EC 3.1.4.22] and RNase T [EC 3.1.4.8] were isolated and sequenced by conventional and high-performance liquid chromatography (HPLC) procedures. The nucleotide sequence of this RNA thus established was compared with those of five other vertebrae 5S rRNAs, and the rates of base substitution per site per year were found to be nearly constant in these RNAs. The analyses of the partial digests of the trout 5S rRNA revealed several sites susceptible to RNase attack, which could be accounted for by the secondary structure model for eukaryotic 5S rRNAs proposed by Nishikawa and Takemura (1).     

The nucleotide sequences of the 5 S rRNAs of seven molds and a yeast and their use in studying ascomycete phylogeny.

The sequences of the 5 S rRNAs isolated from 8 ascomycete species belonging to the genera Aspergillus, Penicillium, Acremonium and Candida are reported. Two of the examined strains each yielded a mixture of 3 slightly different 5 S RNAs, which were individually sequenced after fractionation. A previously published sequence for Aspergillus nidulans 5 S RNA was found to contain errors. Reconstruction of an evolutionary tree based on 5 S RNA sequences showed that the 16 presently examined ascomycetes form three clusters. The same threefold partition can be observed in the secondary structure pattern, each cluster showing a slightly different variant of the general 5-helix model for 5 S rRNA (De Wachter, Chen and Vandenberghe (1982) Biochimie 64, 311-329), and different sets of secondary structure equilibrium forms in helices C and E of the aforementioned model.     

Sequences of three molluscan 5 S ribosomal RNAs confirm the validity of a dynamic secondary structure model.

The collection of known 5 S rRNA primary structures is enriched with the sequences from three mollusca, the snails Helix pomatia and Arion rufus, and the mussel Mytilus edulis. The three sequences can be fitted in a five-helix secondary structure model previously shown (De Wachter et al. (1982) Biochimie 64, 311-329) to apply to all 5 S RNAs regardless of their origin. One of the helices in this model can undergo a bulge-internal loop transition. Within the metazoan kingdom, the dimensions of each helix and loop are rigidly conserved, except for one helix which can comprise either 6 or 7 base pairs.     

Construction and functional analysis of ribosomal 5S RNA from Escherichia coli with single base changes in the ribosomal protein binding sites

The ribosomal 5S RNA gene from E. coli was altered by oligonucleotide-directed mutagenesis at positions A66 and U103. The mutant genes were cloned into an expression vector and selectively transcribed in an UV-sensitive E. coli strain using a modified maxicell system. The mutant 5S RNA genes were found to be transcribed and processed normally. The 5S RNA molecules were assembled into 50S ribosomal subunits. Under in vitro conditions the stability of the mutant 70S ribosomes seemed, however, to be reduced, since they dissociated into their subunits more easily than those of the wild type. The isolated mutated 5S RNAs with base changes in the ribosomal protein binding sites for L18 and L25, together with a point mutant at G41 (G to C), constructed earlier, were tested for their capacity to bind the 5S RNA binding proteins L5, L18 and L25. The following effects were observed: The base change A66 to C within the L18 binding site did not affect the binding of the ribosomal protein L18 but enhanced the stability of the L25-5S RNA complex considerably. The base changes U103 to G and G41 to C slightly reduced the binding of L5 and L25 whereas the binding of L18 to the mutant 5S RNAs was not altered. In addition 70S ribosomes with the single point mutations in their 5S RNAs were tested in their tRNA binding capacity. Mutants containing a C41 in their 5S RNA showed a reduction in the poly(U)-dependent Phe-tRNA binding, whereas the mutations to C66 and G 103 lead to completely inactive ribosomes in the same assay. Based on previous results a spatial model of the 5S RNA molecule is presented which is consistent with the findings reported in this paper.     

Binding oligonucleotides to Escherichia coli and Bacillus stearothermophilus 5 S RNA.

Binding complementary tri- and tetranucleotides to Escherichia coli A19 and Bacillus stearothermophilus 799 5 S RNAs permitted identification of single-stranded regions in these RNAs. Sequences around positions 10, 30, 60, 70, 85 and 95 are in a single-stranded conformation in both 5 S RNAs. It is concluded that the overall structure of bacterial 5 S RNA has been conserved during evolution. Two types of structural conservation have been observed at specific sites of the 5 S RNA: firstly, nucleotide sequence and single strandedness and secondly, single strandedness only. The oligonucleotide binding data for E. coli 5 S RNA are in general agreement with a previous study (Lewis and Doty, 1970) and do not support fully any proposed structural model.     

Identification and assignment of base pairs in three helical stems of Torulopsis utilis ribosomal 5S RNA and its RNase T1 and RNase T2 cleaved fragments via 500-MHz proton homonuclear overhauser enhancements

Imino proton resonances in the downfield region (10-14 ppm) of the 500-MHz 1H NMR spectrum of Torulopsis utilis 5S RNA are identified (A X U, G X C, or G X U) and assigned to base pairs in helices I, IV, and V via analysis of homonuclear Overhauser enhancements (NOE) from intact T. utilis 5S RNA, its RNase T1 and RNase T2 digested fragments, and a second yeast (Saccharomyces cerevisiae) 5S RNA whose nucleotide sequence differs at only six residues from that of T. utilis 5S RNA. The near-identical chemical shifts and NOE behavior of most of the common peaks from these four RNAs strongly suggest that helices I, IV, and V retain the same conformation after RNase digestion and that both T. utilis and S. cerevisiae 5S RNAs share a common secondary and tertiary structure. Of the four G X U base pairs identified in the intact 5S RNA, two are assigned to the terminal stem (helix I) and the other two to helices IV and V. Seven of the nine base pairs of the terminal stem have been assigned. Our experimental demonstration of a G X U base pair in helix V supports the 5S RNA secondary structural model of Luehrsen and Fox [Luehrsen, K. R., & Fox, G.E. (1981) Proc. Natl. Acad. Sci. U.S.A. 78, 2150-2154]. Finally, the base-pair proton peak assigned to the terminal G X U in helix V of the RNase T2 cleaved fragment is shifted downfield from that in the intact 5S RNA, suggesting that helices I and V may be coaxial in intact T. utilis 5S RNA.