首页 | 本学科首页   官方微博 | 高级检索  
相似文献
 共查询到20条相似文献,搜索用时 15 毫秒
1.
2.
3.
We performed a numerical taxonomy analysis of 38 Mycobacterium paratuberculosis and related mycobacterial strains, including wood pigeon mycobacteria; this analysis was based on 22 tests, which were selected for their potential discriminative value from a total of 51 tests studied and produced four well-defined clusters. Cluster 1 contained the M. paratuberculosis strains, including two strains isolated from Crohn's disease patients; cluster 2 contained Mycobacterium avium and Mycobacterium intracellulare reference strains; cluster 3 consisted of the wood pigeon mycobacteria; and the only strain in cluster 4 was M. paratuberculosis 316F, which is used for antigen and vaccine production. Strains in cluster 1 were mycobactin dependent even when they were subcultured, whereas strains in cluster 3 were unable to grow on egg medium and their growth was stimulated by pH 5.5. Growth stimulation by pyruvate, resistance to D-cycloserine (50 micrograms/ml), and alkaline phosphatase activity also were characteristics that were useful for discriminating between clusters 1 and 3. The results of previous DNA-DNA hybridization studies have demonstrated that M. avium Chester 1901, M. paratuberculosis Bergey et al. 1923, and the wood pigeon mycobacteria belong to a single genomic species, and we propose that the name of this species should be M. avium. On the basis of the results of previous genomic analyses based on restriction fragment length, the results of polymorphism studies, and DNA patterns determined by field inversion gel electrophoresis as well as the results of our phenotypic study, we propose that the species should be divided into subspecies which correspond to pathogenicity and host range characteristics.(ABSTRACT TRUNCATED AT 250 WORDS)  相似文献   

4.
Here, we present for the first time a high-affinity peptide nucleic acid (PNA) oligonucleotide sequence for detecting Mycobacterium avium bacteria, including the opportunistically pathogenic subspecies M. avium subsp. avium, M. avium subsp. paratuberculosis, and M. avium subsp. silvaticum, by the fluorescence in situ hybridization (FISH) method. There is evidence that M. avium subsp. avium especially is able to survive and grow in drinking-water biofilms and possibly transmit via drinking water. The designed PNA probe (MAV148) specificity was tested with several bacterial species, including other mycobacteria and mycolic acid-containing bacteria. From the range of bacterial strains tested, only M. avium subsp. avium and M. avium subsp. paratuberculosis strains were hybridized. The PNA FISH method was applied successfully to detect M. avium subsp. avium spiked in water samples and biofilm established within a Propella biofilm reactor fed with potable water from a distribution supply.  相似文献   

5.
Microarray-based comparisons of three Mycobacterium avium subsp. paratuberculosis isolates, including one sheep strain and two cattle strains, identified three large genomic deletions in the sheep strain, totaling 29,208 bp and involving 24 open reading frames. These deletions may help explain some of the differences in pathogenicity and host specificity observed between the cattle and sheep strains of Mycobacterium avium subsp. paratuberculosis.  相似文献   

6.
The effectiveness of pasteurization and the concentration of Mycobacterium avium subsp. paratuberculosis in raw milk have been identified in quantitative risk analysis as the most critical factors influencing the potential presence of viable Mycobacterium paratuberculosis in dairy products. A quantitative assessment of the lethality of pasteurization was undertaken using an industrial pasteurizer designed for research purposes with a validated Reynolds number of 62,112 and flow rates of 3,000 liters/h. M. paratuberculosis was artificially added to raw whole milk, which was then homogenized, pasteurized, and cultured, using a sensitive technique capable of detecting one organism per 10 ml of milk. Twenty batches of milk containing 103 to 104 organisms/ml were processed with combinations of three temperatures of 72, 75, and 78°C and three time intervals of 15, 20, and 25 s. Thirty 50-ml milk samples from each processed batch were cultured, and the logarithmic reduction in M. paratuberculosis organisms was determined. In 17 of the 20 runs, no viable M. paratuberculosis organisms were detected, which represented >6-log10 reductions during pasteurization. These experiments were conducted with very heavily artificially contaminated milk to facilitate the measurement of the logarithmic reduction. In three of the 20 runs of milk, pasteurized at 72°C for 15 s, 75°C for 25 s, and 78°C for 15 s, a few viable organisms (0.002 to 0.004 CFU/ml) were detected. Pasteurization at all temperatures and holding times was found to be very effective in killing M. paratuberculosis, resulting in a reduction of >6 log10 in 85% of runs and >4 log10 in 14% of runs.  相似文献   

7.
The effectiveness of pasteurization and the concentration of Mycobacterium avium subsp. paratuberculosis in raw milk have been identified in quantitative risk analysis as the most critical factors influencing the potential presence of viable Mycobacterium paratuberculosis in dairy products. A quantitative assessment of the lethality of pasteurization was undertaken using an industrial pasteurizer designed for research purposes with a validated Reynolds number of 62,112 and flow rates of 3,000 liters/h. M. paratuberculosis was artificially added to raw whole milk, which was then homogenized, pasteurized, and cultured, using a sensitive technique capable of detecting one organism per 10 ml of milk. Twenty batches of milk containing 10(3) to 10(4) organisms/ml were processed with combinations of three temperatures of 72, 75, and 78 degrees C and three time intervals of 15, 20, and 25 s. Thirty 50-ml milk samples from each processed batch were cultured, and the logarithmic reduction in M. paratuberculosis organisms was determined. In 17 of the 20 runs, no viable M. paratuberculosis organisms were detected, which represented > 6-log10 reductions during pasteurization. These experiments were conducted with very heavily artificially contaminated milk to facilitate the measurement of the logarithmic reduction. In three of the 20 runs of milk, pasteurized at 72 degrees C for 15 s, 75 degrees C for 25 s, and 78 degrees C for 15 s, a few viable organisms (0.002 to 0.004 CFU/ml) were detected. Pasteurization at all temperatures and holding times was found to be very effective in killing M. paratuberculosis, resulting in a reduction of > 6 log10 in 85% of runs and > 4 log10 in 14% of runs.  相似文献   

8.
The presence of Mycobacterium avium subsp. paratuberculosis (MAP) in non-ruminant wildlife has raised questions regarding the role of these species in Johne's disease transmission. In this study we tested 472 tissues from 212 animals of six different species of scavenging mammals. All animals were taken from within a 210-square-mile area in Dane and Iowa counties of south central Wisconsin from September to May in 2003-04 and tested for the presence of MAP. We detected MAP-specific DNA in 81 of 212 (38%) scavenging mammals, in 98 of the 472 (21%) tissues; viable MAP was cultured from one coyote's ileum and lymph node tissue. Despite the low numbers of viable MAP isolated in this study, our data adds to the increasing evidence demonstrating the potential for transmission and infection of MAP in nonruminant species and provides possible evidence of interspecies transmission. The apparently high exposure of nonruminant wildlife provides potential evidence of a spill-over of MAP to wildlife species and raises the question of spillback to domestic and wild ruminants. These results demonstrate the importance of understanding the role of wildlife species in developing management strategies for Johne's disease in domestic livestock.  相似文献   

9.

Background  

Interactions between Mycobacterium avium subsp. paratuberculosis (Map) and free-living protozoa in water are likely to occur in nature. The potential impact of ingestion of Map by two naturally occurring Acanthamoeba spp. on this pathogen's survival and chlorine resistance was investigated.  相似文献   

10.
It has been suggested that Mycobacterium avium subspecies paratuberculosis has a role in Crohn''s disease. The organism may be acquired but is difficult to culture from the environment. We describe a quantitative PCR (qPCR) method to detect M. avium subsp. paratuberculosis in drinking water and the results of its application to drinking water and faucet biofilm samples collected in the United States.Mycobacterium avium subspecies paratuberculosis is a member of the Mycobacterium avium complex. M. avium subsp. paratuberculosis causes Johne''s disease in bovine and ovine animals and has been hypothetically linked to Crohn''s disease in humans. Several review articles have been written describing the association between M. avium subsp. paratuberculosis and Crohn''s disease (1, 2, 10, 11, 16, 23). Most mycobacterial infections are acquired from the environment; however, M. avium subsp. paratuberculosis can elude laboratory culture from environmental samples (28). M. avium subsp. paratuberculosis has been cultured only once from drinking water in the United States; therefore, its occurrence in drinking water is unknown (17). There are several reasons one could expect to find M. avium subsp. paratuberculosis in drinking water. The bacterium has been isolated from surface water used as a source of drinking water (19, 20, 24, 26). It is resistant to chlorine disinfection (25). Also, other subspecies of M. avium have been detected in biofilms obtained from drinking water pipes in the United States (8, 22, 27).Due to the potential for waterborne transmission of mycobacteria and the association of M. avium subsp. paratuberculosis with human illness, the focus of this study was to estimate the organism''s occurrence in drinking water in the United States using quantitative PCR (qPCR) (15). A comprehensive method was developed for detection of M. avium subsp. paratuberculosis in drinking water and biofilms that includes the concentration of microorganisms from samples using membrane filtration, total DNA extraction and purification, and detection of two targets unique to this bacterium: IS900 and target 251. IS900 is a common target used to identify M. avium subsp. paratuberculosis, and the average number of copies per genome is 14 to 18 (13). Target 251 qPCR analysis, which corresponds to the M. avium subsp. paratuberculosis gene 2765c (David Alexander, personal communication), was developed by Rajeev et al. (21). Samples positive for both targets are considered positive for M. avium subsp. paratuberculosis. TaqMan primer and probe sequences and qPCR assay characteristics are described in Table Table1.1. The complete method is described in Fig. S1 in the supplemental material.

TABLE 1.

qPCR assay primers, probes, DNA targets, and assay characteristicsa
DNA targetPrimer or probe (sequence, 5′→3′)Product (bp)
Reference
LODbLOQc
IS900IS900F (CCGCTAATTGAGAGATGCGATTGG)2301.81.813
IS900R (ATTCAACTCCAGCAGCGCGGCCTC)
IS900P (6-FAM-TCCACGCCCGCCCAGACAGG-TAMRA)
Target 251251F (GCAAGACGTTCATGGGAACT)200NDND21
251R (GCGTAACTCAGCGAACAACA)
251P (6-FAM-CTGACTTCACGATGCGGTTCTTC-TAMRA)
Open in a separate windowaFAM, 6-carboxyfluorescein; TAMRA, 6-carboxytetramethylrhodamine; ND, not determined.bThe limit of detection (LOD) of the IS900 qPCR assay was defined as the lowest copy number resulting in a CT of <40, determined from six independent dilution series.cThe limit of quantification (LOQ) was defined as the lowest copy number per assay yielding a coefficient of variation (CV) of less than 25% (33).A master standard curve was generated from six series of 10-fold dilutions of genomic DNA from M. avium subsp. paratuberculosis strain 49164 for quantification of IS900 target copies (see Fig. S2A in the supplemental material). Each dilution series contained eight standards run in triplicate for a total of 18 threshold cycle (CT) measurements per standard. A linear regression was performed on CT versus log IS900 copy number and R2 was 0.997. The standard error of y was used to create two equations to estimate the upper and lower concentration, or range, of M. avium subsp. paratuberculosis IS900 copy number.The specificities of the IS900 and target 251 primer/probe sets were evaluated by Rajeev et al. (21) on 211 M. avium subsp. paratuberculosis and 38 non-M. avium subsp. paratuberculosis isolates, and each assay was 100% specific for M. avium subsp. paratuberculosis. We further evaluated specificity using 22 M. avium subsp. paratuberculosis isolates from animals and 10 non-M. avium subsp. paratuberculosis ATCC reference strains (see Table S1 in the supplemental material) (18). Target 251 was 100% specific; however, one M. avium subsp. paratuberculosis isolate (3063) repeatedly produced a negative result by IS900 qPCR. Results suggest that a small subset of M. avium subsp. paratuberculosis isolates may not contain the IS900 element or may have a sequence that differs from that of the IS900 primer/probe set.The sensitivity of the method for detection of M. avium subsp. paratuberculosis in different drinking water matrices was evaluated by spiking serial dilutions of strain 1112 cells, ranging from 104 cells to no addition of cells, into 1-liter tap water samples obtained from five locations in the United States. The number of M. avium subsp. paratuberculosis cell equivalents was estimated by dividing the IS900 copy number obtained from the master standard curve by 18 (mean, 18 IS900 copies/M. avium subsp. paratuberculosis genome). The method provided consistent detection (5/5 samples) in a spiked sample of 100 cells/liter. In a spiked sample of 10 cells/liter, the IS900 target was detected 40% (2/5 samples) of the time, and at 1 cell/liter we did not detect the target in any spiked sample. Percent recovery was variable and decreased as the number of spiked cells decreased (Fig. (Fig.1).1). At a spike level of 1 × 104 cells/liter, the average percent recovery was 64%; this decreased to 9.2% at 1 × 102 cells/liter. Cell surface hydrophobicity, a property of mycobacteria, may have influenced clumping of the spiked sample or partitioning of M. avium subsp. paratuberculosis onto the sample bottle or filtration unit, affecting recovery of the bacterium (3).Open in a separate windowFIG. 1.Average percent recovery of M. avium subsp. paratuberculosis spiked into drinking water collected from five sites in the United States. Error bars denote standard deviation. MAP, M. avium subsp. paratuberculosis.  相似文献   

11.
Attachment of Mycobacterium avium subsp. paratuberculosis to soil particles could increase their availability to farm animals, as well as influence the transportation of M. avium subsp. paratuberculosis to water sources. To investigate the possibility of such attachment, we passed a known quantity of M. avium subsp. paratuberculosis through chromatography columns packed with clay soil, sandy soil, pure silica, clay-silica mixture, or clay-silica complexes and measured the organisms recovered in the eluent using culture or quantitative PCR. Experiments were repeated using buffer at a range of pH levels with pure silica to investigate the effect of pH on M. avium subsp. paratuberculosis attachment. Linear mixed-model analyses were conducted to compare the proportional recovery of M. avium subsp. paratuberculosis in the eluent between different substrates and pH levels. Of the organisms added to the columns, 83 to 100% were estimated to be retained in the columns after adjustment for those retained in empty control columns. The proportions recovered were significantly different across different substrates, with the retention being significantly greater (P < 0.05) in pure substrates (silica and clay-silica complexes) than in soil substrates (clay soil and sandy soil). However, there were no significant differences in the retention of M. avium subsp. paratuberculosis between silica and clay-silica complexes or between clay soil and sandy soil. The proportion retained decreased with increasing pH in one of the experiments, indicating greater adsorption of M. avium subsp. paratuberculosis to soil particles at an acidic pH (P < 0.05). The results suggest that under experimental conditions M. avium subsp. paratuberculosis adsorbs to a range of soil particles, and this attachment is influenced by soil pH.Mycobacterium avium subsp. paratuberculosis is a pathogen of great significance for livestock since it causes a fatal and economically important disease called paratuberculosis or Johne''s disease (JD). The significance of M. avium subsp. paratuberculosis has further increased due to speculation over its role in the causation of Crohn''s disease in humans (10). Although reports trying to establish a causative association between M. avium subsp. paratuberculosis and Crohn''s disease are conflicting and inconclusive, they have aroused concerns among public health authorities (13); therefore, greater attention is now being paid to understand the natural ecology of M. avium subsp. paratuberculosis (32, 34). We investigated a largely unexplored aspect of the natural ecology of M. avium subsp. paratuberculosis: its attachment to soil particles, which could influence its availability to farm animals and humans (see below).Bacteria can become loosely associated with clay or soil particles through reversible adsorption mediated by electrostatic and van der Waals'' forces or by cell surface hydrophobicity (20). An irreversible firm attachment may later occur usually mediated by extracellular bridging polymers (8). The attachment of microbiota such as Escherichia coli, Arthrobacter spp., and poliovirus to soil or clay particles has been reported previously (2, 3, 11, 22, 26), but there is only indirect evidence of the association of mycobacteria with soil particles. A study reported the recovery of only 3.5% of nontuberculous mycobacteria inoculated into soil samples and attributed this to their adsorption to clay particles (5). Later, a similar phenomenon was inferred for M. avium subsp. paratuberculosis because 99% of these organisms in feces could not be detected upon culture of feces mixed with soil, suggesting the binding of M. avium subsp. paratuberculosis to soil particles (33). An association between M. avium subsp. paratuberculosis and clay particles was also suggested by an epidemiological study conducted to investigate the risk factors for ovine JD, indicating the possibility of bacterial attachment to clay particles (6).M. avium subsp. paratuberculosis is transmitted primarily by the feco-oral route. Infected animals shed huge numbers of M. avium subsp. paratuberculosis in their feces (29, 35), thus contaminating soil and the farm environment. The ability of M. avium subsp. paratuberculosis to survive for extended periods in an external environment, in spite of it being an obligate parasite (32, 34), facilitates the build-up of soil and pasture contamination levels over time. The attachment of M. avium subsp. paratuberculosis to soil particles could help retain the bacteria in the upper layers of the soil, thus further enhancing contamination levels. The contaminated farm environment thus becomes a potential source of infection for farm animals because grazing ruminants normally consume soil with pasture, and the amounts can be substantial, up to 300 or more grams per day for sheep (9, 21).In addition, runoff from contaminated farm soils can contaminate water bodies (23), which can be a potential health hazard for humans because the routine chlorine disinfection of water is not able to eliminate M. avium subsp. paratuberculosis completely (28). The transportation of bacteria from the farm environment to water sources is influenced by their attachment to soil or clay particles (11, 12). Generally, bacterial adsorption to soil particles decreases the rate of transportation through soil (3), but it also helps retain bacteria in the top surface layers of the soil, thus increasing the possibility of the contamination of runoff water (24). Note that soil particles can be dislodged and moved by wind, water, and mechanical factors.The aim of the present study was to verify whether M. avium subsp. paratuberculosis attaches to clay and other soil particles and whether this attachment is influenced by soil pH. The study findings improve our knowledge and understanding of the natural ecology of M. avium subsp. paratuberculosis.  相似文献   

12.
In a previous longitudinal study, Mycobacterium avium subsp. paratuberculosis survived for 55 weeks in fecal material in the shade, but for much shorter periods in exposed locations. In this experiment, the survival of the organism was studied in 250 liters of dam water and sediment in large water troughs that were placed in either a semiexposed location or in a shaded location and compared to survival in fecal material and soil in the shaded location. Survival in water and/or sediment in the shade was for up to 48 weeks compared to 36 weeks in the semiexposed location. Survival in sediment was 12 to 26 weeks longer than survival in the water column. Survival in soil and fecal material in the terrestrial environment in the shaded location was only 12 weeks. Although disturbance to sediment could not be ruled out as a factor, there was evidence of dormancy in both the water column and the sediment, since the organism could not be recovered for several months before again becoming detectable. The results suggest that water may be a significant reservoir of M. avium subsp. paratuberculosis infection. Further research on the biology of the organism in aquatic environments is warranted. Animal health authorities will need to provide appropriate advice to farmers to minimize exposure of livestock to potentially infected water sources. Survival of the organism in water destined for human consumption will need to be addressed if the organism is found to be involved in the etiology of Crohn's disease.  相似文献   

13.
14.
In a previous longitudinal study, Mycobacterium avium subsp. paratuberculosis survived for 55 weeks in fecal material in the shade, but for much shorter periods in exposed locations. In this experiment, the survival of the organism was studied in 250 liters of dam water and sediment in large water troughs that were placed in either a semiexposed location or in a shaded location and compared to survival in fecal material and soil in the shaded location. Survival in water and/or sediment in the shade was for up to 48 weeks compared to 36 weeks in the semiexposed location. Survival in sediment was 12 to 26 weeks longer than survival in the water column. Survival in soil and fecal material in the terrestrial environment in the shaded location was only 12 weeks. Although disturbance to sediment could not be ruled out as a factor, there was evidence of dormancy in both the water column and the sediment, since the organism could not be recovered for several months before again becoming detectable. The results suggest that water may be a significant reservoir of M. avium subsp. paratuberculosis infection. Further research on the biology of the organism in aquatic environments is warranted. Animal health authorities will need to provide appropriate advice to farmers to minimize exposure of livestock to potentially infected water sources. Survival of the organism in water destined for human consumption will need to be addressed if the organism is found to be involved in the etiology of Crohn's disease.  相似文献   

15.
We investigated the presence of Mycobacterium avium subsp. paratuberculosis in retail cheeses from Greece and the Czech Republic. We found that 31.7% and 3.6% of our samples reacted positive by PCR and culture, respectively. Consumption of these cheeses is likely to result in human exposure to M. avium subsp. paratuberculosis, albeit at a low level for viable cells.  相似文献   

16.
We investigated the presence of Mycobacterium avium subsp. paratuberculosis in retail cheeses from Greece and the Czech Republic. We found that 31.7% and 3.6% of our samples reacted positive by PCR and culture, respectively. Consumption of these cheeses is likely to result in human exposure to M. avium subsp. paratuberculosis, albeit at a low level for viable cells.  相似文献   

17.
18.
19.
The incidence of mycobacterial infections was monitored in brown bears (Ursus arctos) in the National Park Low Tatras in the central European Carpathians in Slovakia. Tissue samples of 20 brown bears were examined microscopically and by culture for the presence of mycobacteria. Acid-fast rods were detected by Ziehl-Neelsen staining in a smear from the kidney of one brown bear, although the culture was negative for mycobacteria. Mycobacterium avium subsp. paratuberculosis, the causative agent of paratuberculosis in ruminants, was isolated from the intestinal mucosa of another two brown bears. The isolates were identified by polymerase chain reaction for the specific insertion sequence IS900. Using standardized IS900 restriction fragment length polymorphism (RFLP) analysis, the M. a. paratuberculosis isolates were classified as RFLP type B-C1, which also were detected in the infected cattle in surrounding area. This study describes the first isolation of M. a. paratuberculosis from a brown bear. Our results confirm that animal species other than ruminants can become infected with M. a. paratuberculosis and can act as potential vectors and/or reservoirs of the infection.  相似文献   

20.
We compared the kinetics of activation and antimicrobial activities of MAPK-p38 and MAPK-ERK in bovine monocytes infected with Mycobacterium avium subsp. paratuberculosis (MAP) and Mycobacterium avium subsp. avium (Maa). Monocytes were incubated with MAP or Maa organisms with or without a specific inhibitor of the MAPK-p38 pathway (SB203580), and MAPK phosphorylation and antimicrobial functions of monocytes were evaluated. At early time points MAPK-p38 phosphorylation was greater in MAP-infected bovine monocytes than in Maa-infected monocytes. At later time points MAPK-p38 phosphorylation by both organisms was similar. MAPKp38 phosphorylation in MAP-infected monocytes was similar to negative control cells, whereas in Maa-infected this activation remained greater than negative control cells. Increase phosphorylation MAPK-ERK was similar at all time points for both organisms. Bovine monocytes had minimal capacity to kill MAP organisms, to acidify MAP-containing phagosomes, or to form phagolysosome. Alternatively, bovine monocytes were able to kill Maa organisms. Addition of SB203580 to monocyte cultures increased phagosome acidification, phagolysosome formation, and killing of MAP and Maa organisms. Taken together these data indicate that early transient activation of MAPK-p38 in bovine mononuclear phagocytes by MAP organisms may be a key mechanism involved in the capacity of MAP to survive in bovine monocytes.  相似文献   

设为首页 | 免责声明 | 关于勤云 | 加入收藏

Copyright©北京勤云科技发展有限公司  京ICP备09084417号