Purification and isolation of the arom aggregates of Schizosaccharomyces pombe

The five enzymes that catalyzing steps two through six in the prechorismate polyaromatic amino acid biosynthetic pathway are physically associated and have been purified up to 400-fold from Schizosaccharomyces pombe. The native arom aggregate has a molecular weight of approx. 140,000-145,000 based on gel filtration, glycerol-density-gradient centrifugation, and polyacrylamide-gel electrophoresis in the presence of sodium dodecyl sulphate. Similarities between the S. pombe arom aggregate and that of Neurospora crassa and Euglena gracilis are discussed.     

Evolution of the Chloroplast Genome in Photosynthetic Euglenoids: A Comparison of Eutreptia viridis and Euglena gracilis (Euglenophyta)

The chloroplast genome of Eutreptia viridis Perty, a basal taxon in the photosynthetic euglenoid lineage, was sequenced and compared with that of Euglena gracilis Ehrenberg, a crown species. Several common gene clusters were identified and gene order, conservation, and sequence similarity was assessed through comparisons with Euglena gracilis. Significant gene rearrangements were present between Eutreptia viridis and Euglena gracilis chloroplast genomes. In addition, major expansion has occurred in the Euglena gracilis chloroplast accounting for its larger size. However, the key chloroplast genes are present and differ only in the absence of psaM and roaA in Eutreptia viridis, and psaI in Euglena gracilis, suggesting a high level of gene conservation within the euglenoid lineage. Further comparisons with the plastid genomes of closely related green algal taxa have provided additional support for the hypothesis that a Pyramimonas-like alga was the euglenoid chloroplast donor via secondary endosymbiosis.     

An Ultrastructural Comparison of Euglena gracilis Klebs, Bleached Euglena and Astasia longa Pringsheim

SYNOPSIS. Some of the cytologic features of Euglena gracilis Klebs, Euglena gracilis var. bacillaris Gross (colorless), and Astasia longa Pringsheim were compared in an electron-microscope study. E. gracilis was readily differentiated from the colorless forms by the presence of chloroplasts. The 2 colorless forms were structurally similar; however, it was possible to differentiate bleached Euglena from Astasia longa by the presence of irregular plate-like aggregates of paramylum in the former; similar forms of paramylum were not seen in chloroplast-containing E. gracilis or in A. longa .     

The nucleotide sequence of Euglena cytoplasmic phenylalanine transfer RNA. Evidence for possible classifications of Euglena among the animal rather than the plant kingdom

The nucleotide sequence of cytoplasmic phenylalanine tRNA from Euglena gracilis has been elucidated using procedures described previously for the corresponding chloroplastic tRNA [Cell, 9, 717 (1976)]. The sequence is: pG-C-C-G-A-C-U-U-A-m(2)G-C-U-Cm-A-G-D-D-G-G-G-A-G-A-G-C-m(2)2G-psi-psi-A-G-A-Cm -U-Gm-A-A-Y-A-psi-C-U-A-A-A-G-m(7)G-U-C-*C-C-U-G-G-T-psi-C-G-m(1)A-U-C-C-C-G-G- G-A-G-psi-C-G-G-C-A-C-C-A. Like other tRNA Phes thus far sequenced, this tRNA has a chain length of 76 nucleotides. The sequence of E. gracilis cytoplasmic tRNA Phe is quite different (27 nucleotides out of 76 different) from that of the corresponding chloroplastic tRNA but is surprisingly similar (72 out of 76 nucleotides identical) to that of tRNA Phe from mammalian cytoplasm. This extent of sequence homology even exceeds that found between E. gracilis and wheat germ cytoplasmic tRNA Phe. These findings raise interesting questions on the evolution of tRNAs and the taxonomy of Euglena.     

Evidence for the late origin of introns in chloroplast genes from an evolutionary analysis of the genus Euglena.

The origin of present day introns is a subject of spirited debate. Any intron evolution theory must account for not only nuclear spliceosomal introns but also their antecedents. The evolution of group II introns is fundamental to this debate, since group II introns are the proposed progenitors of nuclear spliceosomal introns and are found in ancient genes from modern organisms. We have studied the evolution of chloroplast introns and twintrons (introns within introns) in the genus Euglena. Our hypothesis is that Euglena chloroplast introns arose late in the evolution of this lineage and that twintrons were formed by the insertion of one or more introns into existing introns. In the present study we find that 22 out of 26 introns surveyed in six different photosynthesis-related genes from the plastid DNA of Euglena gracilis are not present in one or more basally branching Euglena spp. These results are supportive of a late origin for Euglena chloroplast group II introns. The psbT gene in Euglena viridis, a basally branching Euglena species, contains a single intron in the identical position to a psbT twintron from E.gracilis, a derived species. The E.viridis intron, when compared with 99 other Euglena group II introns, is most similar to the external intron of the E.gracilis psbT twintron. Based on these data, the addition of introns to the ancestral psbT intron in the common ancester of E.viridis and E.gracilis gave rise to the psbT twintron in E.gracilis.     

The Effect of 3-(3,4-Dichlorophenyl)-1,1-dimethylurea on Chloroplast Development and Maintenance in Euglena gracilis: I. Ultrastructural Characterization of Light-Grown Cells by the Techniques of Thin Sectioning and Freeze-Etching 1

The ultrastructure of light-grown Euglena gracilis var. bacillaris was examined by the techniques of thin sectioning and freeze-etching. Thin sectioning revealed the typical organelles previously observed in chemically fixed Euglena. In addition to confirming the observations on thin sections, the freeze-etch technique has revealed the presence in E. gracilis of a complex multilaminar pellicle, and an ordered arrangement to the paramylon granule. The chloroplast thylakoids are particulate and similar to those observed in higher plants.     

Synthetic deoxyoligonucleotides as general probes for chloroplast transfer RNA genes

The utility of chemically synthesized deoxyoligonucleotides as hybridization probes for the detection of tRNA genes has been examined. Chloroplast tRNA genes were chosen for this study. Deoxyoligonucleotides complementary to highly conserved regions of chloroplast tRNA genes of both higher plants and Euglena gracilis were chemically synthesized. These synthetic probes have been used to detect tRNA genes by Southern hybridizations to restriction fragments of chloroplast DNAs. This new method of tRNA gene mapping and the oligonucleotides synthesized may be of general application to many chloroplast genomes. This is illustrated by the detection of known and unknown tRNA genes of Euglena gracilis and spinach, and unknown tRNA genes of maize and cucumber chloroplast DNAs. The precise locus and polarity of the Euglena gracilis chloroplast tRNAPhe gene has been determined. We also describe experiments which relate to the effects of the time of hybridization, the stringency of washing, and of base pair mismatches on the hybridization signal.     

Restriction endonuclease map of Euglena gracilis chloroplast DNA.

A physical map of the Euglena gracilis chloroplast genome has been constructed, based on cleavage sites of Euglena gracilis chloroplast DNA treated with bacterial restriction endonucleases. Covalently close, circular chloroplast DNA is cleaved by restriction endonuclease SalI into three fragments and by restriction endonuclease BamHI into six fragments. These nine cleavage sites have been ordered by fragment molecular weight analysis, double digestions, partial digestions, and by digestion studies of isolated DNA fragments. A fragment pattern of the products of EcoRI restriction endonuclease digestion of Euglena chloroplast DNA is also described. One of these fragments has been located on the cleavage site map.     

On Hemoglobin Inhibition of the Growth of Euglena gracilis

SYNOPSIS. The inhibitory principle in whole blood for strains of Euglena gracilis has been characterized and identified as hemoglobin. Hemoglobins from different sources were tested for their inhibitory activity and gave similar results. The inhibition was reversed by raising the concentration of certain divalent metal ions, calcium in particular in the basal growth medium. The nature of the inhibition was studied. Heme and other porphyrins related to hemoglobin stimulated the growth of Euglena gracilis in light. Implications of these findings are discussed.     

Actin Gene Sequence from Euglena gracilis

ABSTRACT The full length coding sequence of the Euglena gracilis actin gene was determined by RT-PCR of Euglena gracilis mRNA. Conserved regions in the actin amino acid sequence were used as guides for the synthesis of degenerate primers. Sequence was obtained for 1.238 nucleotides, of which 1.131 were coding for 377 amino acids. Sequence comparisons showed a similarity with other actins of 56% to 80%. Even though most of the actin amino acid sequence was conserved, some regions showed high divergence, i.e. the DNase I-binding loop at the N-terminal region. The construction of a phylogenetic tree based on actin sequences from different organisms placed Euglena gracilis in a cluster with Trypanosoma brucei and Leishmania major.     

The fractionation of histones isolated from Euglena gracilis.

1. The histones of Euglena gracilis were separated by gel filtration into five fractions. 2. Each fraction was characterized in terms of its electrophoretic, solubility and compositional properties. 3. Euglena gracilis clearly contains histones corresponding to vertebrate H1, H2B, H3 and H4 fractions, although they all differ in containing more lysine. 4. The remaining Euglena histone is considered to be homologous to vertebrate histone H2A, but it differs in having a much higher ratio of lysine to arginine. 5. The Euglena histone H1 appears to be lacking in aspartic acid. 6. Electrophoresis in the presence of sodium dodecyl sulphate indicates that the molecular weights of the Euglena histones are close to those of the homologous vertebrate histones.     

Isolation of a novel type-I fatty-acid synthetase from Euglena gracilis. Specific derepression in streptomycin-bleached cells.

A novel, high-molecular-mass fatty-acid synthetase (FAS) complex has been isolated from streptomycin-bleached Euglena gracilis cells. The enzyme was purified 250-fold from the crude cell homogenate and subsequently migrated upon SDS/PAGE as a single band of molecular mass 270 kDa. This apparent subunit size of the purified protein contrasted with a smaller size of only 200 kDa which was exhibited by the same protein upon immunoblotting of the crude cell extract. The purified Euglena FAS complex cosediments in a sucrose density gradient with yeast FAS and, from this, both enzymes were concluded to have the same overall molecular mass of 2.3 MDa. The enzyme described in this paper appears to be a typical type-I FAS multienzyme which clearly differs from the E. gracilis FAS so far described. Instead, it appears to be organized structurally similar to the type-I FAS multienzymes of lower fungi. In vitro, the purified Euglena FAS complex synthesizes mainly palmitic acid, or its CoA ester, from acetyl CoA and malonyl CoA as substrates. The Km values for acetyl CoA and malonyl CoA are 20 microM and 31 microM, respectively. Similar to the FAS enzymes of other lower eucaryotes, the Euglena type-I FAS is a flavoprotein. In contrast to yeast FAS, however, the flavin cofactor appears to be covalently attached to the enzyme protein. By immunological techniques, the enzyme was shown to be absent in green as well as in etiolated E. gracilis cells, while being rapidly induced upon streptomycin bleaching of heterotrophically growing green cells. The data suggest an inverse correlation between organellar development and derepression of this FAS complex.     

Effect of glucose on carbohydrate synthesis from alanine or lactate in hepatocytes from starved rats.

Euglena gracilis was found to contain a peroxidase that specifically require L-ascorbic acid as the natural electron donor in the cytosol. The presence of an oxidation-reduction system metabolizing L-ascorbic acid was demonstrated in Euglena cells. Oxidation of L-ascorbic acid by the peroxidase, and the absence of ascorbic acid oxidase activity, suggests that the system functions to remove H2O2 in E. gracilis, which lacks catalase.     

Amino acid sequence of calmodulin from Euglena gracilis.

The complete amino acid sequence of calmodulin from Euglena gracilis was determined by isolation and sequence analyses of peptides derived from calmodulin by digestion with trypsin and Staphylococcus aureus V8 protease. Euglena calmodulin consists of 148 amino acid residues; it lacks tryptophan and cysteine and contains one tyrosine, three histidine and two NE-trimethyllysine residues/molecule of the protein. Its N-terminus was blocked with an acetyl group and C-terminal lysine was trimethylated. Euglena calmodulin is the first calmodulin so far examined in which the C-terminal lysine is trimethylated. The comparison of amino acid sequences between Euglena and human brain calmodulins indicated 17 amino acid substitutions in Euglena calmodulin.     

The gene for the large subunit of ribulose-1,5-bisphosphate carboxylase in Euglena gracilis chloroplast DNA: location, polarity, cloning, and evidence for an intervening sequence

The gene for the large subunit (LS) of ribulose-1,5,-bisphosphate carboxylase of Euglena gracilis Z chloroplast DNA has been mapped by heterologous hybridization with DNA restriction fragments containing internal sequences from the Zea mays and Chlamydomonas reinhardii LS genes. The Euglena LS gene which has the same polarity as the Euglena rRNA genes has been located with respect to Pst I, Pvu I, and HindIII sites within the Eco RI fragment Eco A. The region of Euglena chloroplast DNA complementary to an 887 bp internal fragment from the Chlamydomonas chloroplast LS gene is interrupted by a 0.5-1.1 kbp non-complementary sequence. This is the first chloroplast protein gene located on the Euglena genome, and the first evidence for an intervening sequence within any chloroplast protein gene.     

Effect of external environmental factors on DNA content in Euglena]

The chromosome number and DNA content in Euglena gracilis cell have been shown by the number of investigators to vary essentially under the influence of some environmental factors (low phosphate and acetate concentrations, density of culture, temperature, light/dark regime, streptomycin treatment). Variability in the nuclear DNA quantity is supposed to be an important peculiarity of the structure and functional activity of the genome of Euglena gracilis.     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

Absorbance spectra of the hematochrome-like granules and eyespot of Euglena gracilis by scan-free absorbance spectral imaging A(x,y, λ) within the live cells

Journal of Plant Research - Euglena gracilis has an organelle resembling hematochrome, with an appearance similar to the eyespot and the absorption band spectrally overlapped with that of the...