The functional organization of the nopaline A. tumefaciens plasmid pTiC58

We have employed the P type plasmid RP4 and the transposons Tn1 and Tn7 to isolate insertion and deletion mutations in the nopaline Ti-plasmid pTiC58. Mutations that inactivate all known Ti phenotypes have been located on the physical map. Most importantly, we have positioned several regions involved in the determination of oncogenicity. They correspond to regions of homology between octopine and nopaline plasmids. One of these regions is part of the T-DNA, the Ti-plasmid DNA present in transformed plant cells. There are also segments of the T-DNA that are not essential for oncogenicity. One of these determines the biosynthesis of nopaline in tumors. The latter regions might allow insertion of foreign DNA that can then be introduced into plant cells.     

Uptake, integration, expression and genetic transmission of a selectable chimaeric gene by plant protoplasts

Summary Genetic transformation of Nicotiana tabacum protoplasts was achieved by incubation of protoplasts with a plasmid DNA-calcium phosphate coprecipitate, followed by fusion of the protoplasts in the presence of polyvinyl alcohol and subsequent exposure to high pH. A derivative of the plasmid pBR322 containing a chimaeric gene, consisting of the nopaline synthase promoter, the coding region of the aminoglycoside phosphotransferase gene of Tn5 and the polyadenylation signal region of the octopine synthase gene, was used for these transformation experiments. This chimaeric gene confers resistance of transformed plant cells to kanamycin. This novel transformation procedure reproducibly yielded transformants at frequencies of approximately 0.01%. Aminoglycoside phosphotransferase II activity was detected in both transformed calli and in regenerated plants. DNA from some of the transformed clones was analyzed by Southern blot hybridization. The input DNA appears to be integrated into high molecular weight cellular DNA. Genetic analysis of one of the kanamycin resistant plants shows that the chimaeric gene is transmitted to the progeny as a single dominant trait in a Mendelian fashion. As a comparison the input DNA was also introduced into tobacco protoplasts using Agrobacterium tumefaciens and Ti-plasmid derived gene vectors.Dedicated to Professor Georg Melchers to celebrate his 50-year association with the journal     

Efficient octopine Ti plasmid-derived vectors for Agrobacterium-mediated gene transfer to plants.

A two-component cloning system to transfer foreign DNA into plants was derived from the octopine Ti plasmid pTiB6S3. pGV2260 is a non-oncogenic Ti plasmid from which the T-region is deleted and substituted by pBR322. pGV831 is a streptomycin-resistant pBR325 derivative that contains a kanamycin resistance marker gene for plant cells and a site for cloning foreign genes between the 25-bp border sequences of the octopine T-region. Conjugative transfer of pGV831 derivatives to Agrobacterium and cointegration by homologous recombination between the pBR322 sequences present on pGV831 and pGV2260, can be obtained in a single step. Strains carrying the resulting cointegrated plasmids transfer and integrate T-DNA into the genome of tobacco protoplasts, and transformed tobacco calli are readily selected as resistant to kanamycin. Intact plants containing the entire DNA region between the T-DNA borders have been regenerated from such clones. In view of these properties we present pGV831 and its derivatives as vectors for efficient integration of foreign genes into plants.     

Studies on the structure of cointegrates between octopine and nopaline Ti-plasmids and their tumour-inducing properties

Stable cointegrates between incRh-1 octopine (Ach5) and nopaline (C58) Ti-plasmids, present in ten independently isolated Agrobacterium tumefaciens strains, showed identical restriction endonuclease patterns. Each cointegration event had taken place in the common sequence between the T-regions of both Ti-plasmids. This illustrates a high preference for this region when used in the formation of cointegrates. Four crown gall tissues, obtained after transformation of Nicotiana tabacum cells by one of the mutants, were analysed by using Southern blot analysis for their T-DNA structure. The borders of T-DNA frequently appeared to differ from T-DNA borders previously detected in tumour tissues that had been induced by Agrobacterium strain C58 or Ach5. Therefore, it was concluded that possibly a less stringent mechanism exists for the integration into plant DNA of T-DNA, derived from a composite (octopine/nopaline) T-region than for integration of T-DNA from a normal (octopine or nopaline) T-region.Abbreviations Agr sensitivity to agrocin 84 - Ape phage Apl exclusion - Cb resistance to carbenicillin - Occ octopine catabolism - Ocs octopine synthesis - Noc nopaline catabolism - Nos nopaline synthesis - Rec recombination - Tra transfer - Vir virulence     

Locations and stability of Agrobacterium-mediated T-DNA insertions in the Lycopersicon genome

Summary The genomic distribution and genetic behavior of DNA sequences introduced into the tomato genome by Agrobacterium tumefaciens were investigated in the backcross progeny of 10 transformed Lycopersicon esculentum x L. pennellii hybrids. All transformants were found to represent single locus insertions based on the co-segregation of restriction fragments corresponding to the T-DNA left and right border sequences in the backcross progeny. Isozyme and restriction fragment length polymorphism (RFLP) markers were used to test linkage relationships of the insertion in each backcross family. The T-DNA inserts in 9 of the 10 transformants were mapped in relation to one or more of these markers, and each mapped to a different chromosomal location. Because only one insertion did not show linkage with the markers employed, it must be located somewhere other than the genomic regions covered by the markers assayed. We conclude that Agrobacterium-mediated insertion in the Lycopersicon genome appears to be random at the chromosomal level. No discrepancies were found between the T-DNA genotype and the nopaline phenotype in the 322 backcross progeny of the nopaline positive transformants. Backcross progeny of two nopaline negative transformants showed incomplete correspondence between the T-DNA genotype and the kanamycin resistance phenotype. No alteration of T-DNA was observed in progeny showing a discrepancy between T-DNA and kanamycin resistance. However, two kanamycin resistant progeny plants of one of these two transformants possessed altered T-DNA restriction patterns, indicating genetic instability of the T-DNA in this transformant.Journal article no. 1223 of the New Mexico Agricultural Experiment Station     

Right 25 bp terminus sequence of the nopaline T-DNA is essential for and determines direction of DNA transfer from agrobacterium to the plant genome

We have determined which sequences at the right border of the T-DNA region of the nopaline C58 Ti plasmid are required for transfer and/or integration of the T-DNA into the plant cell genome. The results indicate that the 25 bp T-DNA terminus repeat sequence, TGACAGGATATATTGGCGGGTAAAC, is directly responsible for T-DNA transfer; furthermore, this sequence is directional in its mode of action. A transfer-negative nononcogenic Ti plasmid derivative, pGV3852, was constructed, in which 3 kb covering the right T-DNA border region was substituted for by pBR322 sequences. The pBR322 sequences in pGV3852 provide a site for homologous recombination with pBR-derived plasmids containing sequences to assay for transfer activity. First, a 3.3 kb restriction fragment overlapping the deleted region in pGV3852 was shown to restore transfer activity. Second, a sequence of only 25 bp, the T-DNA terminus sequence, was shown to be sufficient to restore normal transfer activity. The transfer-promoting sequences are most active when reinserted in one orientation, that normally found in the Ti plasmid.     

The Agrobacterium rhizogenes pRi TL-DNA segment as a gene vector system for transformation of plants

Summary A plant gene transfer system was developed from the Agrobacterium rhizogenes pRi15834 TL-DNA region. Intermediate integration vectors constructed from ColE1-derived plasmids served as cloning vectors in Escherichia coli and formed cointegrates into the TL-DNA after transfer to A. rhizogenes. An A. rhizogenes strain with pBR322 plasmid sequences replacing part of the TL-DNA was also constructed. Plasmids unable to replicate in Agrobacterium can integrate into this TL-DNA by homologous recombination through pBR322 sequences. No loss of pathogenicity was observed with the strains formed after integration of intermediate vectors or strains carrying pBR322 in the TL-DNA segment. Up to 15 kb of DNA have been transferred to plant cells with these systems. The T-DNA from a binary vector was cotransformed into hairy roots which developed after transfer of the wild-type pRi T-DNA. Tested on Lotus corniculatus the TL-derived vector system transformed 90% of the developed roots and the T-DNA from the binary vector was cotransformed into 60% of the roots. Minimum copy numbers of one to five were found. Both constitutive and organ-specific plant genes were faithfully expressed after transfer to the legume L. corniculatus.     

Transfer of Ti plasmids between Agrobacterium strains by mobilisation with the conjugative plasmid RP4

Summary The P type conjugative plasmid RP4 has been shown to be able to promote the transfer of the Agrobacterium Ti-plasmid. The results provide additional evidence that agrocin 84 sensitivity, exclusion of phage AP₁, ability to catabolize the guanidine derivatives octopine and nopaline and tumor inducing ability, are Ti-plasmid determined properties. Furthermore, the results strongly support the notion that at least part of the Ti-plasmid is transferred from the bacterium to the target plant cells, since it was demonstrated that Ti-plasmid linked genes specify the synthesis of octopine or nopaline by crown-gall tumor cells.     

Interactions and DNA transfer between Agrobacterium tumefaciens, the Ti-plasmid and the plant host.

Agrobacterium tumefaciens is a gram-negative bacterium with the unique capacity to induce neoplasmic transformations in dicotyledonous plants. Recently, both the mechanism and the biological significance of this transformation have been elucidated. Agrobacterium tumefaciens strains contain a large extrachromosomal DNA plasmid (the Ti-plasmid). This Ti-plasmid is responsible for the oncogenic properties of Agrobacterium strains. A particular segment of the Ti-plasmid, containing information determining the tumorous growth pattern and the synthesis of so-called 'opines', e.g. octopine (N-alpha-(D-1-carboxyethyl)-L-arginine) and nopaline (N-alpha-(1,3-dicarboxypropyl)-L-argine), is transferred and stably maintained and expressed in the transformed plant cells. This phenomenon can be understood as a 'genetic colonization' of the plant cells by bacterial plasmid DNA so that the transformed plant cells will produce and secrete into the medium amino acid derivatives (the opines) that Ti-plasmid carrying agrobacteria can selectively use as carbon and nitrogen sources.     

The lysopinedehydrogenase gene used as a marker for the selection of octopine crown gall cells

Plant cells transformed into octopine-synthesizing tumour cells by the bacterium Agrobacterium tumefaciens survive when cultured in the presence of homo-arginine (HA), whereas both normal plant cells and nopaline producing plant tumour cells do not. Survival of octopine crown gall cells is due to the activity of the enzyme lysopinedehydrogenase (LpDH) in these cells, which converts toxic homo-arginine into non-toxic homo-octopine. The selective toxicity of homo-arginine for normal cells can be applied for the enrichment of octopine Ti plasmid transformed plant cells vs normal plant cells in mixed cultures.     

A comparison of virulence determinants in an octopine Ti plasmid, a nopaline Ti plasmid, and an Ri plasmid by complementation analysis of Agrobacterium tumefaciens mutants

Transposon-insertion mutants with vir^? Ti plasmids were characterized and then used in complementation experiments. One of the mutants (LBA 1517) had a mutation in a newly discovered vir locus called virF. The virF mutation led to a strongly diminished virulence on tomato and tobacco, but not on certain other plant species. Also a mutant (LBA 1505) was isolated with a mutation somewhere in the bacterial genome but outside the octopine Ti plasmid that caused a restriction in host range for tumor induction. Introduction of a nopaline Ti plasmid or an Ri plasmid into LBA 1505 did not restore normal virulence, showing that the vir gene affected in LBA 1505 determines a factor which is essential for normal tumor induction both by different types of Ti plasmids and by the Ri plasmid. The introduction of R primes containing part or all of the octopine Ti plasmid virulence region led to a restoration of virulence in strains with a vir^? nopaline Ti plasmid. Also the transfer of an Ri plasmid to a large number of different vir^? octopine or nopaline Ti plasmid mutants rendered these strains virulent. These results indicate that the octopine Ti plasmid, the nopaline Ti plasmid, and the Ri plasmid each have a similar virulence system which can mediate the transfer of T-DNA to plant cells from different types of Ti or Ri plasmids. In complementation experiments between vir^? octopine Ti plasmid mutations and vir^? nopaline Ti plasmid mutations it was found that equivalent functions are determined by the areas of DNA homology in the virulence regions of these two types of Ti plasmids. The previously defined octopine Ti plasmid virC locus appeared to consist of two different loci. One of these loci was found to be in a region of the octopine Ti plasmid which does not share DNA homology with the nopaline Ti plasmid, and was therefore called virO (octopine Ti plasmid specific). For the other locus the name virC was retained. Whereas mutations in the virC locus were avirulent on all plant species tested, mutations in virO were avirulent on tomato and pea, but virulent on sunflower and Nicotiana rustica. VirO^? mutants produced rooty tumors on Kalanchoë tubiflora.     

Further insight on the transferred-DNA of octopine crown gall

Summary Six octopine tumour lines incited by pTiB6S3, pTiAch5 and pTiA6 on tobacco, Arabidopsis and Petunia were studied by the Southern blotting hybridisation technique in order to define accurately the dimensions of the segments of plasmid origin transferred to the tumourous cell and their organisation in the plant genome. Emphasis has been put on the comparison between octopine and nopaline T-DNAs and on the lines presented here compared with those studied previously (Thomashow et al. 1980).The lenght of the transferred DNA segment does not depend on the plasmids used, nor on the host plants. The octopine T-DNA organisation in the cell nucleus is significantly different from that of nopaline T-DNAs: tandem arrangements of T-DNA segments could not be detected and the T-DNA itself is much shorter.The tumour lines described here can be compared to some extent with those studied by another group (Thomashow et al. 1980) by the same technique. However, some differences were observed. The transferred DNA was seen as a unique stretch of about 11 kb present only once per cell. No amplification of any part was noticed in any of these six lines.Examination of the restriction patterns presented by the boundary fragments of the T-DNA in these lines suggested that some of them were of common origin.     

Isolation and characterization of diverse nopaline type Ti plasmids of Agrobacterium tumefaciens from Japan

Ninety Agrobacterium strains were isolated from naturally appearing crown galls in Japan. They were classified into several groups based on opine type, biovars, tumorigenicity, and indigeneous plasmid profiles. Twenty-nine strains utilized nopaline, but none utilized octopine. Eighteen isolates were tumorigenic, nopaline type strains and thus classified as Agrobacterium tumefaciens. Some strains possessed anomalous traits such as lysine utilization, resistance to agrocin 84, and a lack of motility. Pathogenic strains contained Ti plasmids of either 200 kb or 260 kb, as identified by hybridization to T-DNA of the known Ti plasmid. However, the restriction enzyme cleavage patterns, arising from hybridization to the probe, were different from each other and indicated that nopaline type Ti plasmids possess more diverse T-DNA structures than previously reported. Five of 6 representative strains induced tumors on 6 plant species (tomato, petunia, poplar, kalanköe, apple, and grape). Among these, apple was notable, since only a few strains have been reported to be pathogenic to this plant. On petunia, 4 strains developed large tumors while 2 produced only small tumors. Teratomas were formed on poplar in a strain-dependent manner, but not on tomato. These results suggest that our isolates are wide host range strains, and that host-specificity of these strains is related to diverse T-DNA structures.     

The virB operon of Agrobacterium tumefaciens pTiC58 encodes 11 open reading frames

Summary Agrobacterium tumefaciens genetically transforms plant cells by transferring a copy of its T-DNA to the plant where it is integrated and stably maintained. In the presence of wounded plant cells this process is activated and mediated by the products of the vir genes which are grouped into six distinct loci. The largest is the virB locus spanning 9.5 kb. Transposon mutagenesis studies have shown that virB gene products are required for virulence but their functions remain largely unknown. To provide information relevant to understanding the function of VirB polypeptides, the nucleotide sequence of the virB operon from a nopaline plasmid, pTiC58, is presented here. Eleven open reading frames (ORFs) are predicted from this sequence. The predicted sizes of 10 of the 11 VirB polypeptides are verified by specific expression in Escherichia coli. Only the product of the smallest ORF potentially encoding a 5.8 kDa polypeptide has not been detected. The initiation of translation of five virB ORFs occurs at codons that overlap the termination codons of the ORF immediately upstream; thus, translational coupling may be an important mechanism for efficient translation of the large virB polycistronic mRNA. Based on hydropathy plot analysis nine of the virB ORFs encode proteins that may interact with membranes; these data support the earlier hypothesis (Engstromm et al. 1987) that virB gene products may form a membrane pore or channel to mediate exit of the T-DNA copy (T-strands) from Agrobacterium into the plant cell. A comparison of the two published octopine virB sequences with the nopaline sequence presented here is made.     

Sequence context of the T-DNA border repeat element determines its relative activity during T-DNA transfer to plant cells

Summary We present a detailed analysis of the function of the right and left T-DNA border regions of the nopaline Ti plasmid of Agrobacterium tumefaciens. An avirulent deletion of the right border of the nopaline Ti plasmid (pGV3852) was used as an acceptor for 14 different T-DNA border constructs. The functional activities of these constructs were assayed by their ability to restore virulence, i.e. transformation on inoculated plants. Tumorigenicities were measured in several independent experiments over a 2 year period and the statistical significance of their relative levels was evaluated. The data indicate: (i) the entire sequence of the 25 bp direct repeat of the T-DNA is required to provide an efficient substrate for mediating T-DNA transfer events; deletion derivatives of either the conserved or the vaiable domain of the repeat are defective in T-DNA transfer; (ii) while the 25 bp direct repeat alone can promote the T-DNA transfer, the flanking sequences of the repeats enhance (on the right) or attenuate (on the left) their activity; and (iii) tumorigenicity measurements vary depending on the plant assay system: potato discs are more sensitive than wounded tobacco leaves in detecting differences in T-DNA border activity.     

A set of novel Ti plasmid-derived vectors for the production of transgenic plants

Summary We describe in this paper the construction and use of a set of novel Ti plasmid-derived vectors that can be used to produce transgenic plants. These vectors are based on one of two strategies: 1) double recombination into the wild-type Ti plasmid of genetic information flanked by two T-DNA fragments on a wide-host range plasmid; 2) the binary vector strategy. The vector based on the double recombination principle contains a kanamycin resistance gene for use as a plant selectable marker, a polylinker for the insertion of foreign genes, and a nopaline synthase gene. The vector was constructed such that a disarmed T-DNA results from the double recombination event. The binary vector combines several advantageous features including an origin of replication that is stable in Agrobacterium in the absence of selection, six unique sites for insertion of foreign genes, an intact nopaline synthase gene, and a kanamycin resistance marker for selection of transformed plant cells. All of these vectors have been used to produce tobacco plants transformed with a variety of foreign genes.     

The functional organization of the octopine Agrobacterium tumefaciens plasmid pTiB6s3

We have used the transposon Tn7 to isolate insertion and deletion mutations in the octopine Ti-plasmid pTiB6S3. Mutations that inactivate most of the known Ti phenotypes have been located on the physical map. Most importantly, we have positioned several regions involved in the determination of oncogenicity. They correspond to homology regions between octopine and nopaline plasmids. One of these regions, the T region, is part of the Ti-plasmid DNA present in transformed plant cells. Some Tn7 insertions in this region are weakly virulent and the tumor tissue, incited by these mutant Ti plasmids, readily produce proliferating shoots.     

Identification of an Agrobacterium tumefaciens pTiB6S3 vir region fragment that enhances the virulence of pTiC58

Summary The Agrobacterium tumefaciens octopine strain B6S3 and the nopaline strain C58 were compared for their ability to induce opine synthesis on Kalanchoe daigremontiana stem fragments. Whereas B6S3 induced high levels of octopine synthesis, C58 induced only low levels of nopaline synthesis. However, C58-induced nopaline synthesis was greatly increased by mixed infection with B6S3. This effect (called helper-effect) was shown to be due to the activity of a 5 kb fragment from the virulence region of the B6S3 Ti plasmid, since incorporation of this fragment into the C58 plasmid enabled C58 to induce high levels of nopaline synthesis in the absence of a helper strain. The 5kb region contains the vir F locus, as defined earlier (Hooykaas et al. 1984b). A possible correlation between the helper function and vir F is discussed. Our results show that large differences in virulence on particular host plants exist between natural Agrobacterium strains and can be overcome by mixed infections.Dedicated to Professor Georg Melchers to celebrate his 50-year association with the journal     

Phenotypically normal transgenic T-cyt tobacco plants as a model for the investigation of plant gene expression in response to phytohormonal stress

The tumour-inducing T-DNA gene 4 (T-cyt gene) of the nopaline Ti plasmid pTiC58 was cloned and introduced into tobacco cells by leaf disc transformation using Agrobacterium plasmid vectors. Tobacco shoots exposed to elevated cytokinin levels were unable to develop roots and lacked apical dominance. Using exogenously applied phytohormone manipulations we were able to regenerate morphologically normal transgenic tobacco plants which differed in endogenous cytokinin levels from normal untransformed plants. Although T-cyt gene mRNA levels, as revealed by dot-blot hybridization data, in these rooting plants were only about half those in primary transformed shoots the total amount of cytokinins was much lower than in crown gall tissue or cytokinin-type transformed shoots as reported by others. Nevertheless the cytokinin content in T-cyt plants was about 3 times greater than in control tobacco plants.Elevated cytokinin levels have been shown to change the expression of several plant genes, including some nuclear genes encoding chloroplast proteins. Our results show that the mRNA levels of chloroplast rbcL gene increase in cytokinin-type transgenic tobacco plants as compared with untransformed plants. Data obtained suggest that T-cyt transgenic plants are a good model for studying plant gene activity in different parts of the plant under endogenous cytokinin stress.