Sequence requirements for binding of Rep68 to the adeno-associated virus terminal repeats.

We have used reciprocal competition binding experiments with mutant substrates and chemical modification interference assays to precisely define the sequences within the adeno-associated virus (AAV) terminal repeat (TR) that are involved in site-specific binding to the AAV Rep protein. Mutagenesis experiments were done with a 43-bp oligonucleotide which contained the Rep binding element (RBE) within the A stem of the TR. Experiments in which two adjacent base pairs of the RBE were substituted simultaneously with nucleotides that produced transversions identified a 22-bp sequence (CAGTGAGCGAGCGAGCGCGCAG) in which substitutions measurably affected the binding affinity. Although the 22-bp RBE contains the GAGC motifs that have been found in all known Rep binding sites, our results suggest that the GAGC motifs alone are not the only sequences specifically recognized by Rep. The effects of substitutions within the 22-bp sequence were relatively symmetrical, with nucleotides at the periphery of the RBE having the least effect on binding affinity and those in the middle having the greatest effect. Dinucleotide mutations within 18 (GTGAGCGAGCGAGC) of the 22 bp were found to decrease the binding affinity by at least threefold. Dinucleotide mutations within a 10-bp core sequence (GCGAGCGAGC) were found to decrease binding affinity by more than 10-fold. Single-base substitutions within the 10-bp core sequence lowered the binding affinity by variable amounts (up to fivefold). The results of the mutagenesis analysis suggested that the A-stem RBE contains only a single Rep binding site rather than two or more independent sites. To confirm the results of the mutant analysis and to determine the relative contribution of each base to binding, chemical modification experiments using dimethyl sulfate and hydrazine were performed on both the linear A-stem sequence and the entire AAV TR in both the flip and flop hairpinned configurations. Interference assays on the linear A stem identified the 18-bp sequence described above as essential for binding. G, C, and T residues on both strands contributed to binding, and the interference pattern correlated well with the results of the mutagenesis experiments. Interference assays with complete hairpinned TR substrates also identified the 18-bp sequence as important for binding. However, the interference patterns on the two strands within the RBE and the relative contributions of the individual bases to binding were clearly different between the hairpinned substrates and the linear A-stem binding element. Interference assays also allowed us to search for residues within the small internal palindromes of the TR (B and C) that contribute to binding. The largest effect was seen by modification of two T residues within the sequence CTTTG. This sequence was present in the same position relative to the terminal resolution site (trs) in both the flip and flop orientations of the TR. In addition, the interference pattern suggested that the remaining bases within the CTTTG motif as well as other bases within the B and C palindromes make contacts with the Rep protein, albeit with lower affinities. Regardless of whether the TR was in the flip or flop orientation, most of the contact points were clustered in the small internal palindrome furthest away from the trs. We also determined the relative binding affinity of linear substrates containing a complete RBE with hairpinned substrates and found that linear substrates bound Rep less efficiently. Our results were consistent with our previous model that there are three distinct elements within the hairpinned AAV TR that contribute to binding affinity or to efficient nicking at the trs: the A-stem RBE, the secondary structure element which consists of the B and C palindromes, and the trs.     

Avian retroviral long terminal repeats bind CCAAT/enhancer-binding protein.

DNA-protein interactions involving enhancer and promoter sequences within the U3 regions of several avian retroviral long terminal repeats (LTRs) were studied by DNase I footprinting. The rat CCAAT/enhancer-binding protein, C/EBP, bound to all four viral LTRs examined. The Rous sarcoma virus binding site corresponded closely to the 5' limit of the LTR enhancer; nucleotides -225 to -188 were protected as a pair of adjacent binding domains. The Fujinami sarcoma virus LTR bound C/EBP at a single site at nucleotides -213 to -195. C/EBP also bound to the promoter region of the enhancerless Rous-associated virus-0 LTR at nucleotides -77 to -57. The avian myeloblastosis virus LTR bound C/EBP at three sites: nucleotides -262 to -246, -154 to -134, and -55 to -39. We have previously observed binding of C/EBP to an enhancer in the gag gene of avian retroviruses. A heat-treated nuclear extract from chicken liver bound to all of the same retroviral sequences as did C/EBP. Alignment of the avian retroviral binding sequences with the published binding sites for C/EBP in two CCAAT boxes and in the simian virus 40, polyoma, and murine sarcoma virus enhancers suggested TTGNNGCTAATG as a consensus sequence for binding of C/EBP. When two bases of this consensus sequence were altered by site-specific mutagenesis of the Rous sarcoma virus LTR, binding of the heat-stable chicken protein was eliminated.     

Rescue of adeno-associated virus from recombinant plasmids: gene correction within the terminal repeats of AAV

We have isolated three types of pBR322-AAV recombinant plasmids that contain deletions within the 145 bp AAV terminal repeats. When the plasmids were transfected into human cells, mutants that contained deletions within the left (type I) or right (type II) terminal repeat were viable. Of four mutants examined that contained deletions in both termini (type III), only one was viable. All of the viable mutants produced AAV virions that contained wild-type AAV DNA. Furthermore, the viable type III deletion could be converted to a nonviable mutant by deleting all copies of an 11 bp sequence from its termini. We conclude that there is an efficient mechanism for correcting deletions within the AAV termini. A model that could account for these observations is also discussed.     

Sequence requirements for stable binding and function of Rep68 on the adeno-associated virus type 2 inverted terminal repeats.

Replication of the palindromic inverted terminal repeats (ITRs) of adeno-associated virus type 2 requires several functions of the viral nonstructural Rep proteins. These include binding to the ITR, nicking of the double-stranded replication intermediate at the terminal resolution site (trs), and then strand displacement and synthesis from the nick. This report demonstrates the ability of both recombinant fusion maltose-binding protein (MBP)-Rep68 delta produced in Escherichia coli and wild-type (wt) Rep68 to bind to a linear truncated form of the ITR, delta 57 ITR, with similar affinity as to the wt hairpin ITR. A dissociation constant for MBP-Rep68 delta of approximately 8 x 10(-10) M was determined for the wt ITR and delta 57 ITR probes. Truncation of delta 57 ITR to generate delta 28 ITR, which retains the GCTC repeat motif but not the trs, bound at least 10 times less efficiently than delta 57 ITR. Extension of delta 28 ITR with nonspecific sequence restored the ability of MBP-Rep68 delta to bind to delta 28 ITR. Thus, high-affinity binding would appear to require stabilization by flanking sequence as well as the intact GCTC repeat motif. Cleavage of the delta 57 ITR probe with DdeI, which truncates the flanking sequence and was previously shown to inhibit binding by Rep68, also inhibited the binding of MBP-Rep68 delta. The requirements for stable binding were further defined with a series of oligonucleotide probes which spanned the region protected by MBP-Rep78 in DNase I footprinting. The binding activity of either MBP-Rep68 delta or wt Rep68 to hairpin ITR or delta 57 ITR was indistinguishable. However, the binding activity of MBP-Rep68 delta to DNA does not appear to correlate with trs endonuclease activity. The nicking and covalent linkage of MBP-Rep68 delta to the nonhairpin delta 57 ITR was approximately 100-fold less efficient than its linkage to a hairpin-containing ITR. Therefore, although the hairpin portion of the ITR does not appear to play a role in recognition and stabilization of MBP-Rep68 delta binding, its presence does affect the trs cleavage activity of the protein.     

Control of adeno-associated virus type 2 cap gene expression: relative influence of helper virus, terminal repeats, and Rep proteins.

Adeno-associated virus type 2 (AAV-2) gene expression is tightly controlled by functions of the helper virus as well as by the products of its own viral rep gene. Double-immunofluorescence studies of Rep and VP protein expression in cells coinfected with AAV-2 and adenovirus type 2 showed that a large proportion of these cells expressed Rep78 and Rep52 but no capsid proteins. The percentage of Rep78/Rep52- and capsid protein-positive cells was strongly influenced by the relative ratio of AAV-2 to adenovirus type 2. In contrast, nearly all cells positive for Rep68/Rep40 were also positive for capsid protein expression. Examination of p40 promoter transactivation by individual Rep proteins in the presence of adenovirus, however, showed that both Rep78 and Rep68 efficiently stimulated p40 mRNA accumulation and capsid protein expression. This strong transactivation was reliant upon the presence of terminal repeats and correlated with template amplification. In replication-deficient expression constructs, transactivation was observed only with Rep68 and was dependent on the linear Rep binding site within the left terminal repeat which was detected in the presence of high adenovirus concentrations. In the absence of any terminal repeat sequences, Rep68 expression again led to a minor transactivation of capsid protein expression which was detectable only at low adenovirus concentrations. This low level of transactivation of capsid protein expression by Rep proteins in the absence of terminal repeats resulted in a lower efficiency of capsid assembly. The data show a dominant influence of adenovirus type 2 functions on AAV-2 gene expression, a requirement for terminal repeats for strong transactivation of the p40 promoter by Rep proteins, and differential influences of Rep78 and Rep68 on AAV-2 promoters. Implications for the production of recombinant AAV-2 vectors are discussed.     

Cloning and integration of DNA fragments in human cells via the inverted terminal repeats of the adeno-associated virus 2 genome.

In current systems for molecular cloning of eukaryotic genes, bacterial cells are routinely utilized as intermediate hosts. We investigated the possibility of using a viral system for cloning DNA fragments independent of bacterial cell usage. In this report, we provide an alternative approach for molecular cloning of DNA fragments in eukaryotic cells by utilizing the inverted terminal repeats (ITRs) of the genome of a nonpathogenic human parvovirus, the adeno-associated virus 2 (AAV). We constructed a series of chimeric linear duplex DNA molecules, ranging in length from 1.8 to 7.2 kb, containing the cruciform structures of AAV-ITRs at both ends. These 'no-end' (NE) DNA structures, when transfected into adenovirus-infected human cells in the presence of AAV replication proteins (Rep), underwent DNA replication. Furthermore, in the presence of AAV capsid proteins (Cap), all replicated DNA molecules of less than 5.0 kb were packaged into mature, biologically active AAV progeny virions. When a chimeric NE DNA (NE-neo) containing a gene (neo) encoding resistance to neomycin was transfected into human cells, neoR clones could be readily isolated in the presence of G418 (Geneticin). Southern-blot analysis of genomic DNA of several independently isolated neoR clones suggested stable integration of the NE-neo DNA into the host chromosomal DNA. AAV-ITRs, therefore, offer an alternative system for molecular cloning, as well as packaging of DNA fragments in mammalian cells independent of bacterial cell usage.     

Identification of nuclear proteins that specifically interact with adeno-associated virus type 2 inverted terminal repeat hairpin DNA.

A palindromic hairpin duplex containing the inverted terminal repeat sequence of adeno-associated virus type 2 (AAV) DNA was used as a substrate in gel retardation assays to detect putative proteins that specifically interact with the AAV hairpin DNA structures. Nuclear proteins were detected in extracts prepared from human KB cells coinfected with AAV and adenovirus type 2 that interacted with the hairpin duplex but not in nuclear extracts prepared from uninfected, AAV-infected, or adenovirus type 2-infected KB cells. The binding was specific for the hairpin duplex, since no binding occurred with a double-stranded DNA duplex with the identical nucleotide sequence. Furthermore, in competition experiments, the binding could be reduced with increasing concentrations of the hairpin duplex but not with the double-stranded duplex DNA with the identical nucleotide sequence. S1 nuclease assays revealed that the binding was sensitive to digestion with the enzyme, whereas the protein-bound hairpin duplex was resistant to digestion with S1 nuclease. The nucleotide sequence involved in the protein binding was localized within the inverted terminal repeat of the AAV genome by methylation interference assays. These nuclear proteins may be likely candidates for the pivotal enzyme nickase required for replication or resolution (or both) of single-stranded palindromic hairpin termini of the AAV genome.     

Inverted terminal repeats in rabbit poxvirus and vaccinia virus DNA.

In both rabbit poxvirus and vaccinia virus DNA have demonstrated an identical distribution of eight HinfI. The length of the terminal repeats was found to be 3.4 to 3.6 megadaltons (Mdaltons) for rabbit poxvirus DNA and 7.4 to 8.0 Mdaltons for vaccinia virus DNA. Maps of the HinfI restriction sites within isolated EcoRI end fragments of rabbit poxvirus and vaccinia virus DNA PHAVE DEMONSTRATED AN IDENTICAL DISTRIBUTION OF EIGHT HinfI sites in an internal part (approximately 2 Mdaltons) of the EcoRI end fragments of the two genomes.     

Nucleotide sequence of the inverted terminal repetition in adeno-associated virus DNA.

The inverted terminal repetition in adeno-associated virus type 2 DNA has been sequenced. The terminal repetition contain 145 nucleotides of which the first 125 nucleotides can self-base pair to form a T-shaped hairpin structure. Both restriction endonuclease analysis with SmaI and BglI and direct sequence analysis of the SmaI fragments provide evidence for two sequences in the region of the terminal repetition between nucleotides 44 and 81. The two sequences represent an inversion of the first 125 nucleotides of the terminal repetition. Based on these data a model for adeno-associated virus DNA replication is presented which agrees in detail with a general model for eucaryotic DNA replication originally proposed by Cavalier-Smith (T. Cavalier-Smith, Nature [London] 18:672--684, 1976).     

High information conservation implies that at least three proteins bind independently to F plasmid incD repeats.

The 12 incD repeats in the F plasmid each contain about 60 bits of information, which is three times the amount of conservation that a single protein would need to distinguish the repeats from the rest of the Escherichia coli genome. This is the first reported discovery of a case of threefold excess information, and it implies that at least three proteins bind independently to the repeats. In support of this observation, other workers have shown that three polypeptides bind to this region, but only one, SopB, is known to bind independently of other factors. Identification of the other two proteins should help us to understand the mechanism of plasmid partitioning during cell division.     

Identification of cell membrane proteins that bind visna virus.

Visna virus infects cells of ovine origin by attaching to a cell surface receptor via its envelope glycoprotein. The identity of the visna virus receptor is not known. To identify the molecule responsible for binding the virus to target cells, virus overlay protein blot assays were used to examine the molecular weights of cell surface molecules which bind purified virus. Molecules on the surface of goat synovial membrane (GSM) cells and sheep choroid plexus (SCP) cells of approximately 15, 30, and 50 kDa bound to visna virus. The binding of visna virus to these proteins was reduced by preincubating virus with neutralizing antibodies. 125I-labeled cell membrane preparations of GSM and SCP cells were used to affinity purify these virus-binding proteins. These proteins were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and had molecular masses of 15, 30, and 50 kDa. Antibodies to the 50-kDa protein bound to the surface of both live SCP and GSM cells in immunofluorescence assays. In addition, antibodies to the 50-kDa protein blocked the binding of [35S]methionine-labeled visna virus to SCP cells in culture. Antibodies raised against the 15- and 30-kDa proteins did not block virus binding to cells. The blocking activity of antibody of the 50-kDa protein provided data that this protein is the molecule which visna virus recognizes and binds to on the surface of target cells.     

Helper-independent retrovirus vectors with Rous-associated virus type O long terminal repeats.

We have constructed nonpermuted replication-competent avian retrovirus vectors that derive from Rous sarcoma virus (S. H. Hughes, J. J. Greenhouse, C. J. Petropoulos, and P. Sutrave, J. Virol. 61:3004-3012, 1987). We describe here the construction and properties of corresponding vectors in which the long terminal repeats (LTRs) of the parental virus have been replaced by the LTRs of the endogenous chicken virus Rous-associated virus type O. The Rous-associated virus type O LTR vectors replicated approximately 1/10 as well as the parental vectors and expressed a test gene, chloramphenicol acetyltransferase, approximately 1/30 to 1/50 as well.     

A novel terminal resolution-like site in the adeno-associated virus type 2 genome.

The adeno-associated virus 2 (AAV) contains a single-stranded DNA genome of which the terminal 145 nucleotides are palindromic and form T-shaped hairpin structures. These inverted terminal repeats (ITRs) play an important role in AAV DNA replication and resolution, since each of the ITRs contains a terminal resolution site (trs) that is the target site for the AAV rep gene products (Rep). However, the Rep proteins also interact with the AAV DNA sequences that lie outside the ITRs, and the ITRs also play a crucial role in excision of the proviral genome from latently infected cells or from recombinant AAV plasmids. To distinguish between Rep-mediated excision of the viral genome during rescue from recombinant AAV plasmids and the Rep-mediated resolution of the ITRs during AAV DNA replication, we constructed recombinant AAV genomes that lacked either the left or the right ITR sequence and one of the Rep-binding sites (RBSs). No rescue and replication of the AAV genome occurred from these plasmids following transfection into adenovirus type 2-infected human KB cells, as expected. However, excision and abundant replication of the vector sequences was clearly detected from the plasmid that lacked the AAV left ITR, suggesting the existence of an additional putative excision site in the left end of the AAV genome. This site was precisely mapped to one of the AAV promoters at map unit 5 (AAV p5) that also contains an RBS. Furthermore, deletion of this RBS abolished the rescue and replication of the vector sequences. These studies suggest that the Rep-mediated cleavage at the RBS during viral DNA replication may, in part, account for the generation of the AAV defective interfering particles.