Telomere and 45S rDNA sequences are structurally linked on the chromosomes in <Emphasis Type="Italic">Chrysanthemum segetum</Emphasis> L.

Some reports have shown that nucleolar organizer regions are located at the telomeric region and have a structural connection with telomeres at the cellular level in many organisms. In this study, we found that all 45S ribosomal DNA (rDNA) signals were located at telomeric regions on the chromosomes in Chrysanthemum segetum L., and the 45S rDNA showed distinct signal patterns on different metaphase chromosome spreads. The bicolor fluorescence in situ hybridization experiment on the extended fibers revealed that telomere repeats were structurally connected with or interspersed into rDNA sequences. The close cytological structure relation between rDNA and telomere sequences led us to use PCR with combinations of the telomere primer and the rDNA primer to obtain some fragments, which were flanked by different rDNA and telomere primer sequences. One representative clone CHS2 contains closely connected rDNA and telomere sequences, suggesting that the telomere sequence invaded into the conserved rDNA sequence. In addition, the sequences of some PCR clones were flanked by the single telomeric primer sequence or the rDNA primer sequence. These results suggested that homologous recombination occurred between tandem repeat units of rDNA sequences or telomere repeats at the chromosome terminus.     

Sequencing and characterization of telomere and subtelomere regions on rice chromosomes 1S, 2S, 2L, 6L, 7S, 7L and 8S

Telomeres, which are important for chromosome maintenance, are composed of long, repetitive DNA sequences associated with a variety of telomere-binding proteins. We characterized the organization and structure of rice telomeres and adjacent subtelomere regions on the basis of cytogenetic and sequence analyses. The length of the rice telomeres ranged from 5.1 to 10.8 kb, as revealed by both fibre-fluorescent in situ hybridization and terminal restriction-fragment assay. Physical maps of the chromosomal ends were constructed from a fosmid library. This facilitated sequencing of the telomere regions of chromosomes 1S, 2S, 2L, 6L, 7S, 7L and 8S. The resulting sequences contained conserved TTTAGGG telomere repeats, which indicates that the physical maps partly covered the telomere regions of the respective chromosome arms. These repeats were organized in the order of 5'-TTTAGGG-3' from the chromosome-specific region, except in chromosome 7S, in which seven inverted copies also existed in tandem array. Analysis of the telomere-flanking regions revealed the occurrence of deletions, insertions, or chromosome-specific substitutions of single nucleotides within the repeat sequences at the junction between the telomere and subtelomere. The sequences of the 500-kb regions of the seven chromosome ends were analysed in detail. A total of 598 genes were predicted in the telomeric regions. In addition, repetitive sequences derived from various kinds of retrotransposon were identified. No significant evidence for segmental duplication could be detected within or among the subtelomere regions. These results indicate that the rice chromosome ends are heterogeneous in both sequence and characterization.     

Visualization of the terminal structure of rice chromosomes 6 and 12 with multicolor FISH to chromosomes and extended DNA fibers

High-resolution fluorescence in situ hybridization (FISH) on interphase and pachytene nuclei, and extended DNA fibers enabled microscopic distinction of DNA sequences less than a few thousands of base pairs apart. We applied this technique to reveal the molecular organization of telomere ends in japonica rice (Oryza sativa ssp. japonica), which consist of the Arabidopsis type TTTAGGG heptameric repeats and the rice specific subtelomeric tandem repeat sequence A (TrsA). Southern hybridizations of DNA digested with Bal31 and EcoRI, and FISH on chromosomes and extended DNA fibers demonstrated that (1) all chromosome ends possess the telomere tandem repeat measuring 3–4 kb; (2) the subtelomeric TrsA occurs only at the ends of the long arms of chromosomes 6 and 12, and measure 6 and 10 kb, which corresponds to 231 and 682 copies for these sites, respectively; (3) the telomere and TrsA repeats are separated by at most a few thousands of intervening nucleotide sequences. The molecular organization for a general telomere organization in plant chromosomes is discussed.     

Intrachromosomal location of the telomeric repeat (TTAGGG)n

Eukaryotic telomeres are specialized DNA-protein structures that are thought to ensure chromosomal stability and complete replication of the chromosome ends. All telomeres which have been studied consist of a tandem array of G-rich repeats which seem to be sufficient for telomere function. Originally, the human telomeric repeat (TTAGGG)_n was assumed to be exclusively located at the very end of all human chromosomes. More recent evidence, however, suggests an extension into proterminal regions. Very little is known about the interstitial distribution of telomeric repeats. Here we present evidence for the presence of (TTAGGG)_n repeats in internal loci on the long and short arms of different human chromosomes. In addition, we studied the genomic organization of these repeats in more detail and discuss possible functions of interstitial telomeric repeats in the human genome.     

Restriction Enzyme-Resistant High Molecular Weight Telomeric DNA Fragments in Tobacco

Restriction endonuclease-resistant high-molecular-weight (HMW)DNA fragments were isolated from nuclear DNA fragments in tobacco.The size of the fragments produced by EcoRI, HindIII, AfaI,and HaeIII ranged from 20 kb to over 166 kb. The kinetics ofdigestion by Bal31 nuclease showed that most of the HMW fragmentsare chromosome ends. The consensus sequence for tobacco telomererepeats was determined to be CCCTAAA by genomic sequencing usingthe HMW fragments and by sequencing after cloning. Besides thetelomere sequence, 9 tandem repeats of a 45-bp sequence wereidentified, in which a 35-bp unit sequence (AGTCAGCATTAGGGTTTTAAACCCTAAACTGAACT)formed a stem structure. The front of the stem is composed ofa palindrome of the telomere repeats. This highly conservedunit is surrounded by less conserved internal sequences thatare around 10–11 bp in size and contain a TTTT stretch.The internal sequences resemble the 10–11 bp consensusfor the scaffold attachment regions found in yeast and drosophila.The characteristic 45-bp sequence was abundant on the ends ofchromosomes. The shortest distance between the repeats containingtelomeric stem and the telomere was less than 20 kb. This architectureof the tobacco chromosome end region resembles the end regionof yeast chromosomes in which autonomous replication sequencesare present frequently.     

Telomeric DNA allocation in chromosomes of common shrew (Sorex araneus, eulipotyphla)

Recently, we displayed an Iberian shrew species (Sorex granarius) with telomere structures unusual for mammals. Long telomeres on the short acrocentric arms contain an average of 213 kb of telomere repeats, whereas the other chromosomal ends have only 3.8 kb (Zhdanova et al., 2005; 2007). However, it is not clear whether these telomeres are typical for all shrew species or only for S. granarius. S. granarius and common shrew Sorex araneus are sibling species. In this study, using modified Q-FISH we demonstrated that telomeres in S. araneus from various chromosomal races distinguished by their number of metacentrics contain 6.8–15.2 kb of telomeric tracts. The S. araneus telomere lengths appear to correspond to telomere lengths in the majority of both shrew species and wild mammals, whereas S. granarius has telomeres with unique or rare structures. Using DNA and RNA high-specific modified probes to telomeric repeats (PNA and LNA), we showed that interstitial telomeric sites in S. araneus chromosomes contain mainly telomeric DNA and that their localization coincide with some evolutionary breakpoints. Interstitial telomeric DNA in S. granarius chromosomes was not revealed. Thus, the distribution of telomeric DNA may be significantly different, even in closely related species whose chromosomes are composed of almost identical chromosomal arms.     

Ribosomal RNA genes of Phaseolus coccineus. I

rDNA fragments, including the whole intergenic spacer (IGS) region of P. coccineus, were cloned into dephosphorylated pUC 13 plasmid. Four clones of different insert size were analysed. Restriction patterns and physical maps of these length variants (pPH1, pPH2, pPH5, pPH6) were performed through complete Eco RI cleavage and partial digestion with Hpa II, Hae III, Sau 3AI, Sma I. Evidence was obtained that the length heterogeneity of the four genes was mainly due to a differing number of about 170 bp sub-repeating elements in the IGS. Indeed, there are 16 of these in pPH1, about 34 in pPH2, 10 in pPH5 and about 60 in pPH6. The sequence analysis of pPH6 sub-repeats revealed that there are two types of sub-repeats: short ones (S) of 162 bp and long ones (L) of 176 bp. The homology between S and L is high (93.8%). S and L elements are present in at least three of the four genes investigated, as shown by a restriction pattern obtained with Hae III digestion to completion. The relative frequency of S and L types, however, differs among the four genes. The possible functional meaning of the subrepeat structure is discussed on the basis of the homology between the S and L sequences on the one hand and on the other the ribosomal sequences of: i) Xenopus promoter(s); ii) wheat block A sub-repeats; iii) presumptive promoter(s) of wheat.     

Chromosomal mapping of chicken mega-telomere arrays to GGA9, 16, 28 and W using a cytogenomic approach

Four mega-telomere loci were mapped to chicken chromosomes 9, 16, 28, and the W sex chromosome by dual-color fluorescence in situ hybridization using a telomeric sequence probe and BAC clones previously assigned to chicken chromosomes. The in-common features of the mega-telomere chromosomes are that microchromosomes are involved rather than macrochromosomes; in three cases (9, 16, 28) acrocentrics are involved with the mega-telomeres mapping to the p arms. Three of the four chromosomes (9, 16, W) encode tandem repeats which in two cases (9 and 16) involve the ribosomal DNA arrays (the 5S and 18S-5.8S-28S gene repeats, respectively). All involved chromosomes have a typical-sized telomere on the opposite terminus. Intra- and interindividual variation for mega-telomere distribution are discussed in terms of karyotype abnormalities and the potential for mitotic instability of some telomeres. The diversity and distribution of telomere array quantity in the chicken genome should be useful in contributing to research related to telomere length regulation - how and by what mechanism genomes and individual chromosomes establish and maintain distinct sets of telomere array sizes, as well as for future studies related to stability of the chicken genome affecting development, growth, cellular lifespan and disease. An additional impact of this study includes the listing of BAC clones (26 autosomal and six W BACs tested) that were cytogenetically verified; this set of BACs provide a useful tool for future cytogenetic analyses of the microchromosomes.     

Sequence variations of simple sequence repeats on chromosome-4 in two subspecies of the Asian cultivated rice

Computational screening of the chromosome-4 sequence of the rice cultivar Nipponbare (Oryza sativa L. japonica) revealed 1,844 tandem simple sequence repeats (SSRs) or microsatellites with SSR motifs 20 bp and repeated unit length of 1–6 base pairs. Thus SSRs occur once in every 18.8 kb, on the average, on the chromosome with one SSR per 23.8 kb and 16 kb on the short and long arms, respectively. No SSR was detected in the core region of the centromere. Poly(AT) _n repeats represented the most abundant and length polymorphic class of SSRs on the chromosome, but it did not occur in the exons. GC-rich trinucleotide repeats were most abundant in the coding regions, representing 71.69% of the SSRs identified in the exons. Two hundred and twenty four SSRs were associated with the repetitive DNA sequences, most of them were poly(AT) _n tracts. Sequence variations of SSRs between two cultivars, representing the two subspecies of the Asian cultivated rice indica and japonica, were identified, revealing that divergence and convergence of the two subspecies could be traced by the analysis of SSRs. These results provide a great opportunity for SSR-based marker development and comparative genome analysis of the two subspecies of the Asian cultivated rice.Electronic Supplementary Material Supplementary material is available in the online version of this article at .Communicated by Q. Zhang     

Characterisation of Leishmania telomeres reveals unusual telomeric repeats and conserved telomere-associated sequence.

Characterisation of the telomeres of Leishmania is important for understanding many aspects of the parasitic life of this primitive protozoan and for the completion of the physical map and sequencing of the genome. After sequencing more than 300 telomere-derived clones from Leishmania braziliensis and Leishmania major, a conserved 100 bp sequence was identified immediately adjacent to the telomere at the chromosome end and was named LCTAS (Leishmania conserved telomere-associated sequence). The LCTAS contains two conserved sequence boxes, and is present in all Leishmania species studied. The organisation of the LCTAS in the telomeric region differs between L. braziliensis and L. major: in L. major the LCTASs are tandemly repeated, while in L. braziliensis the LCTAS is present as a single copy per end. Two additional TASs with 1.6 kb and 274 bp repeat structures, which are apparently different to LCTAS, were isolated and mapped onto a L. braziliensis 250 kb multicopy minichromosome and the L. major chromosome 1, respectively. An unusual feature in L. braziliensis is that the telomeric repeats are often comprised of a novel tandem repeat CCCTAACCCGTGGA. A 'slippage' mechanism for LCTAS formation is proposed in this study as an alternative way for the synthesis and maintenance of telomeres and subtelomere regions.     

Chromosome-specific distribution of nucleotide substitutions in telomeric repeats of rice (Oryza sativa L.)

Examination of the genomic sequence of the telomere region makes it possible to understand the evolution of the structure of chromosomal ends. We compared the genomic sequences of 14 chromosomal ends of rice, Oryza sativa, L., on the basis of the variation in TTTAGGG repeats. In the proximal telomere repeats, nucleotide substitution occurred more frequently than in the more distal repeats. The most significant diversity was observed at the 1st, 2nd, or 3rd position of TTTAGGG, suggesting that T has been a target of mutation preferentially. Copies of ATTAGGG, CTTAGGG, GTTAGGG, TTCAGGG, TTGAGGG, or TATAGGG were arrayed in tandem, or the same subtypes were located close to each other. The substituted variants were accumulated in chromosomes 2L, 3L, 7L, and 10S but not in the ends of the other chromosomes. In contrast, deletion variants, almost all of which were TTTAGGG to TTAGGG, were dispersed over approximately 4.9% of the sequenced telomere repeats. In summary, the rice proximal telomeric arrays were composed of blocks of at least 6 types of substituted variants and the canonical sequence in a chromosome-specific manner. These results suggest that the variants might arise from the rapid expansion of a single mutation rather than from the gradual accumulation of random mutations.     

Two new families of tandem repeats isolated from genus Vicia using genomic self-priming PCR

A modified genomic self-priming technique was used for rapid isolation of tandem repeats from several Vicia species. Based on homologies of their nucleotide sequences the newly isolated clones were assigned to two repeat families named VicTR-A and VicTR-B. Both families are rich in AT (74%) and are organized as long blocks of tandemly repeated units. The VicTR-A repeats are characterized by a monomer size of 69 bp, whereas the VicTR-B repeat monomer is about 38 bp long, and the two families do not share significant sequence homology. VicTR sequences show different degrees of amplification (up to 10⁶–10⁷ copies/haploid genome) in individual Vicia species and are not amplified in other legumes. The abundances of these repeats do not correlate with genome sizes but are similar in species that belong to the same taxonomic section within the genus Vicia. Primed in situ (PRINS) labeling of metaphase chromosomes of V. pannonica revealed that VicTR-A sequences are located predominantly in the telomeric regions of the short arms of all chromosomes. In contrast, labeling of VicTR-B repeats in V. sativa resulted in mainly intercalary bands of various intensities and only weak telomeric signals. Received: 15 December 1999 / Accepted: 8 March 2000     

Karyotypic characterization and genomic organization of the 5S rDNA in <Emphasis Type="Italic">Polypterus senegalus</Emphasis> (Osteichthyes,Polypteridae)

Polypteridae (Cladistia) is a family of archaic fishes, confined to African freshwaters. On account of their primitiveness in anatomical and morphological characters and mosaic relationships among lower Osteichthyans fishes, they constitute an important subject for the study of evolution in vertebrates. Very little is known about the karyological structure of these species. In this article, a cytogenetic analysis on twenty specimens of Polypterus senegalus (Cuvier, 1829) was performed using both classical and molecular techniques. Karyotype (2n = 36; FN = 72), chromosome location of telomeric sequences (TTAGGG) _n , (GATA)₇ repeats and ribosomal 5S and 18S rRNA genes were examined by using Ag-NOR, classical C-banding, CMA₃ staining and FISH. Staining with Ag-NOR showed the presence of two GC rich NORs on the p arm of the chromosome pair no. 1. CMA₃ marked all centromerical and some (no. 1 and no. 14) telomeric regions. FISH with 5S rDNA marked the subtelomeric region of the q arm of the chromosome pair no. 14. FISH with 18S rDNA marked the telomeric region of the p arm of the chromosome pair no. 1, previously marked by Ag-NOR. (GATA)₇ repeats marked the subtelomeric regions of all chromosome pairs, with the exclusion of the no. 1, 3 and 14. Hybridization with telomeric probes (TTAGGG) _n showed bright signals at the end of all chromosomes. After cloning, the 5SrDNA alignment revealed an organization of sequences made up of two different classes of tandem arrays (5S type I and 5S type II) of different lengths.     

A Concertedly Evolving Region in Chironomus, Unique Within the Telomere

Chromosome terminal, complex repeats in the dipteran Chironomus pallidivittatus show rapid concerted evolution during which there is remarkably efficient homogenization of the repeat units within and between chromosome ends. It has been shown previously that gene conversion is likely to be an important component during these changes. The sequence evolution could be a result of different processes—exchanges between repeats in the tandem array as well as information transfer between units in different chromosomes—and is therefore difficult to analyze in detail. In this study the concerted evolution of a region present only once per chromosome, at the junction between the telomeric complex repeats and the subtelomeric DNA was therefore investigated in the two sibling species C. pallidivittatus and C. tentans. Material from individual microdissected chromosome ends was used, as well as clones from bulk genomic DNA. On the telomeric side of the border pronounced species-specific sequence differences were observed, the patterns being similar for clones of different origin within each species. Mutations had been transmitted efficiently between chromosomes also when adjoining, more distally localized DNA showed great differences in sequence, suggesting that gene conversion had taken place. The evolving telomeric region bordered proximally to subtelomeric DNA with high evolutionary constancy. More proximally localized, subtelomeric DNA evolved more rapidly and showed heterogeneity between species and chromosomes. Received: 24 September 1997 / Accepted: 24 November 1997     

Chromosomal Instability and Telomere Length Variations during the Life Span of Human Fibroblast Clones

Growth characteristics, karyotype changes, and telomere length variations were analyzed during the life span of 12 anchorage-independent clones isolated from a xeroderma pigmentosum fibroblast strain. After an initial period of comparable active growth, all the clones showed a decline in the growth rate and finally entered a phase of replicative senescence; however, the number of population doublings and the time required to enter senescence varied among the clones. Repeated cytogenetic analyses during culture propagation showed the appearance of chromosome anomalies, mainly telomeric association (tas) and unbalanced translocations. In all the clones the percentage of abnormal mitoses increased with culture passage, but reached different levels (from less than 10% to about 100%). This finding indicates that the replicative block may be associated with differently altered cytogenetic patterns. Specific chromosome arms (5p, 16q, 19q, and 20q) were preferentially involved intas,suggesting that alterations in chromosome ends may occur which predispose to fusion. In some clones it was possible to demonstrate the origin of marker chromosomes from the evolution oftas.Telomere length analysis by Southern blotting on DNA samples prepared from 7 clones and from the parental cell lines showed that the terminal restriction fragment (TRF) profiles were homogeneous in senescent parental cells and in the clones during the last part of their life in culture, regardless of the degree of karyotype abnormalities. The homogeneity of the TRF profiles supports the hypothesis of a critical telomere length at senescence.     

Sequence comparison of distal and proximal ribosomal DNA arrays in rice (Oryza sativa L.) chromosome 9S and analysis of their flanking regions

Rice (Oryza sativa ssp. japonica cv. Nipponbare) harbors a ribosomal RNA gene (rDNA) cluster in the nucleolar-organizing region at the telomeric end of the short arm of chromosome 9. We isolated and sequenced two genomic clones carrying rice rDNA fragments from this region. The rice rDNA repeat units could be classified into three types based on length, which ranged from 7,928 to 8,934 bp. This variation was due to polymorphism in the number of 254-bp subrepeats in the intergenic spacer (IGS). Polymerase chain reaction (PCR) analysis suggested that the rDNA units in rice vary widely in length and that the copy number of the subrepeats in the IGS ranges from 1 to 12 in the rice genome. PCR and Southern blot analyses showed that most rDNA units have three intact and one truncated copies of the subrepeats in the IGS, and distal (telomere-side) rDNA units have more subrepeats than do proximal (centromere-side) ones. Both genomic clones we studied contained rDNA-flanking DNA sequences of either telomeric repeats (5′-TTTAGGG-3′) or a chromosome-specific region, suggesting that they were derived from the distal or proximal end, respectively, of the rDNA cluster. A similarity search indicated that retrotransposons appeared more frequently in a 500-kb portion of the proximal rDNA-flanking region than in other subtelomeric regions or sequenced regions of the genome. This study reveals the repetitive nature of the telomeric end of the short arm of chromosome 9, which consists of telomeric repeats, an rDNA array, and a retrotransposon-rich chromosomal region.Sequence accession numbers in DDBJ assigned for OSJNOa063K24 and OSJNBb0013K10 are AP009051 and AP008245, respectively.     

Quantification of total genomic DNA and selected repetitive sequences reveals concurrent changes in different DNA families in indica and japonica rice

This paper describes a fluorescence in situ hybridization (FISH) analysis of three different repetitive sequence families, which were mapped to mitotic metaphase chromosomes and extended DNA fibers (EDFs) of the two subspecies of rice (Oryza sativa), indica and japonica (2n=2x=24). The repeat families studied were (1) the tandem repeat sequence A (TrsA), a functionally non-significant repeat; (2) the [TTTAGGG]_n telomere sequence, a non-transcribed, tandemly repeated but functionally significant repeat; and (3) the 5S ribosomal RNA (5S rDNA). FISH of the TrsA repeat to metaphase chromosomes of indica and japonica cultivars revealed clear signals at the distal ends of twelve and four chromosomes, respectively. As shown in a previous report, the 17S ribosomal RNA genes (17S rDNA) are located at the nucleolus organizers (NORs) on chromosomes 9 and 10 of the indica cultivar. However, the japonica rice lacked the rDNA signals on chromosome 10. The size of the 5S rDNA repeat block, which was mapped on the chromosome 11 of both cultivars, was 1.22 times larger in the indica than in the japonica genome. The telomeric repeat arrays at the distal ends of all chromosome arms were on average three times longer in the indica genome than in the japonica genome. Flow cytometric measurements revealed that the nuclear DNA content of indica rice is 9.7% higher than that of japonica rice. Our data suggest that different repetitive sequence families contribute significantly to the variation in genome size between indica and japonica rice, though to different extents. The increase or decrease in the copy number of several repetitive sequences examined here may indicate the existence of a directed change in genome size in rice. Possible reasons for this phenomenon of concurrent evolution of various repeat families are discussed. Received: 9 August 1999 / Accepted: 29 December 1999     

Characterisation of the telomeres at opposite ends of a 3 Mb Theileria parva chromosome.

Bacteriophage lambda clones containing Theileria parva genomic DNA derived from two different telomeres were isolated and the nucleotide sequences of the telomeric repeats and adjacent telomere-associated (TAS) DNA were determined. The T.parva telomeric repeat sequences, a tandem array of TTTTAGGG or TTTAGGG interspersed with a few variant copies, showed a high degree of sequence identity to those of the photosynthetic algae Chlamydomonas reinhardtii (97% identity) and Chlorella vulgaris (87.7% identity) and the angiosperm Arabidopsis thaliana (84.4% identity). Unlike most organisms which have been studied, no significant repetitive sequences were found in the nucleotide sequences of TAS DNA located centromere-proximal to the telomeric repeats. Restriction mapping and hybridisation analysis of lambda EMBL3 clones containing 16 kilobases of TAS DNA derived from one telomere suggested that they did not contain long regions of repetitive DNA. The cloned TAS DNAs were mapped to T.parva Muguga genomic SfiI fragments 8 and 20, which are located at opposite ends of the largest T.parva chromosome. A 126 bp sequence located directly centromere-proximal to the telomeric repeats was 94% identical between the two cloned telomeres. The conserved 126 bp sequence was present on all T.parva Muguga telomeric SfiI fragments.     

Dynamics of telomere turnover inPlasmodium berghei

Non-uniform composition in telomeric repeats at the extremities ofPlasmodium chromosomes was exploited in order to obtain data on intraclonal diversification of telomeric sequences, relevant for the study of telomere regeneration dynamics. Families of sibling telomeric clones were obtained from several chromosomal ends ofPlasmodium berghei, and analysed so as to determine the exact points from which individual clones start to diverge. As much as 90% of the telomeric tract appears to be subject to events causing abrupt changes in the sequence of telomeric repeats. The results are compatible with the hypothesis that breakpoint probability is a continuously increasing function over the entire telomeric tract.