Nucleotide sequence of bacteriophage fd DNA.

The sequence of the 6,408 nucleotides of bacteriophage fd DNA has been determined. This allows to deduce the exact organisation of the filamentous phage genome and provides easy access to DNA segments of known structure and function.     

DNA regions essential for the function of a bacteriophage fd promoter.

The promoter for the major coat protein gene of bacteriophage fd contains a unique sequence. TATAAT, in the non-transcribed region corresponding to the Pribnow box. A R-Hha I cleavage site which destroys functions is located five pairs upstream from the TATAAT sequence (fifteen base pairs upstream from the RNA initiation site). The promoter was cleaved into two fragments by R-Hha I and each promoter fragment was joined to DNA fragments derived from other regions. Ligation of the TATAAT-containing fragment to any of the DNA fragments examined resulted in recovery of promoter function. The results suggest for this type of promoter that no unique sequence is necessary upstream from the R-Hha I cleavage site although a contiguous DNA chain must be present in this area.     

Location of the cooperative melting regions in bacteriophage fd DNA

Differential melting profiles of the linear replicative form (RF-III) DNA of bacteriophage fd, of the fragments obtained by the restriction endonuclease R.HinHI and of those obtained by R.Hga were investigated. With these results a physical map which locates the cooperative melting regions on the DNA was constructed, and compared with the genetic map.     

Studies on bacteriophage fd DNA. II. Localization of RNA initiation sites on the cleavage map of the fd genome.

In an in vitro RNA synthesizing system, a single size of A-start RNA and three different sizes of G-start RNA are predominantly transcribed on the doubly closed replicative form (RFI) DNA of phage fd. When the RFI DNA was cleaved into three fragments (HinH-A, HinH-B and HinH-C) by a restriction endonuclease from Haemophilus influenzae H-I, the A-start RNA was predominantly initiated on HinH-B and the three G-start RNAs on HinH-A. RFI DNA was further cleaved into smaller pieces by two other restriction endonucleases from H. aphirophilus and H. gallinarum. Upon mixing the digests with RNA polymerase, two specific fragments derived from HinH-A were bound to the polymerase with GTP present. G-start RNA was efficiently initiated on the fragments isolated by this procedure. On the basis of these observations and estimates of the size of RNA formed on each fragment, the initiation sites for major RNA species were localized on the cleavage map of the phage fd genome previously constructed.     

Structure at 2.3 A resolution of the gene 5 product of bacteriophage fd: a DNA unwinding protein.

The structure of the gene 5 DNA unwinding protein from bacteriophage fd has been determined by X-ray diffraction analysis of single crystals to 2.3 Å resolution using six isomorphous heavy-atom derivatives. The essentially globular monomer appears to consist of three secondary structural elements, a radically twisted three-stranded antiparallel β sheet and two distinct anti-parallel β loops, which are joined by short segments of extended polypeptide chain. The molecule contains no α-helix. A long groove, or arch, 30 Å in length is formed by the underside of the twisted β sheet and one of the two β ribbons. We believe this groove to be the DNA binding region, and this is supported by the assignment of residues on its surface implicated in binding by solution studies. These residues include several aromatic amino acids which may intercalate or stack upon the bases of the DNA. Two monomers are maintained as a dimer by the very close interaction of symmetry related β ribbons about the molecular dyad. About six residues at the amino and carboxyl terminus are in extended conformation and both seem to exhibit some degree of disorder. The amimo-terminal methionine is the locus for binding the platinum heavy-atom derivatives and tyrosine 26 for attachment of the major iodine substituent.     

Nuclear magnetic resonance of the filamentous bacteriophage fd.

The filamentous bacteriophage fd and its major coat protein are being studied by nuclear magnetic resonance (NMR) spectroscopy. 31P NMR shows that the chemical shielding tensor of the DNA phosphates of fd in solution is only slightly reduced in magnitude by motional averaging, indicating that DNA-protein interactions substantially immobilize the DNA packaged in the virus. There is no evidence of chemical interactions between the DNA backbone and the coat protein, since experiments on solid virus show the 31P resonances to have the same principle elements of its chemical shielding tensor as DNA. 1H and 13C NMR spectra of fd virus in solution indicate that the coat proteins are held rigidly in the structure except for some aliphatic side chains that undergo relatively rapid rotations. The presence of limited mobility in the viral coat proteins is substantiated by finding large quadrupole splittings in 2H NMR of deuterium labeled virions. The structure of the coat protein in a lipid environment differs significantly from that found for the assembled virus. Data from 1H and 13C NMR chemical shifts, amide proton exchange rates, and 13C relaxation measurements show that the coat protein in sodium dodecyl sulfate micelles has a native folded structure that varies from that of a typical globular protein or the coat protein in the virus by having a partially flexible backbone and some rapidly rotating aromatic rings.     

Refined structure of the gene 5 DNA binding protein from bacteriophage fd

The three-dimensional structure of the gene 5 DNA binding protein (G5BP) from bacteriophage fd has been determined from a combination of multiple isomorphous replacement techniques, partial refinements and deleted fragment difference Fourier syntheses. The structure was refined using restrained parameter least-squares and difference Fourier methods to a final residual of R = 0.217 for the 3528 statistically significant reflections present to 2.3 A resolution. In addition to the 682 atoms of the protein, 12 solvent molecules were included. We describe here the dispositions and orientations of the amino acid side-chains and their interactions as visualized in the G5BP structure. The G5BP monomer of 87 peptide units is almost entirely in the beta-conformation, organized as a three-stranded sheet, a two-stranded beta-ribbon and a broad connecting loop. There is no alpha-helix present in the molecule. Two G5BP monomers are tightly interlocked about an intermolecular dyad axis to form a compact dimer unit of about 55 A X 45 A X 36 A. The dimer is characterized by two symmetry-related antiparallel clefts that traverse the monomer surfaces essentially perpendicular to the dyad axis. From the three-stranded antiparallel beta-sheet, formed from the first two-thirds of the sequence, extend three tyrosine residues (26, 34, 41), a lysine (46) and two arginine residues (16, 21) that, as indicated by other physical and chemical experiments, are directly involved in DNA binding. Other residues likely to share binding responsibility are arginine 80 extending from the beta-ribbon and phenylalanine 73 from the tip of this loop, but as provided, however, by the opposite monomer within each G5BP dimer pair. Thus, both symmetry-related DNA binding sites have a composite nature and include contributions from both elements of the dimer. The gene 5 dimer is clearly the active binding species, and the two monomers within the dyad-related pair are so structurally contiguous that one cannot be certain whether the isolated monomer would maintain its observed crystal structure. This linkage is manifested primarily as a skeletal core of hydrophobic residues that extends from the center of each monomer continuously through an intermolecular beta-barrel that joins the pair. Protruding from the major area of density of each monomer is an elongated wing of tenuous structure comprising residues 15 through 32, which is, we believe, intimately involved in DNA binding. This wing appears to be dynamic and mobile, even in the crystal and, therefore, is likely to undergo conformational change in the presence of the ligand.     

Photo-induced cross-linkage of gene-5 protein and bacteriophage fd DNA+

The gene 5 protein, coded for by the bacteriophage fd, forms a complex with single stranded fd-DNA such that one gene 5 protein monomer interacts with four bases. Exposure of this complex to ultraviolet light results in the formation of covalent bonds between 25-30% of the gene 5 protein monomers which are bound to the DNA. In contrast, when the intact fd virion, which is a complex of coat protein and DNA, was exposed to ultraviolet irradiation, no detectable protein DNA cross-links were found.     

Conversion of bacteriophage fd into an efficient single-stranded DNA vector system

Summary Single-stranded DNA vectors were constructed in vitro by insertion of various DNA fragments into the Intergenic Region of the single-stranded DNA phage fd. These inserts introduce into the phage genome unique cleavage sites for restriction nucleases which are suited for sticky joining in cloning experiments. Since these sites are usually located within genes coding for antibiotic resistance, inactivation of a resistance gene by insertion can be used as a marker for the successful cloning of a DNA fragment. Resistance genes also allow to select for recombinant DNA phages and to minimize the loss of DNA inserts which otherwise becomes significant above an insert size of about one kb. Cloning of several DNA fragments is described and strand separation of double-stranded DNA fragments by means of cloning into fd DNA is given as an example for application of single-stranded DNA vectors.Abbreviations Ap ampicillin - Cm chloramphenicol - Km kanamycin - Sm streptomycin - kb, kbp a unit length equivalent to 1000 bases, respectively 1000 base pairs - wt wild type     

Structure of the dna binding cleft of the gene 5 protein from bacteriophage fd

The structure of the gene 5 DNA unwinding protein from bacteriophage fd has been solved to 2.3-Å resolution by X-ray diffraction techniques. The molecule contains an extensive cleft region that we have identified as the DNA binding site on the basis of the residues that comprise its surface. The interior of the groove has a rather large number of basic amino acid residues that serve to draw the polynucleotide backbone into the cleft. Arrayed along the external edges of the groove are a number of aromatic amino acid side groups that are in position to stack upon the bases of the DNA and fix it in place. The structure and binding mechanism as we visualize it appear to be fully consistent with evidence provided by physical-chemical studies of the protein in solution.     

Studies on bacteriophage fd DNA. III. Nucleotide sequence preceding the RNA start-site on a promoter-containing fragment.

A short DNA fragment containing a strong promoter was isolated from phage fd replicative form DNA with the use of restriction endonucleases, and the sequence of 110 nucleotides in the region preceding the RNA start-site was determined. The sequence was : (5') CGGTCTGGTTCGCTTTGAGGCTCGAATTAAAACGCGATATTTGAAGTCTTTCGGGCTTCCTCTTAATCTTTTTGATCGAATTCGCTTTGCTTCTGACTATAATAGACAGG (3').