Evidence for a HeLa nuclear protein that binds specifically to the single-stranded d(CCCTAA)n telomeric motif.

In recent years several telomere binding proteins from eukaryotic organisms have been identified that are able to recognise specifically the duplex telomeric DNA repeat or the G-rich 3'-ending single strand. In this paper we present experimental evidence that HeLa nuclear extracts contain a protein that binds with high specificity to the single-stranded complementary d(CCCTAA)n repeat. Electrophoretic mobility shift assays show that the oligonucleotide d(CCCTAACCCTAACCCTAACCCT) forms a stable complex with this protein in the presence of up to 1000-fold excesses of single-stranded DNA and RNA competitors, but is prevented from doing so in the presence of its complementary strand. SDS-PAGE experiments after UV cross-linking of the complex provide an estimate of 50 kDa for the molecular weight of this protein.     

Cloning and characterization of a single-stranded DNA binding protein that specifically recognizes deoxycytidine stretch.

We previously identified a G-rich silencer element involved in negative regulation of catalase gene expression in some hepatoma cells (Mol. Cell. Biol., (1992), 12, 2525-2533). To study a nuclear binding protein for this element, we screened cDNA libraries from a rat ascites hepatoma cell line by binding with a synthetic oligonucleotide probe and obtained several clones. One of them, designated SW, was studied in detail. A clone (SW2) of this series contained a near full length cDNA encoding a putative peptide with 463 amino acid residues. We isolated this peptide as a fusion protein. It was found that the protein strongly bound to the C-stretch of the DNA sequence in a single strand specific fashion, but absolutely did not to G-rich sequence. The protein bound weakly to the corresponding double-stranded DNA as well as to C-rich RNA sequence. This protein, though not the expected one, was found to be a novel protein whose DNA binding domain was located on the region containing at least 75 amino acid residues of the carboxyl terminus. A proline rich region was also observed in the middle part of the protein. Northern blot profiles indicated extensive and slight expression of both 2.0 kb and 2.7 kb mRNA species in some hepatoma cell lines and in the rat liver, respectively.     

Leishmania replication protein A-1 binds in vivo single-stranded telomeric DNA

Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in different events of DNA metabolism. In yeast, subunits 1 (RPA-1) and 2 (RPA-2) work also as telomerase recruiters and, in humans, the complex unfolds G-quartet structures formed by the 3' G-rich telomeric strand. In most eukaryotes, RPA-1 and RPA-2 bind DNA using multiple OB fold domains. In trypanosomatids, including Leishmania, RPA-1 has a canonical OB fold and a truncated RFA-1 structural domain. In Leishmania amazonensis, RPA-1 alone can form a complex in vitro with the telomeric G-rich strand. In this work, we show that LaRPA-1 is a nuclear protein that associates in vivo with Leishmania telomeres. We mapped the boundaries of the OB fold DNA-binding domain using deletion mutants. Since Leishmania and other trypanosomatids lack homologues of known telomere end binding proteins, our results raise questions about the function of RPA-1 in parasite telomeres.     

Nuclear envelope associated protein that binds telomeric DNAs

Rana temporaria oocytes at the 6th diplotene stage of maturation contain a special structure, the karyosphere capsule, with chromosomes covered and detached from the nuclear envelope (NE), though at the previous stage the telomeres were attached to the membrane, as characteristic of germ cells. The DNA-protein complexes from band shift assays with proteins extracted from oocyte NEs and telomeric DNA fragment (T(2)G(4))(130) were isolated and injected into a guinea pig. In the present paper the only protein of 70 kDa recognized by antibody (AB) in the NE is named the Membrane Telomere Binding Protein (MTBP). Western blots with guinea pig AB and AB against telobox peptide from TRF2 show that protein of 60 kDa (probably TRF1) belongs to the chromatin, but MTBP (TRF2 according to immunoprecipitation) belongs to the NE. In the somatic cell nuclei both proteins are present and recognized by AB against telobox peptide, but AB raised recognize only MTBP/TRF2 due to the epitope different from telobox. Combined in situ hybridization with the vertebrate telomeric DNA sequences (T(2)AG(3))(135) and immunocytochemistry with the MTBP AB showed them to be colocalized within the mouse nucleus. As it was shown by immunofluorescense of NE spread, MTBP is organized in a distinct pattern that looks like a network made of double-dots. Electron microscope immunogold staining with both ABs showed that the protein is localized on the outer surface of the oocyte NE within cup-like structures attached to the membrane. This is the first clear evidence of a protein, which could be responsible for the attachment of telomeres to the nuclear membrane.     

Rap1 binds single-stranded DNA at telomeric double- and single-stranded junctions and competes with Cdc13 protein

The ends of eukaryotic chromosomes are protected by specialized telomere chromatin structures. Rap1 and Cdc13 are essential for the formation of functional telomere chromatin in budding yeast by binding to the double-stranded part and the single-stranded 3' overhang, respectively. We analyzed the binding properties of Saccharomyces castellii Rap1 and Cdc13 to partially single-stranded oligonucleotides, mimicking the junction of the double- and single-stranded DNA (ds-ss junction) at telomeres. We determined the optimal and the minimal DNA setup for a simultaneous binding of Rap1 and Cdc13 at the ds-ss junction. Remarkably, Rap1 is able to bind to a partially single-stranded binding site spanning the ds-ss junction. The binding over the ds-ss junction is anchored in a single double-stranded hemi-site and is stabilized by a sequence-independent interaction of Rap1 with the single-stranded 3' overhang. Thus, Rap1 is able to switch between a sequence-specific and a nonspecific binding mode of one hemi-site. At a ds-ss junction configuration where the two binding sites partially overlap, Rap1 and Cdc13 are competing for the binding. These results shed light on the end protection mechanisms and suggest that Rap1 and Cdc13 act together to ensure the protection of both the 3' and the 5' DNA ends at telomeres.     

Isolation of a yeast single-strand deoxyribonucleic acid binding protein that specifically stimulates yeast DNA polymerase I

We sought a protein from yeast that would bind more strongly to single-stranded DNA than to duplex DNA and would stimulate the activity of the major yeast DNA polymerase, but not polymerases from other organisms. We isolated a protein that binds about 200 times more strongly to single-stranded DNA than duplex DNA and stimulates yeast DNA polymerase I activity 4-5-fold. It inhibits synthesis catalyzed by calf thymus DNA polymerase alpha and has little effect on T4 DNA polymerase. This yeast protein, SSB-1, has a molecular weight of approximately 40 000. At apparent saturation there is one protein molecule bound per 40 nucleotides. Protein binding causes the single-stranded DNA molecule to assume a relatively extended conformation. It binds to single-stranded RNA as strongly as to DNA. SSB-1 increases the initial rate of polymerization catalyzed by yeast DNA polymerase I apparently by increasing the processivity of the enzyme. We estimate there are 7500-30 000 molecules of SSB-1 per yeast cell, enough to bind at least 400-1600 nucleotides per replication fork. Thus it is present in sufficient abundance to participate in DNA replication in vivo in the manner suggested by these in vitro experiments.     

A bovine papillomavirus E1-related protein binds specifically to bovine papillomavirus DNA.

The E1 open reading frame of bovine papillomavirus (BPV) was expressed as a RecA-E1 fusion protein in Escherichia coli. The bacterially expressed RecA-E1 protein exhibited sequence-specific DNA binding activity; strong binding to the region from nucleotides 7819 to 93 on the BPV genome (designated region A) and weak binding to the adjacent region from nucleotides 7457 to 7818 (region B) were observed. The interaction between the BPV-derived RecA-E1 protein and region A appeared to be highly specific for BPV DNA, as no comparable binding was detected with heterologous papillomavirus DNAs. Binding to region A was eliminated by digestion of region A at the unique HpaI site, which suggests that the RecA-E1 binding site(s) was at or near the HpaI recognition sequence. Binding to region B but not region A was observed when nuclear extracts from ID13 cells were used as a source of E1 proteins. The absence of region A binding by ID13 extracts may reflect a negative regulation of E1 DNA binding activity.     

Identification of a 67 kDa protein that binds specifically to the pre-rRNA primary processing site in a higher plant.

In radish pre-rRNA primary processing cleavage occurs at a UUUUCGCGC element (motif P) mapped in the 5'-external transcribed spacer (Delcasso-Tremousaygue et al., 1988). Significantly, motif P is part of a cluster of homologous elements including three UUUUCCGG elements (motifs A123) and a single UUUUGCCCC element (motif B). Here we used the EMSA to identify in radish extracts an RNA-binding activity, NF C, that specifically interacts with the pre-rRNA A123BP sequence. Using different RNA probes and competitors we show that NF C recognises a 38 base RNA sequence including the 3'-end of motif A3 and motifs B and P. NF C binds to poly U, but not to poly A, poly C or poly G. Therefore we used poly (U) Sepharose chromatography as a final step to obtain pure NF C fractions. These, analysed by SDS-PAGE, revealed two major polypeptides of 67 and 60 kDa. According to UV cross-linking analysis the 67 kDa polypeptide corresponds to NF C activity, while the 60 kDa species is a proteolysed form of this protein. We also showed that NF C is enriched in nuclear extracts. Based on its stringent RNA substrate specificity and its nuclear localisation we propose that NF C is involved in pre-rRNA primary processing in plants.     

Characterization of a novel protein that specifically binds to DNA modified by N-acetoxy-acetylaminofluorene and cis-diamminedichloroplatinum

Proteins recognizing DNA damaged by the chemical carcinogen N-acetoxy-acetylaminofluorene (AAAF) were analyzed in nuclear extracts from rat tissues, using a 36 bp oligonucleotide as a substrate and electrophoretic mobility shift and Southwestern blot assays. One major damage-recognizing protein was detected, whose amount was estimated as at least 10(5) copies per cell. Levels of this protein were similar in extracts from brain, kidney and liver, but much lower in extracts from testis. The affinity of the detected protein for DNA damaged by AAAF was about 70-fold higher than for undamaged DNA. DNA damaged by cis-diamminedichloroplatinum (cis-DDP), benzo(a)pyrene diolepoxide (BPDE) or UV-radiation also bound this protein with an increased affinity, the former more strongly and the latter two more weakly as compared to AAAF-damaged DNA. The detected AAAF/DDP-damaged-DNA-binding (AAAF/DDP-DDB) protein had a molecular mass of about 25 kDa and was distinct from histone H1 or HMGB proteins, which are known to have a high affinity for cis-DDP-damaged DNA. The level of this damage-recognizing protein was not affected in rats treated with the carcinogen 2-acetylaminofluorene. The activity of an AAAF/DDP-DDB protein could also be detected in extracts from mouse liver cells but not from the Hep2G human hepatocellular carcinoma.     

Identification and characterization of SEB, a novel protein that binds to the acute undifferentiated leukemia-associated protein SET.

SET, the translocation breakpoint-encoded protein in acute undifferentiated leukemia (AUL), is a 39-kDa nuclear phosphoprotein and has an inhibitory activity for protein phosphatase 2A (PP2A). SET is fused to a putative oncoprotein, CAN/NUP214, in AUL and is thought to play a key role in leukemogenesis by its nuclear localization, protein-protein interactions and PP2A inhibitory activity. Here, we describe the isolation and characterization of a novel cDNA encoding a protein with 1542 amino-acid residues that specifically interacts in a yeast two-hybrid system as well as in human cells with SET. This new protein, which we name SEB (SET-binding protein), is identified as a 170-kDa protein by immunoprecipitation with a specific antibody and is localized predominantly in the nucleus. SEB1238--1434 is determined as a SET-binding region that specifically binds to SET182--223. SEB also has an oncoprotein Ski homologous region (amino acids 654--858), six PEST sequences and three sequential PPLPPPPP repeats at the C-terminus. SEB mRNA is expressed ubiquitously in all human adult tissues and cells examined. The SEB gene locus is assigned to the chromosome 18q21.1 that contains candidate tumor suppressor genes associated with deletions in cancer and leukemia. Although the function of SEB is not known, we propose that SEB plays a key role in the mechanism of SET-related leukemogenesis and tumorigenesis, perhaps by suppressing SET function or by regulating the transforming activity of Ski in the nucleus.     

A Chlamydomonas protein that binds single-stranded G-strand telomere DNA.

We have identified a protein in Chlamydomonas reinhardtii cell extracts that specifically binds the single-stranded (ss) Chlamydomonas G-strand telomere sequence (TTTTAGGG)n. This protein, called G-strand binding protein (GBP), binds DNA with two or more ss TTTTAGGG repeats. A single polypeptide (M(r) 34 kDa) in Chlamydomonas extracts binds (TTTTAGGG)n, and a cDNA encoding this G-strand binding protein was identified by its expression of a G-strand binding activity. The cDNA (GBP1) sequence predicts a protein product (Gbp1p) that includes two domains with extensive homology to RNA recognition motifs (RRMs) and a region rich in glycine, alanine and arginine. Antibody raised against a peptide within Gbp1p reacted with both the 34 kDa polypeptide and bound G-strand DNA-protein complexes in gel retardation assays, indicating that GBP1 encodes GBP. Unlike vertebrate heteronuclear ribonucleoproteins, GBP does not bind the cognate telomere RNA sequence UUUUAGGG in gel retardation, North-Western or competition assays. Thus, GBP is a new type of candidate telomere binding protein that binds, in vitro, to ss G-strand telomere DNA, the primer for telomerase, and has domains that have homology to RNA binding domains in other proteins.     

Amsacrine binds in a cooperative manner to deoxyribonucleic acid

The intercalative binding of the acridine antitumour drug 4'-(9-acridinylamino) methane-sulphonate-m-anisidine, a known inhibitor of nucleic acid synthesis, to native calf thymus DNA has been studied using optical titration method. Amsacrine (AMSA) exhibits positive cooperativity in their equilibrium binding to DNA as indicated by the positive slope in the initial region of the binding isotherms (Scatchard plots) under conditions simulating physiological ionic strengths. m-AMSA binds with a higher degree of cooperativity than o-AMSA. Although this correlates with the effectiveness of the drugs as antitumour agents, the exact relationship between the observation of cooperative binding and pharmacological activity is yet to be determined.     

Tel2p, a regulator of yeast telomeric length in vivo, binds to single-stranded telomeric DNA in vitro

The telomeres of the yeast Saccharomyces cerevisiae consist of a duplex region of TG_1–3 repeats that acquire a single-stranded 3’ extension of the TG_1–3 strand at the end of S-phase. The length of these repeats is kept within a defined range by regulators such as the TEL2-encoded protein (Tel2p). Here we show that Tel2p can specifically bind to single-stranded TG_1–3. Tel2p binding produced several shifted bands; however, only the slowest migrating band contained Tel2p. Methylation protection and interference experiments as well as gel shift experiments using inosine-containing probes indicated that the faster migrating bands resulted from Tel2p-mediated formation of DNA secondary structures held together by G-G interactions. Tel2p bound to single-stranded substrates that were at least 19 bases in length and contained 14 bases of TG_1–3, and also to double-stranded/single-stranded hybrid substrates with a 3’ TG_1–3 overhang. Tel2p binding to a hybrid substrate with a 24 base single-stranded TG_1–3 extension also produced a band characteristic of G-G-mediated secondary structures. These data suggest that Tel2p could regulate telomeric length by binding to the 3’ single-stranded TG_1–3 extension present at yeast telomeres. Received: 12 November 1998; in revised form: 6 April 1999 / Accepted: 13 April 1999     

Identification of a cell surface protein from Crandell feline kidney cells that specifically binds Aleutian mink disease parvovirus

Aleutian mink disease parvovirus (ADV) is the etiological agent of Aleutian disease of mink. The acute disease caused by ADV consists of permissive infection of alveolar type II cells that results in interstitial pneumonitis. The permissive infection is experimentally modeled in vitro by infecting Crandell feline kidney (CrFK) cells with a tissue culture-adapted isolate of ADV, ADV-G. ADV-G VP2 empty virions expressed in a recombinant baculovirus system were analyzed for the ability to bind to the surface of CrFK cells. Radiolabeled VP2 virions bound CrFK cells specifically, while they did not bind either Mus dunni or Spodoptera frugiperda cells, cells which are resistant to ADV infection. The binding to CrFK cells was competitively inhibited by VP2 virions but not by virions of cowpea chlorotic mottle virus (CCMV), another unenveloped virus similar in size to ADV. Furthermore, preincubation of CrFK cells with the VP2 virions blocked infection by ADV-G. The VP2 virions were used in a virus overlay protein binding assay to identify a single protein of approximately 67 kDa, named ABP (for ADV binding protein), that demonstrates specific binding of VP2 virions. Exogenously added VP2 virions were able to competitively inhibit the binding of labeled VP2 virions to ABP, while CCMV virions had no effect. Polyclonal antibodies raised against ABP reacted with ABP on the outer surface of CrFK cells and blocked infection of CrFK cells by ADV-G. In addition, VP2 virion attachment to CrFK cells was blocked when the VP2 virions were preincubated with partially purified ABP. Taken together, these results indicate that ABP is a cellular receptor for ADV.     

Isolation of protein from Urechis sperm acrosomal granules that binds sperm to eggs and initiates development

Protein was isolated from the ring-shaped acrosomal granules of Urechis sperm which bound tightly to Urechis egg surface coats and also initiated development. The acrosomal protein preparation migrated as a single major band in acetic acid-urea PAGE, had a lysine + arginine content of ∼50%, and lacked carbohydrate. The molecular mass of the acrosomal protein was 25,000–30,000 Da in cetyltrimethylammonium bromide PAGE. Acrosomal rings of acrosomereacted sperm were selectively labeled with fluorescamine and the fluorescence persisted throughout the isolation procedure and was observed in the major band on gels. Although the acrosomal protein and Urechis sperm protamine had similar amino acid contents and migrated similarly in acetic acid-urea gels, acrosomal protein differed from protamine by its relative insolubility in hot 5% trichloroacetic acid and cold 0.25 N H₂SO₄, by its migration in cetyl- and tetratrimethylammonium bromide PAGE and in a major spot on its peptide map following thermolysin digestion. Agglutination of eggs by Urechis acrosomal protein was not species-specific and included various echinoderm eggs and algal zygotes as well as Urechis eggs. Both the acrosomal protein preparation and protein extracted from the major band of gels initiated development of Urechis eggs, causing rounding out, elevation of the surface coat, germinal vesicle breakdown, polar body formation, and establishment of a polyspermy block. Polylysine and calf thymus histones were equally effective in activating Urechis eggs, but Urechis sperm protamine was less effective, and salmon sperm protamine, although highly basic, activated only a small percentage of eggs. Urechis acrosomal protein also induced partial elevation of sea urchin egg fertilization envelopes, similar to the response of sea urchin eggs to Urechis sperm. Sea urchin eggs were not activated by polylysine.     

The yeast telomere length regulator TEL2 encodes a protein that binds to telomeric DNA.

TEL2 is required for telomere length regulation and viability in Saccharomyces cerevisiae. To investigate the mechanism by which Tel2p regulates telomere length, the majority (65%) of the TEL2 ORF was fused to the 3'-end of the gene for maltose binding protein, expressed in bacteria and the purified protein used in DNA binding studies. Rap1p, the major yeast telomere binding protein, recognizes a 13 bp duplex site 5'-GGTGTGTGGGTGT-3' in yeast telomeric DNA with high affinity. Gel shift experiments revealed that the MBP-Tel2p fusion binds the double-stranded yeast telomeric Rap1p site in a sequence-specific manner. Analysis of mutated sites showed that MBP-Tel2p could bind 5'-GTGTGTGG-3' within this 13 bp site. Methylation interference analysis revealed that Tel2p contacts the 5'-terminal guanine in the major groove. MBP-Tel2p did not bind duplex telomeric DNA repeats from vertebrates, Tetrahymena or Oxytricha. These results suggest that Tel2p is a DNA binding protein that recognizes yeast telomeric DNA.     

A plant gene encoding a Myb-like protein that binds telomeric GGTTTAG repeats in vitro

A gene (AtTRP1) encoding a telomeric repeat-binding protein has been isolated from Arabidopsis thaliana. AtTRP1 is a single copy gene located on chromosome 5 of A. thaliana. The protein AtTRP1 encoded by this gene is not only homologous to the Myb DNA-binding motifs of other telomere-binding proteins but also is similar to several initiator-binding proteins in plants. Gel retardation assay revealed that the 115 residues on the C terminus of this protein, including the Myb motif, are sufficient for binding to the double-stranded plant telomeric sequence. The isolated DNA-binding domain of AtTRP1 recognizes each telomeric repeat centered on the sequence GGTTTAG. The almost full-length protein of AtTRP1 does not form any complex at all with the DNA fragments carrying four or fewer GGTTTAG repeats. However, it forms a complex with the sequence (GGTTTAG)(8) more efficiently than with the sequence (GGTTTAG)(5). These data suggest that the minimum length of a telomeric DNA for AtTRP1 binding consists of five GGTTTAG repeats and that the optimal AtTRP1 binding may require eight or more GGTTTAG repeats. It also implies that this protein AtTRP1 may bind in vivo primarily to the ends of plant chromosomes, which consist of long stretches of telomeric repeats.