Radiation damage to dinucleoside monophosphates: mediated versus direct damage

The mediation of radiation-induced damage to dinucleoside monophosphate by oxygen and by glutathione was studied. The sequence isomers d(TpA) and d(ApT) were X-irradiated in aqueous solutions and the products isolated by reverse-phase high-performance liquid chromatography. The main products were characterized by proton NMR spectroscopy. In the presence of oxygen the principal products are the formamido derivative formed by breakdown of thymine and the aldehyde derivative formed at the 5' end of the dinucleoside monophosphate, both nucleoside monophosphates and free bases. In the presence of glutathione, the two stereoisomers of the 5,6-dihydrothymine derivatives are prominent. Radiation-induced damage to d(TpA) and d(ApT) in the solid state was also studied.     

A duplex of the oligonucleotides d(GGGGGTTTTT) and d(AAAAACCCCC) forms an A to B conformational junction in concentrated salt solutions

The coexistence of both A form and B form tracts and formation of an A-B junction in the oligomer d(GGGGGTTTTT).d(AAAAACCCCC) in saturated sodium chloride solution have been detected by Raman spectroscopy. The entire duplex adopts the familiar B-form conformation in aqueous solution at low salt concentrations (0.1M NaCl). In 6M NaCl the adoption of an A form is observed within the G,C tract while a B-form is maintained in the A.T tract. The experimental results indicate that two different helical forms can co-exist in a rather short oligonucleotide and that formation of an A-B junction can occur over a fairly small span of bases. This is in agreement with recent rules governing the relation between base sequence and secondary structure of DNA published from this laboratory. The conformational preferences of each of the individual oligomers d(AAAAACCCCC) and d(GGGGGTTTTT) have also been investigated. The oligomer d(AAAAACCCCC) is single stranded but some evidence for base stacking is observed at 2 degrees C. In contrast, a double stranded B-form structure characterized by wobble G-T base pairing is observed for d(GGGGGTTTTT) in 0.1M and 6M NaCl.     

A Duplex of the Oligonucleotides d(GGGGGTTTTT) and d(AAAAACCCCC) Forms an A to B Conformational Junction in Concentrated Salt Solutions

Abstract

The coexistence of both A form and B form tracts and formation of an A-B junction in the oligomer d(GGGGGTTTTT)· d(AAAAACCCCC) in saturated sodium chloride solution have been detected by Raman spectroscopy. The entire duplex adopts the familiar B-form conformation in aqueous solution at low salt concentrations (0.1M NaCl). In 6M NaCl the adoption of an A form is observed within the G,C tract while a B-form is maintained in the A,T tract. The experimental results indicate that two different helical forms can co-exist in a rather short oligonucleotide and that formation of an A-B junction can occur over a fairly small span of bases. This is in agreement with recent rules governing the relation between base sequence and secondary structure of DNA published from this laboratory.

The conformational preferences of each of the individual oligomers d(AAAAACCCCC) and d(GGGGGTTTTT) have also been investigated. The oligomer d(AAAAACCCCC) is single stranded but some evidence for base stacking is observed at 2°C. In contrast, a double stranded B-form structure characterized by wobble G-T base pairing is observed for d(GGGGGTTTTT) in 0.1M and 6M NaCl.     

cgDNA: a software package for the prediction of sequence-dependent coarse-grain free energies of B-form DNA

cgDNA is a package for the prediction of sequence-dependent configuration-space free energies for B-form DNA at the coarse-grain level of rigid bases. For a fragment of any given length and sequence, cgDNA calculates the configuration of the associated free energy minimizer, i.e. the relative positions and orientations of each base, along with a stiffness matrix, which together govern differences in free energies. The model predicts non-local (i.e. beyond base-pair step) sequence dependence of the free energy minimizer. Configurations can be input or output in either the Curves+ definition of the usual helical DNA structural variables, or as a PDB file of coordinates of base atoms. We illustrate the cgDNA package by comparing predictions of free energy minimizers from (a) the cgDNA model, (b) time-averaged atomistic molecular dynamics (or MD) simulations, and (c) NMR or X-ray experimental observation, for (i) the Dickerson–Drew dodecamer and (ii) three oligomers containing A-tracts. The cgDNA predictions are rather close to those of the MD simulations, but many orders of magnitude faster to compute. Both the cgDNA and MD predictions are in reasonable agreement with the available experimental data. Our conclusion is that cgDNA can serve as a highly efficient tool for studying structural variations in B-form DNA over a wide range of sequences.     

Thermal perturbation differential spectra of ribonucleic acids. II. Nearest neighbour interactions.

Dinucleoside monophosphates are used here as models for studying sequence dependence of the hypochromic effect correlated with base stacking. It was shown that once the contribution due to the temperature dependent hydration change of the bases is substracted from the thermal perturbation difference spectra of dinucleoside monophosphates, the absorbance change of the dimer only due to unstacking of the bases could be obtained. In order to be able to use these corrected thermal perturbation difference spectra as models for studying nearest neighbour interactions in nucleic acids, it was necessary to normalize them to 100% unstacking of the bases. To perform this normalization, apparent thermodynamic parameters were extracted from the corrected transition curves by means of the two-state model.     

Prediction of atomic structure from sequence for double helical DNA oligomers

DNA can adopt different conformations depending on the base sequence, solvent, electrolyte composition and concentration, pH, temperature, and interaction with proteins. Here we present a model for calculating the three-dimensional atomic structure of double-stranded DNA oligomers. A theoretical energy function is used for calculating the interactions within the base steps and an empirical backbone function is used to restrict the conformational space accessible to the bases and to account for the conformational coupling of neighboring steps in a sequence. Conformational searching on large structures or a large number of structures is possible, because each base step can be described by just two primary degrees of freedom (slide and shift). A genetic algorithm is used to search for low-energy structures in slide-shift space, and this allows very rapid optimization of DNA oligomers. The other base step parameters have been previously optimized for all possible slide-shift sequence combinations, and a heuristic algorithm is used to add the atomic details of the backbone conformation in the final step of the calculation. The structures obtained by this method are very similar to the corresponding X-ray crystal structures observed experimentally. The average RMSD is 2.24 Angstroms for a set of 20 oligomer structures. For 15 of these sequences, the X-ray crystal structure is the global energy minimum. The other 5 are bistable sequences that have B-form global energy minima but crystallize as A-DNA.     

Circular dichroism of polynucleotides: dimers as a function of conformation

Working within the restrictions of a model, we have calculated the circular dichroism of the dinucleoside phosphates ApA, CpC, and CpA for various conformations. Comparing the calculated curves with those measured in aqueous solution we find agreement for (1) ApA as a right-handed helix with both bases either as in B-form DNA, or else rotated 180° around the glycosidic bond, (2) CpC as the right-handed conformation with both bases as in DNA, (3) ApC as either the right-handed conformation with both bases as in DNA, or else as a left-handed helix with both bases rotated 180°, and (4) CpA as either a left-handed helix with both bases in a left-handed DNA, or else in the right-handed conformation with both bases rotated 180°. In addition, we have investigated circular dichroism as a measure of unstacking. We find that opening the bases to a 90° total angle (base planes perpendicular) reduces the intensity of the calculated bands to 20% of their original value. Further, we find that allowing the sliding of one base past the other does not lead to a temperature dependence consistent with experiment.     

Radiation chemistry of a dinucleoside monophosphate and its sequence isomer

A combination of high-performance liquid chromatography (HPLC) and nuclear magnetic resonance (NMR) spectroscopy was used to analyze the products of X-irradiated aqueous solutions of the dinucleoside monophosphate thymidylyl(3'-5')-2'-deoxyadenosine, d(TpA), and its sequence isomer 2'-deoxyadenylyl(3'-5')thymidine, d(ApT). The products of d(TpA) include both bases and nucleotides and a variety of thymine modifications of d(TpA) including the two cis and two trans glycol stereoisomers, two cis monohydroxy derivatives, an N-formamide derivative, and the hydroxymethyl derivative. Attention is focused on using NMR spectral features to distinguish among the various stereoisomers. The radiation chemistry of d(ApT) is also explored and differences in product formation compared with d(TpA) are described, particularly the formation of two products involving modification of adenine base. The potential of the HPLC-NMR approach to the study of radiation chemistry in DNA model compounds is discussed.     

Temperature-dependent properties of dinucleoside phosphates

The optical rotatory dispersion, hypochromism, and proton magnetic resonance were measured for a number of dinucleoside phosphates in both dilute salt solutions and in 25.2% LiCl (which freezes below ?70°C.) as a function of temperature. Two models for the “disordering” of dinucleoside phosphates: the two-state model and the oscillating dimer model, are used to analyze the data. Both models fit some of the data, but neither are completely satisfactory. Evidence is given for a dynamic structure of dinucleoside phosphates, in which the bases oscillate with respect to one another, remaining parallel to one another with no solvent in between, even at high temperatures. Implications of this model to the structures of single-strand sections of RNA's are discussed.     

X-ray analysis of a DNA dodecamer containing 2'-deoxy-N4-methoxycytidine.

The crystal structure of DNA dodecamer with the sequence of d(CGCAAATTXGCG), where X is 2'-deoxy-N4-methoxycytidine, has been determined by X-ray analysis. The dodecamers form a double helix with B-form conformation. The electron density indicates that the two modified cytosine bases respectively make a pair with the adenine bases on the opposite strand in a manner of Watson-Crick geometry and that the methoxy groups are in anti conformation to the N3 atom.     

High-resolution crystal structure of the intramolecular d(TpA) thymine-adenine photoadduct and its mechanistic implications

A high-resolution crystal structure is reported for d(TpA)*, the intramolecular thymine–adenine photoadduct that is produced by direct ultraviolet excitation of the dinucleoside monophosphate d(TpA). It confirms the presence of a central 1,3-diazacyclooctatriene ring linking the remnants of the T and A bases, as previously deduced from heteronuclear NMR measurements by Zhao et al. (The structure of d(TpA)*, the major photoproduct of thymidylyl-(3′-5′)-deoxyadenosine. Nucleic Acids Res., 1996, 24, 1554–1560). Within the crystal, the d(TpA)* molecules exist as zwitterions with a protonated amidine fragment of the eight-membered ring neutralizing the charge of the internucleotide phosphate monoanion. The absolute configuration at the original thymine C5 and C6 atoms is determined as 5S,6R. This is consistent with d(TpA)* arising by valence isomerization of a precursor cyclobutane photoproduct with cis–syn stereochemistry that is generated by [2 + 2] photoaddition of the thymine 5,6-double bond across the C6 and C5 positions of adenine. This mode of photoaddition should be favoured by the stacked conformation of adjacent T and A bases in B-form DNA. It is probable that the primary photoreaction is mechanistically analogous to pyrimidine dimerization despite having a much lower quantum yield.     

The structure of cytidilyl(2',5')adenosine when bound to pancreatic ribonuclease S

The three-dimensional structure of the RNase S complex with the synthetic dinucleoside monophosphate cytidilyl(2′,5′)adenosine(C₂,p₅,A) is determined using difference Fourier techniques at 2.0 Å resolution in conjunction with computer graphic model-building and energy minimization. The latter has been carried out as a function of the rigid body parameters of the dinucleoside monophosphate and the dihedral angles of the nucleoside portion as well as of relevent amino acids in the active site of the enzyme.The bound dinucleoside monophosphate is found to assume an extended conformation, with the adenine and cytidine bases nearly perpendicular. The bases form specific hydrogen bonds with groups in the active site. Although the atoms involved in the recognition of the pyrimidine base by the enzyme are the same as in the pyrimidine bases of UMP, CMP and UpcA, the details of the binding are different. The adenosine moiety blocks most of the various positions that His119 occupies in the native enzyme and forces it into one well-defined position. One of the His119 ring protons is in contact with O(5′) (the leaving group), O(1′) of the adenine ribose and with a free phosphoryl oxygen. No strong charge contacts with the phosphate group are observed.We show how combining X-ray data with computer graphic model-building, electron density fitting and energy calculations leads to the model we propose and discuss in detail the enzyme-nucleic acid interactions.     

DNA structure: what's in charge?

DNA structure is well known to be sensitive to hydration and ionic strength. Recent theoretical predictions and experimental observations have raised the idea of the intrusion of monovalent cations into the minor groove spine of hydration in B-form DNA. To investigate this further, extensions and further analysis of molecular dynamics (MD) simulations on d(CGCCGAATTCGCG), d(ATAGGCAAAAAATAGGCAAAAATGG) and d(G(5)-(GA(4)T(4)C)(2)-C(5)), including counterions and water, have been performed. To examine the effective of minor groove ions on structure, we analyzed the MD snapshots from a 15 ns trajectory on d(CGCGAATTCGCG) as two subsets: those exhibiting a minor groove water spine and those with groove-bound ions. The results indicate that Na(+) at the ApT step of the minor groove of d(CGCCGAATTCGCG) makes only small local changes in the DNA structure, and these changes are well within the thermal fluctuations calculated from the MD. To examine the effect of ions on the differential stability of a B-form helix, further analysis was performed on two longer oligonucleotides, which exhibit A-tract-induced axis bending localized around the CpG step in the major groove. Plots of axis bending and proximity of ions to the bending locus were generated as a function of time and revealed a strong linear correlation, supporting the idea that mobile cations play a key role in local helix deformations of DNA and indicating ion proximity just precedes the bending event. To address the issue of "what's in charge?" of DNA structure more generally, the relative free energy of A and B-form d(CGCGAATTCGCG) structures from MD simulations under various environmental circumstances were estimated using the free energy component method. The results indicate that the dominant effects on conformational stability come from the electrostatic free energy, but not exclusively from groove bound ions per se, but from a balance of competing factors in the electrostatic free energy, including phosphate repulsions internal to the DNA, the electrostatic component of hydration (i.e. solvent polarization), and electrostatic effects of the counterion atmosphere. In summary, free energy calculations indicate that the electrostatic component is dominant, MD shows temporal proximity of mobile counterions to be correlated with A-track-induced bending, and thus the mobile ion component of electrostatics is a significant contributor. However, the MD structure of the dodecamer d(CGCGAATTCGCG) is not highly sensitive to whether there is a sodium ion in the minor groove.     

PPP calculations of the circular dichroism spectra of some dinucleoside phosphates

Circular dichriosm (CD) spectra have been calculated for serveral dinucleoside phosphates using a variant of the Pariser-Parr-Pople π-electron molecular orbital method. This method does not require the prior knowledge of the experimental absorption spectra of transition moments of the bases forming the dinucleoside phosphates. Calculated spectra were obtained in good agreement with experimental spectra for four dinucleoside phosphates, ApA, UpU, GpA, and UpA, and reasonable agreement was obtained for ApG and ApU. The effect of changing conformation on the CD spectrum was studied for ApA, UpU, UpA, and ApU; the spectra of UpU, UpA, and ApU were sensitive to small change in conformation, whereas ApA was insensitive over the range of conformation studied. Further studies await detailed knowledge of the structure of dinucleoside phosphates in solution.     

Radiation chemistry of 2'-deoxycytidylyl-(3'-5')-2'-deoxyguanosine and its sequence isomer in N2O- and O2-saturated solutions

The radiation chemistry of the dinucleoside monophosphate d(CpG) and its sequence isomer, d(GpC), has been examined in aqueous solutions saturated with either N2O or O2. The products were isolated using HPLC, and the major products were identified using proton NMR spectroscopy and mass spectrometry. The major products include 5,6-dihydroxy-5,6-dihydrouracil (glycol) derivatives, 5- and 6-hydroxycytosine substitution products, 1-carbamoyl-2-oxo-4,5-dihydroxyimidazolidine products, and the 8-hydroxyguanine substitution product. Both trans stereoisomers of the imidazolidine derivatives are obtained from d(CpG) as well as from its sequence isomer. These are prominent products when the irradiation is carried out in the presence of oxygen, but they are not observed in the absence of oxygen.     

Conformations of dinucleoside phosphates in aqueous solution

The conformations of dinucleoside phosphates have been reexamined by semiempirical potential energy calculations. Conformations I, II, and III, proposed by Lee & Tinoco [Lee, C. H., & Tinoco, I., Jr. (1977) Biochemistry 16, 5403], are possible species after refinement of their structures by potential energy minimization. These three conformers can represent three types of dinucleoside phosphate species in solution. Dhingra et al. [Dhingra, M. M., Sarma, R. H., Giessner-Prettre, C., & Pullman, B. (1978) Biochemistry 17, 5815] had concluded that conformations of type II and III were unlikely or impossible. They favored conformations g-g- (equivalent to I), g+g+,g+t, and tg+; the last three conformations have little stacking and are calculated to be energetically less favorable by more than 5 kcal/mol. Common structures of the types I, II, and III are found for dinucleoside phosphates with different purine-pyrimidine sequences. The sequence dependence of the potential energy of these three conformers has been calculated. The experimental nuclear magnetic resonance data of dinucleoside phosphates are consistent with these three conformations.     

Theoretical investigation on the hypochromism of dinucleoside phosphates]

The hypochromism of stacked dimers of the nucleotide bases taken as models of the dinucleoside phosphates and dinucleotides was studied with the use of the configuration interaction and pertubation theory methods. General expression for the hypochromism of the polynucleotides is given in the first order perturbation theory with three different ways for approximation of the matrix elements of the perturbation operator. This expression was used for calculation of the dimer hypochromism in terms of theoretically calculated monomer characteristics. Dependence of the hypochromism on the dimer conformation was investigated. The results obtained so far demonstrate that it is important to take into account the electronic transitions in the vacuum UV region. This approach will enable one to elucidate the contribution of neighbouring bases into the DNA hypochromism.     

Effects of substrate structure on the kinetics of circle opening reactions of the self-splicing intervening sequence from Tetrahymena thermophila: evidence for substrate and Mg2+ binding interactions.

The self-splicing intervening sequence from the precursor rRNA of Tetrahymena thermophila cyclizes to form a covalently closed circle. This circle can be reopened by reaction with oligonucleotides or water. The kinetics of circle opening as a function of substrate and Mg2+ concentrations have been measured for dCrU, rCdU, dCdT, and H2O addition. Comparisons with previous results for rCrU suggest: (1) the 2' OH of the 5' sugar of a dinucleoside phosphate is involved in substrate binding, and (2) the 2' OH of the 3' sugar of a dimer substrate is involved in Mg2+ binding. Evidently, the binding site for a required Mg2+ ion is dependent on both the ribozyme and the dimer substrate. The apparent activation energy and entropy for circle opening by hydrolysis are 31 kcal/mol and 50 eu, respectively. The large, positive activation entropy suggests a partial unfolding of the ribozyme is required for reaction.     

Probing the initial stage of aggregation of the Abeta(10-35)-protein: assessing the propensity for peptide dimerization

Characterization of the early stages of peptide aggregation is of fundamental importance in elucidating the mechanism of the formation of deposits associated with amyloid disease. The initial step in the pathway of aggregation of the Abeta-protein, whose monomeric NMR structure is known, was studied through the simulation of the structure and stability of the peptide dimer in aqueous solution. A protocol based on shape complementarity was used to generate an assortment of possible dimer structures. The structures generated based on shape complementarity were evaluated using rapidly computed estimates of the desolvation and electrostatic interaction energies to identify a putative stable dimer structure. The potential of mean force associated with the dimerization of the peptides in aqueous solution was computed for both the hydrophobic and the electrostatic driven forces using umbrella sampling and classical molecular dynamics simulation at constant temperature and pressure with explicit solvent and periodic boundary conditions. The comparison of the two free energy profiles suggests that the structure of the peptide dimer is determined by the favorable desolvation of the hydrophobic residues at the interface. Molecular dynamics trajectories originating from two putative dimer structures indicate that the peptide dimer is stabilized primarily through hydrophobic interactions, while the conformations of the peptide monomers undergo substantial structural reorganization in the dimerization process. The finding that the phi-dimer may constitute the ensemble of stable Abeta(10-35) dimer has important implications for fibril formation. In particular, the expulsion of water molecules at the interface might be a key event, just as in the oligomerization of Abeta(16-22) fragments. We conjecture that events prior to the nucleation process themselves might involve crossing free energy barriers which depend on the peptide-peptide and peptide-water interactions. Consistent with existing experimental studies, the peptides within the ensemble of aggregated states show no signs of formation of secondary structure.     

Molecular evidence of stereo-specific lactoferrin dimers in solution

Gathering experimental evidence suggests that bovine as well as human lactoferrin self-associate in aqueous solution. Still, a molecular level explanation is unavailable. Using force field based molecular modeling of the protein-protein interaction free energy we demonstrate (1) that lactoferrin forms highly stereo-specific dimers at neutral pH and (2) that the self-association is driven by a high charge complementarity across the contact surface of the proteins. Our theoretical predictions of dimer formation are verified by electrophoretic mobility and N-terminal sequence analysis on bovine lactoferrin.