C-terminus of a long alpha-neurotoxin is highly mobile when bound to the nicotinic acetylcholine receptor: a time-resolved fluorescence anisotropy approach

To better understand how alpha-neurotoxins interact with the acetylcholine receptor, four fluorescein isothiocyanate derivatives of the siamemsis alpha-cobratoxin were prepared (conjugated to the epsilon-amino group in Lys(23), Lys(35), Lys(49), or Lys(69)) and the time-resolved fluorescence anisotropy of each conjugate was measured free in solution and bound to the Torpedo acetylcholine receptor. All the conjugated reporter groups displayed a high and comparable level of mobility free in solution. When receptor bound, on the other hand, significant differences in the conformational dynamics of the reporter groups were observed with the C-terminal Lys(69) derivative displaying by far the greatest mobility strongly suggesting that the C-terminal domain of the bound neurotoxin is highly mobile and does not participate in the toxin-nAChR binding surface. Additionally, this study demonstrates the utility of time-resolved fluorescence anisotropy to characterize the interaction of heteroproteins.     

CP-arene oxides: the ultimate, active mutagenic forms of cyclopenta-fused polycyclic aromatic hydrocarbons (CP-PAHs)

The bacterial mutagenic response (Ames-assay, Salmonella typhimurium strain TA98+/-S9-mix) of a series of monocyclopenta-fused polycyclic aromatic hydrocarbons (CP-PAHs) identified in combustion exhausts, viz. cyclopenta[cd]pyrene (1), acephenanthrylene (2), aceanthrylene (3) and cyclopenta[hi]chrysene (4), is re-evaluated. The mutagenic effects are compared with those exerted by the corresponding partially hydrogenated derivatives, 3,4-dihydrocyclopenta[cd]pyrene (5), 4,5-dihydroacephenanthrylene (6), 1,2-dihydroaceanthrylene (7) and 4,5-dihydrocyclopenta[hi]chrysene (8). It is shown that the olefinic bond of the externally fused five-membered ring of 1, 3 and 4 is of importance for a positive mutagenic response. In contrast, whilst CP-PAH 2 is found inactive, its dihydro analogue (6) shows a weak metabolism-dependent response. The importance of epoxide formation at the external olefinic bond in the five-membered ring is substantiated by the bacterial mutagenic response of independently synthesized cyclopenta[cd]pyrene-3,4-epoxide (9), acephenanthrylene-4,5-epoxide (10), aceanthrylene-1,2-epoxide (11) and cyclopenta[hi]chrysene-4,5-epoxide (12). Their role as ultimate, active mutagenic forms, when CP-PAHs 1, 3 and 4 exhibit a positive mutagenic response, is confirmed. Semi-empirical Austin Model 1 (AM1) calculations on the formation of the CP-arene oxides (9-12) and their conversion into the monohydroxy-carbocations (9a-12a and 9b-12b) via epoxide-ring opening support our results. For 2 and 4, which also possess a bay-region besides an annelated cyclopenta moiety, the calculations rationalize that epoxidation at the olefinic bond of the cyclopenta moiety is favoured.     

Facilitation of the conversion from B to Z conformation in poly(dG-dC) modified by anti-benzo(a)pyrene-7,8-dihydrodiol-9,10-epoxide

The transition from B to Z conformation has been studied in poly(dG-dC) covalently modified with racemic anti- or syn-benzo(a)pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), a strong and a weak carcinogen, respectively. Circular dichroism was used to study the kinetics of the transition after a sudden increase of the ionic strength to 2.7 M NaCl. The results show that the rate of the B to Z transition of poly(dG-dC) in high NaCl concentration is considerably enhanced by bound anti-BPDE and diminished by bound syn-BPDE. The results may be interpreted such that at the binding site of anti-BPDE the base stacking is distorted and made looser, which facilitates the B to Z transition. The partly intercalative nature of the syn-BPDE complexes apparently is effective in reducing the rate of the transition. These properties of the two BPDEs may be relevant to explain their different carcinogenic potencies.     

STAT3 repressed USP7 expression is crucial for colon cancer development

Interleukin-6 (IL-6) induced STAT3 activation is viewed as crucial for multiple tumor growth and metastasis, including colon cancer. However, the molecular mechanisms remain largely unexplored. Here, we show that expression of ubiquitin-specific protease 7 (USP7), a deubiquitylating enzyme, is decreased in STAT3-positive tumors. IL-6 administration or transfection of a constitutively activated STAT3 in SW480 cells also repressed USP mRNA expression. Using luciferase reporter and ChIP assay, we found that STAT3 bound to the promoter region of USP7 and inhibited its activity through recruiting HDAC1. As a result of the decline of USP7 expression, endogenous P53 protein level was decreased. Thus, our results suggest a previously unknown STAT3-USP7-P53 molecular network controlling colon cancer development.

Structured summary of protein interactions:

STAT3physically interacts with HDAC1 by anti bait coimmunoprecipitation (View interaction)     

Repair of DNA lesions: mechanisms and relative repair efficiencies

DNA is frequently damaged by endogenous agents inside the cells. Some exogenous agents such as polycyclic aromatic hydrocarbons (PAHs) are ubiquitous in the environment and may thus contribute to the 'background' DNA damage in humans. DNA lesions are normally removed by various repair mechanisms. The major repair mechanisms for various DNA lesions are summarized. In contrast to the extensively studied repair mechanisms, much less is known about the relative repair efficiencies of various DNA lesions. Since DNA repair is a crucial defense against carcinogenesis, it may constitute an important factor affecting the carcinogenicity of DNA damaging agents. We have adopted a human cell-free system for measuring relative DNA repair efficiencies based on the concept of repair competition between acetylaminofluorene adducts and other DNA lesions of interest. Using this in vitro system, we determined the relative repair efficiencies of PAH adducts induced by: anti-(+/-)-benzo[a]pyrene-trans-7,8-dihydrodiol-9,10-epoxide (BPDE), anti-(+/-)-benz[a]anthracene-trans-3,4-dihydrodiol-1,2-epoxide (BADE-I), anti-(+/-)-benz[a]anthracene-trans-8,9-dihydrodiol-10, 11-epoxide (BADE-II), anti-(+/-)-benzo[b]fluoranthene-trans-9, 10-dihydrodiol-11,12-epoxide (BFDE), anti-(+/-)-chrysene-trans-1, 2-dihydrodiol-3,4-epoxide (CDE), and anti-(+/-)-dibenzo[a, l]pyrene-trans-11,12-dihydrodiol-13,14-epoxide (DBPDE). While damage by BPDE, DBPDE, CDE, and BFDE were repaired by nucleotide excision repair as efficiently as AAF adducts, the repair of BADE-I and BADE-II adducts were significantly slower in human cell extracts. Damage by DBPDE at 3 microM in vitro yielded approximately 5-fold higher DNA adducts than BPDE as determined by quantitative PCR. This potent DNA reactivity may account in part for the potent carcinogenicity of dibenzo[a,l]pyrene. The correlation of these results to the carcinogenic properties of the PAH compounds is discussed. Furthermore, we show that NER plays a role in AP site repair in vivo in the eukaryotic model organism yeast.     

Chiral stationary phase high-performance liquid chromatographic resolution and absolute configuration of enantiomeric benzo[a]pyrene diol-epoxides and tetrols

Enantiomers of diastereomeric benzo[a]pyrene (BP) diol-epoxides, r-7,t-8-dihydroxy-t-9,10-epoxy-7,8,9,10-tetrahydro-BP (BP 7,8-diol-anti-9,10-epoxide), r-7,t-8-dihydroxy-c-9,10-epoxy-7,8,9,10-tetrahydro-BP (BP 7,8-diol-syn-9,10-epoxide), r-9,t-10-dihydroxy-t-7,8-epoxy-7,8,9,10-tetrahydro-BP (BP 9,10-diol-anti-7,8-epoxide), and several 7,8,9,10-tetrahydroxy-7,8,9,10-tetrahydrobenzo[a]pyrenes (BP tetrols) were resolved by high-performance liquid chromatography (HPLC) using columns packed with either (R)-N-(3,5-dinitrobenzoyl)phenylglycine[(R)-DNBPG] or (S)-N-(3,5-dinitrobenzoyl)leucine [(S)-DNBL], which is either ionically or covalently bonded to gamma-aminopropylsilanized silica. Resolution of enantiomers was confirmed by ultraviolet-visible absorption and circular dichroism spectral analyses. Resolved enantiomers of BP diol-epoxides were each hydrolyzed in acidic solution to a pair of diastereomeric tetrols which were separated by reversed-phase HPLC. Absolute stereochemistries of enantiomeric diol-epoxides were deduced by the absolute configuration of their hydrolysis products.     

Light-dependent conversion of carotenoids in the parasitic angiosperm Cuscuta reflexa L.

The parasitic angiosperm Cuscuta reflexa contains unusually high amounts of the carotenoids lutein-5,6-epoxide and 9- cis -violaxanthin. In this study the light-dependent conversions of these carotenoids in entire plant tissue and purified LHCII b was compared with that of the xanthophyll cycle carotenoid violaxanthin when plants are exposed to high irradiance followed by low irradiance. In entire tissue under high irradiance, similar conversion kinetics and stoichiometry with de-epoxidation products suggest that both lutein-5,6-epoxide and all- trans -violaxanthin are equally suitable substrates for de-epoxidase. This is not the case under low irradiance as, although epoxidation of zeaxanthin and antheraxanthin rapidly restores the violaxanthin pool, the recovery of the lutein-5,6-epoxide pool is comparatively slow and has no stoichiometric relationship with its de-epoxidation product, lutein. Light-dependent changes in the concentration of 9- cis -violaxanthin mimic violaxanthin. However, the inability to detect de-epoxidation products or to de-epoxidize 9- cis -violaxanthin in vitro suggests that it is not subject to de-epoxidation and, instead, its concentration changes may reflect the equilibrium between isomers of violaxanthin. Light exposure did not affect the composition of carotenoids bound to purified LHCII b , indicating that these bound carotenoids are not subject to de-epoxidation and do not contribute to the isomer pool equilibrium. The biosynthetic origins of lutein-5,6-epoxide and the potential role of these carotenoid cycles in photoprotection are discussed.     

Nuclear Overhauser effect studies of the conformations of MgATP bound to the active and secondary sites of muscle pyruvate kinase

MgATP binds both at the active site (site 1) and at a secondary site (site 2) on each monomer of muscle pyruvate kinase as previously found by binding studies and by X-ray analysis. Interproton distances on MgATP bound at each site have been measured by the time-dependent nuclear Overhauser effect in the absence and presence of phosphoenolpyruvate (P-enolpyruvate), which blocks ATP binding at site 1. Interproton distances at site 2 are consistent with a single conformation of bound ATP with a high antiglycosidic torsional angle (chi = 68 +/- 10 degrees) and a C3'-endo ribose pucker (delta = 90 +/- 10 degrees). Interproton distances at site 1, determined in the absence of P-enolpyruvate by assuming the averaging of distances at both sites, cannot be fit by a single adenine-ribose conformation but require the contribution of at least three low-energy structures: 62 +/- 10% low anti (chi = 30 degrees), C3'-endo; 20 +/- 8% high anti (chi = 55 degrees), O1'-endo; and 18 +/- 8% syn (chi = 217 degrees), C2'-endo. Although a different set of ATP conformations might also have fit the interproton distances, the mixture of conformations used also fits previously determined distances from Mn2+ to the protons of ATP bound at site 1 [Sloan, D. L., & Mildvan, A. S. (1976) J. Biol. Chem. 251, 2412] and is similar to the adenine-ribose portion of free Co(NH3)4ATP, which consists of 35% low anti, 51% high anti, and 14% syn [Rosevear, P. R., Bramson, H. N., O'Brian, C., Kaiser, E. T., & Mildvan, A. S. (1983) Biochemistry 22, 3439].(ABSTRACT TRUNCATED AT 250 WORDS)     

Germacranolides from Viguiera microphylla

Three new germacranolides, including two heliangolides (niveusin C-2′,3′-epoxide and 1,2-dehydroniveusin C-2′,3′-epoxide) and a germacrolide (3β-hydroxy-8β-epoxyangeloyloxycostunolide-1β,10α-epoxide) were isolated from Viguiera microphylla. Their structures were established by spectroscopic analyses, including extensive ¹H NMR and ¹³C NMR decoupling experiments and chemical transformations. X-ray diffraction analysis confirmed the structure of niveusin C-2′,3′-epoxide.     

Human umbilical cord mesenchymal stem cells facilitate the up‐regulation of miR‐153‐3p,whereby attenuating MGO‐induced peritoneal fibrosis in rats

MiRNAs contribute greatly to epithelial to mesenchymal transition (EMT) of peritoneal mesothelial cells (PMCs), which is a crucial step in peritoneal fibrosis (PF). In this study, we tried to profile whether miRNA expression differences exist after human umbilical cord mesenchymal stem cells (hUCMSCs) treatment in PF rats and investigate the possible role of miR‐153‐3p involved in anti‐EMT process. We randomly assigned 34 rats into three groups: control group (Group Control), MGO‐induced PF rats (Group MGO) and hUCMSCs‐treated rats (Group MGO + hUCMSCs). MiRNA microarrays and real‐time PCR analyses were conducted in three groups. α‐SMA, Snail1 and E‐cadherin expression were detected by Western blot. Luciferase reporter assays were used to detect the effects of miR‐153‐3p overexpression on Snai1 in rat peritoneal mesothelial cells (RPMCs). We identified differentially expressed miRNAs related to EMT, in which miR‐153‐3p demonstrated the greatest increase in Group MGO + hUCMSCs. Transient cotransfection of miR‐153‐3p mimics with luciferase expression plasmids resulted in a significant repression of Snai1 3′‐untranslated region luciferase activity in RPMCs. These studies suggest that miR‐153‐3p is a critical molecule in anti‐EMT effects of hUCMSCs in MGO‐induced PF rats. MiR‐153‐3p might exert its beneficial effect through directly targeting Snai1.     

A complex array of DNA-binding proteins required for pairing-sensitive silencing by a polycomb group response element from the Drosophila engrailed gene

Regulatory DNA from the Drosophila gene engrailed causes silencing of a linked reporter gene (mini-white) in transgenic Drosophila. This silencing is strengthened in flies homozygous for the transgene and has been called "pairing-sensitive silencing." The pairing-sensitive silencing activities of a large fragment (2.6 kb) and a small subfragment (181 bp) were explored. Since pairing-sensitive silencing is often associated with Polycomb group response elements (PREs), we tested the activities of each of these engrailed fragments in a construct designed to detect PRE activity in embryos. Both fragments were found to behave as PREs in a bxd-Ubx-lacZ reporter construct, while the larger fragment showed additional silencing capabilities. Using the mini-white reporter gene, a 139-bp minimal pairing-sensitive element (PSE) was defined. DNA mobility-shift assays using Drosophila nuclear extracts suggested that there are eight protein-binding sites within this 139-bp element. Mutational analysis showed that at least five of these sites are important for pairing-sensitive silencing. One of the required sites is for the Polycomb group protein Pleiohomeotic and another is GAGAG, a sequence bound by the proteins GAGA factor and Pipsqueak. The identity of the other proteins is unknown. These data suggest a surprising degree of complexity in the DNA-binding proteins required for PSE function.     

Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.

The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 formed base triplets, and nucleotides G7*C13formed a Watson-Crick base pair. The oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT), designated '1G', also formed a triplex in which nucleotides C24*G3*C24 formed a triplet. Reaction of the two oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide revealed that only the 3G sequence formed an adduct, as determined by UV absorbance and piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis. This site was identified as G7by comparison to the guanine-specific cleavage pattern. The chemistry was extended to a series of nicked bimolecular triple helices, constructed from d(AAAGGGGGAA) and d(CnTTCTTTTTCCCCCTTTATTTTTTC5-n) (n = 1-5). Each oligomer in the series differed only in the placement of the nick. Reaction of the nicked triplexes with AFB1- exo -8,9-epoxide, piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis, revealed cleavage corresponding to the guanine closest to the pyrimidine strand nick. By using the appropriate pyrimidine sequence the lesion was positioned within the purine strand.     

Allosteric effect of fructose 1,6-bisphosphate on the conformation of NAD+ as bound to L-lactate dehydrogenase from Thermus caldophilus GK24

The allosteric effect of fructose 1,6-bisphosphate (Fru-1,6-P2) on L-lactate dehydrogenase (L-lactate:NAD+ oxidoreductase, EC 1.1.1.27) from Thermus caldophilus GK24 was studied by means of 1H NMR analyses. The conformation of NAD+ as bound to the T. caldophilus enzyme was elucidated by analyses of the transferred nuclear Overhauser effects (TRNOE), in the presence and the absence of the allosteric effector, Fru-1,6-P2. Upon binding of Fru-1,6-P2 to the enzyme, the ribose ring of the adenosine moiety of NAD+ is converted from the C2'-endo form to the C3'-endo form. This C3'-endo form of the adenosine moiety is similar to that of NAD+ as bound to nonallosteric vertebrate enzymes. However, the anti conformation of the adenine-ribose bond of NAD+ as bound to the T. caldophilus enzyme is not affected by the binding of Fru-1,6-P2. In contrast, the syn conformation of the nicotinamide-ribose bond is converted to the anti form on the binding of Fru-1,6-P2, while the ribose ring remains in the C3'-endo form as found in the case of a nonallosteric enzyme. Such a conformational change of enzyme-bound NAD+ as found on TRNOE analysis is essentially involved in the allosteric regulation of the T. caldophilus enzyme by Fru-1,6-P2.     

Parallel double stranded helices and the tertiary structure of nucleic acids

Thermal denaturation of four oligonucleotides, viz. 3'-d(AT)5pO(CH2)6Opd(AT)5-3'(par(AT], 3'-d(AT)5pO(CH2)6Opd(AT)5-5'(anti(AT],3'-d(A)10pO(CH2) 6Op(T)10-3'(par(A-T], and 3'-d(A)10pO(CH2)6Opd(T)10-5' (anti(A-T], was studied in 0.01 M phosphate buffer, pH 7, in the presence of 0.1, 0.25, 0.5 and 1.0 M NaCl. All the oligomers were found to exist at a lower temperature (0 to 20 degrees C) as complexes composed either of two oligomer molecules (a canonical duplex) or of more oligomer molecules whereas, at a higher temperature (30 to 70 degrees C), they formed hairpins with a parallel (par(AT) and par(A-T] or antiparallel (anti(AT) and anti(A-T) orientation of the chains. Melting curves (A260(T] were used to calculate thermodynamic parameters for the formation of hairpins and "low-temperature" duplexes. Experiments on ethidium bromide binding to the oligonucleotides have shown that the oligomer anti(A-T) exists, at a low ionic strength, as a four stranded complex ("quadruplex") contains two antiparallel helices, d(A).d(T), which have a parallel orientation and are bound to one another owing to the formation of additional hydrogen bonds between nucleic acid bases. The possible biological function of quadruplexes is discussed.     

Intermediates of stigmasterol metabolism in Spodoptera littoralis

Stigmasterol-24,28-epoxide, 22E-stigmasta-5,22,24(28E)-trien-3 beta-ol, and 22E-cholesta-5,22,24-trien-3 beta-ol were identified as normal metabolites of [3H]stigmasterol in Spodoptera littoralis larvae. Relative concentrations of all three of these metabolites increased when a diazasterol inhibitor was fed in combination with stigmasterol in the artificial diet. Identification of these sterols as intermediates in the conversion of stigmasterol to cholesterol in this insect indicates that intermediates analogous to fucosterol and fucosterol-24,28-epoxide in the conversion of sitosterol to cholesterol are produced in the metabolism of stigmasterol. This is the first published identification of stigmasterol-24,28-epoxide and 22E-stigmasta-5,22,24(28E)-trien-3 beta-ol as intermediates in this pathway in an insect.     

Structure and conformation of 1-beta-D-ribo furanosyl pyridin-2-one-5-carboxamide: an anti-inflammatory agent

The pyrimidine nucleoside, 1-beta-D-ribofuranosyl pyridine-2-one-5-carboxamide, is an anti inflammatory agent used in the treatment of adjuvant-induced arthritis. It is the 2-one isomer of 1-beta-D-ribofuranosyl pyridine-4-one 5-carboxamide, an unusual nucleoside isolated from the urine of patients with chronic myelogenic leukemia and an important cancer marker. Crystals of 1-beta-D-ribofuranosyl pyridine-2-one-5-carboxamide are monoclinic, space group C2, with the cell dimensions a = 31.7920(13), b = 4.6872 (3), c = 16.1838(11), beta = 93.071(3) degrees , V = 2408.2(2) A(3), D(calc) = 1.496 mg/m(3) and Z = 8 (two molecules in the asymmetric unit). The structure was obtained by the application of direct methods to diffractometric data and refined to a final R value of 0.050 for 1669 reflections with I >or= 3sigma. The nucleoside exhibits an anti conformation across the glycosidic bond (chi(CN) = -15.5 degrees , -18.9 degrees ), a C3 '-endo C2 '-exo [(3)(2)T] ribose pucker and g(+) across the C(4 ')-C(5 ') exocyclic bond. The amino group of the carboxamide group is distal from the 2-one and lacks the intramolecular hydrogen bonding found in the related 2-one molecule. Nuclear magnetic resonance studies shows also an anti conformation across the glycosidic bond but the solution conformation of the furanose ring is not the same as that found in the solid state.     

Xanthobacter sp. C20 contains a novel bioconversion pathway for limonene

Xanthobacter sp. C20 was isolated from sediment of the river Rhine using cyclohexane as sole source of carbon and energy. Xanthobacter sp. C20 converted both enantiomers of limonene quantitatively into limonene-8,9-epoxide, a not previously described bioconversion product of limonene. With (4R)-limonene, (4R,8R)-limonene-8, 9-epoxide was formed as the only reaction product, while (4S)-limonene was converted into a (78:22) mixture of (4S,8R)- and (4S,8S)-limonene-8,9-epoxide. Cytochrome P-450 was shown to be induced concomitantly with limonene bioconversion activity following growth of Xanthobacter sp. C20 on cyclohexane. Maximal limonene bioconversion rate was observed at an initial substrate concentration of 12 mM. The amount of limonene-8,9-epoxide formed, up to 0.8 g l(-1), was limited by a strong product inhibition.     

Interaction of La (III) and Tb (III) ions with purine nucleotides: evidence for metal chelation (N-7-M-PO3) and the effect of macrochelate formation on the nucleotide sugar conformation.

The interaction of the La (III) and Tb (III) ions with adenosine-5'-monophosphate (5'-AMP), guanosine-5'-monophosphate (5'-GMP), and 2'-deoxyguanosine-5'-monophosphate (5'-dGMP) anions with metal/nucleotide ratios of 1 and 2 has been studied in aqueous solution in acidic and neutral pHs. The solid complexes were isolated and characterized by Fourier transform ir and 1H-nmr spectroscopy. The lanthanide (III)-nucleotide complexes are polymeric in nature both in the solid and aqueous solutions. In the metal-nucleotide complexes isolated from acidic solution, the nucleotide binding is via the phosphate group (inner sphere) and an indirect metal-N-7 interaction (outer-sphere) with the adenine N-1 site protonated. In the complexes obtained from neutral solution, metal chelation through the N-7 and the PO3(2-) group is prevailing. In aqueous solution, an equilibrium between the inner and outer sphere metal-nucleotide interaction has been observed. The ribose moiety shows C2'-endo/anti pucker in the free AMP anion and in the lanthanide (III)-AMP complexes, whereas the GMP anion with C2'-endo/anti sugar conformation exhibits a mixture of the C2'-endo/anti and C3'-endo/anti sugar puckers in the lanthanide (III)-GMP salts. The deoxyribose has O4'-endo/anti sugar pucker in the free dGMP anion and a C3'-endo/anti, in the lanthanide (III)-dGMP complexes.     

Mobility of the spin-labeled side chains of some novel antifolate inhibitors in their complexes with dihydrofolate reductase

Four spin-labeled inhibitors of dihydrofolate reductase (DHFR) have been synthesized, each of which has the 2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO) reporting group at a different distance from the 2,4-diaminopyrimidine moiety by which the inhibitors are anchored and oriented in the active site. Inhibitors in which the TEMPO group is attached by a short side chain are weakly bound to DHFR from bacteria (Streptococcus faecium and Lactobacillus casei), to the bovine enzyme and to recombinant human DHFR. However, binding is sufficiently tight, especially in the ternary complexes with NADPH, for recording of the EPR spectra of the bound ligands. The spectra indicate that when these inhibitors are bound to the enzyme the TEMPO group is highly immobilized with correlation time, tau c, 4-20ns. Inhibitors that have the reporter group attached to the glutamate moiety of methotrexate bind to all four DHFRs more tightly than the inhibitors with shorter side chains by factors of up to 10(6). However, in most complexes formed by the inhibitors with longer side chains immobilization of the TEMPO group is slight (tau c 0.2-4 ns). These results are in general agreement with predictions from X-ray crystallographic results including thermal factors but there are some unanticipated differences between some results for bacterial and eukaryotic enzymes. Three of the splin-labeled inhibitors would provide good probes for distance measurements in and around the active site of mammalian DHFR.     

The binding of a carcinogen to the nucleosomal and non-nucleosomal regions of the simian virus 40 chromosome in vivo

The effect of chromatin structure on the binding of a chemical carcinogen to the genomic DNA was studied. The binding in vivo of the ultimate carcinogen, benzo-pyrene 7,8,-diol,-9,10-epoxide, to various regions of the SV40 chromosome was revealed by an immunological method. Particular attention was given to restriction fragments which include the origin of replication which is "non-nucleosomal" in a significant fraction of the chromosomes. The distribution of (+/-) trans-7,8-dihydrobenzo[alpha]pyrene-7,8-diol-9,10-epoxide (BPDE) adducts was studied in 1) SV40 DNA modified in vitro to a level of 20 adducts/molecule, 2) DNA from SV40 chromosomes modified in vivo to a level of less than 1 adduct, and 3) DNA from only those chromosomes with an open origin of replication. In other experiments, the binding of BPDE to the origin region was compared to the binding to nucleosome core particle DNA from the viral chromosome. The origin region bound 1.7-fold more BPDE than core DNA, while linker DNA is 3-fold more modified than core DNA. However, the origin region was only about 20% more modified than any other region of the chromosome. We conclude that while the conformation of the DNA in chromatin has a slight effect on its accessibility to the carcinogen, the SV40 chromosome does not contain a particular "hot spot" which is preferentially modified by BPDE.