首页 | 本学科首页   官方微博 | 高级检索  
相似文献
 共查询到20条相似文献,搜索用时 62 毫秒
1.
Predator-prey relationships among prokaryotes have received little attention but are likely to be important determinants of the composition, structure, and dynamics of microbial communities. Many species of the soil-dwelling myxobacteria are predators of other microbes, but their predation range is poorly characterized. To better understand the predatory capabilities of myxobacteria in nature, we analyzed the predation performance of numerous Myxococcus isolates across 12 diverse species of bacteria. All predator isolates could utilize most potential prey species to effectively fuel colony expansion, although one species hindered predator swarming relative to a control treatment with no growth substrate. Predator strains varied significantly in their relative performance across prey types, but most variation in predatory performance was determined by prey type, with Gram-negative prey species supporting more Myxococcus growth than Gram-positive species. There was evidence for specialized predator performance in some predator-prey combinations. Such specialization may reduce resource competition among sympatric strains in natural habitats. The broad prey range of the Myxococcus genus coupled with its ubiquity in the soil suggests that myxobacteria are likely to have very important ecological and evolutionary effects on many species of soil prokaryotes.Predation plays a major role in shaping both the ecology and evolution of biological communities. The population and evolutionary dynamics of predators and their prey are often tightly coupled and can greatly influence the dynamics of other organisms as well (1). Predation has been invoked as a major cause of diversity in ecosystems (11, 12). For example, predators may mediate coexistence between superior and inferior competitors (2, 13), and differential trajectories of predator-prey coevolution can lead to divergence between separate populations (70).Predation has been investigated extensively in higher organisms but relatively little among prokaryotes. Predation between prokaryotes is one of the most ancient forms of predation (27), and it has been proposed that this process may have been the origin of eukaryotic cells (16). Prokaryotes are key players in primary biomass production (44) and global nutrient cycling (22), and predation of some prokaryotes by others is likely to significantly affect these processes. Most studies of predatory prokaryotes have focused on Bdellovibrionaceae species (e.g., see references 51, 55, and 67). These small deltaproteobacteria prey on other Gram-negative cells, using flagella to swim rapidly until they collide with a prey cell. After collision, the predator cells then enter the periplasmic space of the prey cell, consume the host cell from within, elongate, and divide into new cells that are released upon host cell lysis (41). Although often described as predatory, the Bdellovibrionaceae may also be considered to be parasitic, as they typically depend (apart from host-independent strains that have been observed [60]) on the infection and death of their host for their reproduction (47).In this study, we examined predation among the myxobacteria, which are also deltaproteobacteria but constitute a monophyletic clade divergent from the Bdellovibrionaceae (17). Myxobacteria are found in most terrestrial soils and in many aquatic environments as well (17, 53, 74). Many myxobacteria, including the model species Myxococcus xanthus, exhibit several complex social traits, including fruiting body formation and spore formation (14, 18, 34, 62, 71), cooperative swarming with two motility systems (64, 87), and group (or “wolf pack”) predation on both bacteria and fungi (4, 5, 8, 9, 15, 50). Using representatives of the genus Myxococcus, we tested for both intra- and interspecific variation in myxobacterial predatory performance across a broad range of prey types. Moreover, we examined whether prey vary substantially in the degree to which they support predatory growth by the myxobacteria and whether patterns of variation in predator performance are constant or variable across prey environments. The latter outcome may reflect adaptive specialization and help to maintain diversity in natural populations (57, 59).Although closely related to the Bdellovibrionaceae (both are deltaproteobacteria), myxobacteria employ a highly divergent mode of predation. Myxobacteria use gliding motility (64) to search the soil matrix for prey and produce a wide range of antibiotics and lytic compounds that kill and decompose prey cells and break down complex polymers, thereby releasing substrates for growth (66). Myxobacterial predation is cooperative both in its “searching” component (6, 31, 82; for details on cooperative swarming, see reference 64) and in its “handling” component (10, 29, 31, 32), in which secreted enzymes turn prey cells into consumable growth substrates (56, 83). There is evidence that M. xanthus employs chemotaxis-like genes in its attack on prey cells (5) and that predation is stimulated by close contact with prey cells (48).Recent studies have revealed great genetic and phenotypic diversity within natural populations of M. xanthus, on both global (79) and local (down to centimeter) scales (78). Phenotypic diversity includes variation in social compatibility (24, 81), the density and nutrient thresholds triggering development (33, 38), developmental timing (38), motility rates and patterns (80), and secondary metabolite production (40). Although natural populations are spatially structured and both genetic diversity and population differentiation decrease with spatial scale (79), substantial genetic diversity is present even among centimeter-scale isolates (78). No study has yet systematically investigated quantitative natural variation in myxobacterial predation phenotypes across a large number of predator genotypes.Given the previous discovery of large variation in all examined phenotypes, even among genetically extremely similar strains, we anticipated extensive predatory variation as well. Using a phylogenetically broad range of prey, we compared and contrasted the predatory performance of 16 natural M. xanthus isolates, sampled from global to local scales, as well as the commonly studied laboratory reference strain DK1622 and representatives of three additional Myxococcus species: M. flavescens (86), M. macrosporus (42), and M. virescens (63) (Table (Table1).1). In particular, we measured myxobacterial swarm expansion rates on prey lawns spread on buffered agar (31, 50) and on control plates with no nutrients or with prehydrolyzed growth substrate.

TABLE 1.

List of myxobacteria used, with geographical origin
Organism abbreviation used in textSpeciesStrainGeographic originReference(s)
A9Myxococcus xanthusA9Tübingen, Germany78
A23Myxococcus xanthusA23Tübingen, Germany78
A30Myxococcus xanthusA30Tübingen, Germany78
A41Myxococcus xanthusA41Tübingen, Germany78
A46Myxococcus xanthusA46Tübingen, Germany78
A47Myxococcus xanthusA47Tübingen, Germany78
A75Myxococcus xanthusA75Tübingen, Germany78
A85Myxococcus xanthusA85Tübingen, Germany78
TVMyxococcus xanthusTvärminneTvärminne, Finland79
PAKMyxococcus xanthusPaklenicaPaklenica, Croatia79
MADMyxococcus xanthusMadeira 1Madeira, Portugal79
WARMyxococcus xanthusWarwick 1Warwick, UK79
TORMyxococcus xanthusToronto 1Toronto, Ontario, Canada79
SUL2Myxococcus xanthusSulawesi 2Sulawesi, Indonesia79
KALMyxococcus xanthusKalalauKalalau, HI79
DAVMyxococcus xanthusDavis 1ADavis, CA79
GJV1Myxococcus xanthusGJV 1Unknown35, 72
MXFL1Myxococcus flavescensMx fl1Unknown65
MXV2Myxococcus virescensMx v2Unknown65
CCM8Myxococcus macrosporusCc m8Unknown65
Open in a separate window  相似文献   

2.
The biological, serological, and genomic characterization of a paramyxovirus recently isolated from rockhopper penguins (Eudyptes chrysocome) suggested that this virus represented a new avian paramyxovirus (APMV) group, APMV10. This penguin virus resembled other APMVs by electron microscopy; however, its viral hemagglutination (HA) activity was not inhibited by antisera against any of the nine defined APMV serotypes. In addition, antiserum generated against this penguin virus did not inhibit the HA of representative viruses of the other APMV serotypes. Sequence data produced using random priming methods revealed a genomic structure typical of APMV. Phylogenetic evaluation of coding regions revealed that amino acid sequences of all six proteins were most closely related to APMV2 and APMV8. The calculation of evolutionary distances among proteins and distances at the nucleotide level confirmed that APMV2, APMV8, and the penguin virus all were sufficiently divergent from each other to be considered different serotypes. We propose that this isolate, named APMV10/penguin/Falkland Islands/324/2007, be the prototype virus for APMV10. Because of the known problems associated with serology, such as antiserum cross-reactivity and one-way immunogenicity, in addition to the reliance on the immune response to a single protein, the hemagglutinin-neuraminidase, as the sole base for viral classification, we suggest the need for new classification guidelines that incorporate genome sequence comparisons.Viruses from the Paramyxoviridae family have caused disease in humans and animals for centuries. Over the last 40 years, many paramyxoviruses isolated from animals and people have been newly described (16, 17, 22, 29, 31, 32, 36, 42, 44, 46, 49, 58, 59, 62-64). Viruses from this family are pleomorphic, enveloped, single-stranded, nonsegmented, negative-sense RNA viruses that demonstrate serological cross-reactivity with other paramyxoviruses related to them (30, 46). The subfamily Paramyxovirinae is divided into five genera: Respirovirus, Morbillivirus, Rubulavirus, Henipavirus, and Avulavirus (30). The Avulavirus genus contains nine distinct avian paramyxovirus (APMV) serotypes (Table (Table1),1), and information on the discovery of each has been reported elsewhere (4, 6, 7, 9, 12, 34, 41, 50, 51, 60, 68).

TABLE 1.

Characteristics of prototype viruses APMV1 to APMV9 and the penguin virus
StrainHostDiseaseDistributionFusion cleavagecGI accession no.
APMV1/Newcastle disease virus>250 speciesHigh mortalityWorldwideGRRQKRF45511218
InapparentWorldwideGGRQGRLa11545722
APMV2/Chicken/CA/Yucaipa/1956Turkey, chickens, psittacines, rails, passerinesDecrease in egg production and respiratory diseaseWorldwideDKPASRF169144527
APMV3/Turkey/WI/1968TurkeyMild respiratory disease and moderate egg decreaseWorldwidePRPSGRLa209484147
APMV3/Parakeet/Netherlands/449/1975Psittacines, passerines, flamingosNeurological, enteric, and respiratory diseaseWorldwideARPRGRLa171472314
APMV4/Duck/Hong Kong/D3/1975Duck, geese, chickensNone knownWorldwideVDIQPRF210076708
APMV5/Budgerigar/Japan/Kunitachi/1974Budgerigars, lorikeetsHigh mortality, enteric diseaseJapan, United Kingdom, AustraliaGKRKKRFa290563909
APMV6/Duck/Hong Kong/199/1977Ducks, geese, turkeysMild respiratory disease and increased mortality in turkeysWorldwidePAPEPRLb15081567
APMV7/Dove/TN/4/1975Pigeons, doves, turkeysMild respiratory disease in turkeysUnited States, England, JapanTLPSSRF224979458
APMV8/Goose/DE/1053/1976Ducks, geeseNone knownUnited States, JapanTYPQTRLa226343050
APMV9/Duck/NY/22/1978DucksNone knownWorldwideRIREGRIa217068693
APMV10/Penguin/Falkland Islands/324/2007Rockhopper penguinsNone KnownFalkland IslandsDKPSQRIa300432141
Open in a separate windowaRequires the addition of an exogenous protease.bProtease requirement depends on the isolate examined.cPutative.Six of these serotypes were classified in the latter half of the 1970s, when the most reliable assay available to classify paramyxoviruses was the hemagglutination inhibition (HI) assay (61). However, there are multiple problems associated with the use of serology, including the inability to classify some APMVs by comparing them to the sera of the nine defined APMVs alone (2, 8). In addition, one-way antigenicity and cross-reactivity between different serotypes have been documented for many years (4, 5, 14, 25, 29, 33, 34, 41, 51, 52, 60). The ability of APMVs, like other viruses, to show antigenic drift as it evolves over time (37, 43, 54) and the wide use and availability of precise molecular methods, such as PCR and genome sequencing, demonstrate the need for a more practical classification system.The genetic diversity of APMVs is still largely unexplored, as hundreds of avian species have never been surveyed for the presence of viruses that do not cause significant signs of disease or are not economically important. The emergence of H5N1 highly pathogenic avian influenza (HPAI) virus as the cause of the largest outbreak of a virulent virus in poultry in the past 100 years has spurred the development of surveillance programs to better understand the ecology of avian influenza (AI) viruses in aquatic birds around the globe, and in some instances it has provided opportunities for observing other viruses in wild bird populations (15, 53). In 2007, as part of a seabird health surveillance program in the Falkland Islands (Islas Malvinas), oral and cloacal swabs and serum were collected from rockhopper penguins (Eudyptes chrysocome) and environmental/fecal swab pools were collected from other seabirds.While AI virus has not yet been isolated from penguins in the sub-Antarctic and Antarctic areas, there have been two reports of serum antibodies positive to H7 and H10 from the Adélie species (11, 40). Rare isolations of APMV1, both virulent (45) and of low virulence (8), have been reported from Antarctic penguins. Sera positive for APMV1 and AMPV2 have also been reported (21, 24, 38, 40, 53). Since 1981, paramyxoviruses have been isolated from king penguins (Aptenodytes patagonicus), royal penguins (Eudyptes schlegeli), and Adélie penguins (Pygoscelis adeliae) from Antarctica and little blue penguins (Eudyptula minor) from Australia that cannot be identified as belonging to APMV1 to -9 and have not yet been classified (8, 11, 38-40). The morphology, biological and genomic characteristics, and antigenic relatedness of an APMV recently isolated from multiple penguin colonies on the Falkland Islands are reported here. Evidence that the virus belongs to a new serotype (APMV10) and a demonstration of the advantages of a whole genome system of analysis based on random sequencing followed by comparison of genetic distances are presented. Only after all APMVs are reported and classified will epidemiological information be known as to how the viruses are moving and spreading as the birds travel and interact with other avian species.  相似文献   

3.
Resistance of greenhouse-selected strains of the cabbage looper, Trichoplusia ni, to Bacillus thuringiensis subsp. kurstaki was countered by a hybrid strain of B. thuringiensis and genetically modified toxins Cry1AbMod and Cry1AcMod, which lack helix α-1. Resistance to Cry1AbMod and Cry1AcMod was >100-fold less than resistance to native toxins Cry1Ab and Cry1Ac.Insecticidal proteins from Bacillus thuringiensis are used widely for pest control, but evolution of resistance by pests can reduce their efficacy (3, 4, 6, 14). Resistance to B. thuringiensis toxins has been reported in field populations of four species of Lepidoptera, one species in response to sprays (3, 14) and three species in response to transgenic crops (10, 15, 16). Here, we focus on understanding and countering resistance to sprays of Bacillus thuringiensis subsp. kurstaki that evolved in commercial greenhouse populations of the cabbage looper, Trichoplusia ni (7, 17).We compared responses to single toxins and formulations of B. thuringiensis by two resistant strains (GipBtR and GlenBtR) and two related susceptible strains (GipS and GlenS) of T. ni. All four strains were started by the collection of larvae in 2001 from commercial greenhouses near Vancouver in British Columbia, Canada (7). Resistance evolved in the greenhouses in response to repeated sprays of DiPel (7), a formulation of B. thuringiensis subsp. kurstaki strain HD1 containing Cry1Aa, Cry1Ab, Cry1Ac, and Cry2Aa (9). Previously reported concentrations required to kill 50% of larvae (LC50s) indicated that, relative to a susceptible laboratory strain, initial resistance to DiPel was 113-fold in the Gip population (labeled T2c in reference 7) and 24-fold in the Glen population (labeled P5 in reference 7).We reared larvae on a wheat germ diet (5) at 26°C on a light-to-dark schedule of 16 h:8 h. GipS and GlenS were reared on diet without B. thuringiensis toxins, which allowed resistance to decline (7). To maintain resistance, GipBtR and GlenBtR were reared each generation on a diet treated with 5 or 10 mg of DiPel WP (Abbott Laboratories, Ontario, Canada) per milliliter of diet (7). In bioassays, groups of five third-instar larvae were put in 60-ml plastic cups containing diet, and mortality was assessed after 3 days by gently probing larvae for movement.We used diet overlay bioassays to evaluate the toxicity to GipBtR and GipS of the protoxin forms of Cry1Ab, Cry1Ac, Cry1AbMod, and Cry1AcMod produced in B. thuringiensis strains (12). Cry1AbMod and Cry1AcMod are genetically engineered variants of Cry1Ab and Cry1Ac, respectively, each lacking 56 amino acids from the amino-terminal region, including helix α-1 (12). An 80-μl aliquot containing distilled water and toxin was dispensed evenly over the surfaces of 2 ml of diet (a mean surface area of 7.1 cm2) and allowed to dry. Fifty to 200 larvae from each strain were tested at five to eight concentrations of each toxin.We used diet incorporation bioassays (7) to evaluate the toxicities of DiPel and Agree WG (Certis, Columbia, MD) to GipS, GipBtR, GlenS, and GlenBtR. Agree is a formulation of hybrid strain GC91, which was created from the conjugation-like transfer of a plasmid from B. thuringiensis subsp. kurstaki strain HD191 into B. thuringiensis subsp. aizawai strain HD135, and it contains Cry1Ac, Cry1C, and Cry1D (1, 8). DiPel and Agree were diluted in distilled water and mixed into diet (7). Twenty-five to 50 larvae from each strain were tested at six to seven concentrations of DiPel and Agree.We used probit analysis (13) to estimate the LC50s and their 95% fiducial limits (FL), as well as the slopes of concentration-mortality lines and their standard errors. The mortality of larvae fed treated diet was not adjusted for the mortality of control larvae on untreated diet, because the control mortality was low (mean, 3.6%; range, 0 to 16%). LC50s with nonoverlapping 95% FL are significantly different. Resistance ratios were calculated as the LC50 of a resistant strain (GipBtR or GlenBtR) divided by the LC50 of its susceptible counterpart (GipS or GlenS).The genetically modified toxins Cry1AbMod and Cry1AcMod were much more effective than the native toxins Cry1Ab and Cry1Ac against larvae of T. ni from the resistant GipBtR strain (Table (Table1).1). Resistance ratios of GipBtR were 580 for Cry1Ab and 1,400 for Cry1Ac but only 5.5 for Cry1AbMod and 9.3 for Cry1AcMod (Table (Table1).1). Against GipBtR, the LC50 was 53-fold higher for Cry1Ab than for Cry1AbMod and 11-fold higher for Cry1Ac than for Cry1AcMod (Table (Table1).1). Against GipS, however, the LC50 was 2-fold higher for Cry1AbMod than for Cry1Ab and 14-fold higher for Cry1AcMod than for Cry1Ac (Table (Table11).

TABLE 1.

Responses of resistant (GipBtR and GlenBtR) and susceptible (GipS and GlenS) strains of T. ni to native toxins (Cry1Ab and Cry1Ac), modified toxins (Cry1AbMod and Cry1AcMod), and formulations (DiPel and Agree)
Toxin or formulationStrainNo. of larvaeLC50 (95% FL)aSlope ± SEResistance ratiob
Cry1AbGipBtR400180 (59-2,900)c0.41 ± 0.09580
GipS3760.30 (0.21-0.41)0.56 ± 0.06
Cry1AbModGipBtR4003.4 (2.6-4.6)0.52 ± 0.055.5
GipS3750.62 (0.51-0.75)0.99 ± 0.09
Cry1AcGipBtR60054 (35-110)d0.50 ± 0.071,400
GipS1,4500.038 (0.031-0.046)0.44 ± 0.02
Cry1AcModGipBtR6005.1 (4.4-5.8)0.85 ± 0.069.3
GipS1,1450.55 (0.47-0.64)0.60 ± 0.03
DiPelGipBtR12566 (21-420,000)e0.43 ± 0.17370
GipS1250.18 (0.08-0.27)0.73 ± 0.16
AgreeGipBtR3004.9 (3.6-7.7)0.81 ± 0.129.9
GipS3000.49 (0.42-0.57)1.4 ± 0.14
DiPelGlenBtR1503.2 (2.7-3.9)1.9 ± 0.2726
GlenS1250.13 (0.05-0.17)1.5 ± 0.44
AgreeGlenBtR3002.0 (1.7-2.4)1.2 ± 0.125.9
GlenS2950.34 (0.29-0.39)1.4 ± 0.17
Open in a separate windowaConcentration that killed 50% and its 95% FL in mg protoxin per cm2 diet for toxins and mg formulation per ml of diet for DiPel and Agree.bLC50 of the resistant strain divided by the LC50 of the related susceptible strain for each toxin or formulation.cTotal of 17% mortality at the highest toxin concentration tested (17 mg protoxin/cm2 diet).dTotal of 35% mortality at the highest toxin concentration tested (23 mg protoxin/cm2 diet).eTotal of 24% mortality at the highest toxin concentration tested (15 mg DiPel/ml diet).Agree was more effective than DiPel against the two resistant strains GipBtR and GlenBtR (Table (Table1).1). Resistance ratios for DiPel were 370 for GipBtR and 26 for GlenBtR compared to resistance ratios for Agree, which were 9.9 for GipBtR and 5.9 for GlenBtR (Table (Table1).1). For the two resistant strains, LC50s were higher for DiPel than for Agree (13-fold higher against GipBtR and 1.6-fold higher against GlenBtR) (Table (Table1).1). Conversely, against the two susceptible strains, the LC50s were higher for Agree than for DiPel (2.7-fold higher against GipBtR and 2.6-fold higher against GlenBtR).The resistant GipBtR strain examined here (Table (Table1)1) and the resistant GLEN-Cry1Ac-BCS strain of T. ni studied by Wang et al. (17) had >500-fold resistance to Cry1Ab and Cry1Ac. Both GipBtR and GLEN-Cry1Ac-BCS were derived from greenhouse populations of T. ni that had been sprayed repeatedly with DiPel (7, 17), which contains Cry1Ab and Cry1Ac but not Cry1C or Cry1D (9). The GLEN-Cry1Ac-BCS strain had cross-resistance of only 2.5-fold to Cry1C and 2.4-fold to Cry1D (17). Agree contains Cry1C and Cry1D (8), which probably boosted its efficacy against GipBtR and GlenBtR (Table (Table11).The results here with Cry1AbMod and Cry1AcMod extend those of previous work indicating that modified toxins killed larvae of Manduca sexta in which susceptibility to Cry1Ab was decreased via RNA interference and also killed larvae of Pectinophora gossypiella that had laboratory-selected, genetically based resistance to Cry1Ab and Cry1Ac (12). The efficacy of Cry1AbMod and Cry1AcMod against greenhouse-selected T. ni suggests that the modified toxins may be useful against resistance that evolves in commercial agricultural settings. The results here also increase the number of lepidopteran species against which the modified toxins were effective to three, with each species representing a different family (Sphingidae, Gelechiidae, and Noctuidae). In the two other species, decreased susceptibility to native Cry1A toxins was mediated by alterations in a cadherin protein that binds Cry1Ac (2, 11, 12), whereas the role of cadherin in T. ni resistance has not been demonstrated or excluded.Similar to patterns observed with P. gossypiella (12), modified toxins were more effective than native toxins against resistant T. ni larvae, but native toxins were more effective than modified toxins against susceptible T. ni larvae (Table (Table1).1). This raises the intriguing possibility that combinations of native and modified toxins might be especially effective against populations with a mixture of susceptible and resistant individuals. In any case, the Cry1AMod toxins and hybrid B. thuringiensis products applied either jointly or separately may be useful for countering or delaying evolution of resistance in T. ni. However, further work is needed to determine how native and modified toxins interact when used in combination and how modified toxins perform in the greenhouse and field.  相似文献   

4.
Par-1 is an evolutionarily conserved protein kinase required for polarity in worms, flies, frogs, and mammals. The mammalian Par-1 family consists of four members. Knockout studies of mice implicate Par-1b/MARK2/EMK in regulating fertility, immune homeostasis, learning, and memory as well as adiposity, insulin hypersensitivity, and glucose metabolism. Here, we report phenotypes of mice null for a second family member (Par-1a/MARK3/C-TAK1) that exhibit increased energy expenditure, reduced adiposity with unaltered glucose handling, and normal insulin sensitivity. Knockout mice were protected against high-fat diet-induced obesity and displayed attenuated weight gain, complete resistance to hepatic steatosis, and improved glucose handling with decreased insulin secretion. Overnight starvation led to complete hepatic glycogen depletion, associated hypoketotic hypoglycemia, increased hepatocellular autophagy, and increased glycogen synthase levels in Par-1a−/− but not in control or Par-1b−/− mice. The intercrossing of Par-1a−/− with Par-1b−/− mice revealed that at least one of the four alleles is necessary for embryonic survival. The severity of phenotypes followed a rank order, whereby the loss of one Par-1b allele in Par-1a−/− mice conveyed milder phenotypes than the loss of one Par-1a allele in Par-1b−/− mice. Thus, although Par-1a and Par-1b can compensate for one another during embryogenesis, their individual disruption gives rise to distinct metabolic phenotypes in adult mice.Cellular polarity is a fundamental principle in biology (6, 36, 62). The prototypical protein kinase originally identified as a regulator of polarity was termed partitioning defective (Par-1) due to early embryonic defects in Caenorhabditis elegans (52). Subsequent studies revealed that Par-1 is required for cellular polarity in worms, flies, frogs, and mammals (4, 17, 58, 63, 65, 71, 89). An integral role for Par-1 kinases in multiple signaling pathways has also been established, and although not formally addressed, multifunctionality for individual Par-1 family members is implied in reviews of the list of recognized upstream regulators and downstream substrates (Table (Table1).1). Interestingly, for many Par-1 substrates the phosphorylated residues generate 14-3-3 binding sites (25, 28, 37, 50, 59, 61, 68, 69, 78, 95, 101, 103). 14-3-3 binding in turn modulates both nuclear/cytoplasmic as well as cytoplasmic/membrane shuttling of target proteins, thus allowing Par-1 activity to establish intracellular spatial organization (15, 101). The phosphorylation of Par-1 itself promotes 14-3-3 binding, thereby regulating its subcellular localization (37, 59, 101).

TABLE 1.

Multifunctionality of Par-1 polarity kinase pathwaysa
Regulator or substrateFunctionReference(s)
Regulators (upstream function)
    LKB1Wnt signaling, Peutz-Jeghers syndrome, insulin signal transduction, pattern formation2, 63, 93
    TAO1MEK3/p38 stress-responsive mitogen-activated protein kinase (MAPK) pathway46
    MARKKNerve growth factor signaling in neurite development and differentiation98
    aPKCCa2+/DAG-independent signal transduction, cell polarity, glucose metabolism14, 37, 40, 45, 59, 75, 95
    nPKC/PKDDAG-dependent, Ca2+-independent signal transduction (GPCR)101
    PAR-3/PAR-6/aPKC(−); regulates Par-1, assembly of microtubules, axon-dendrite specification19
    GSK3β(−); tau phosphorylation, Alzheimer''s dementia, energy metabolism, body patterning54, 97
    Pim-1 oncogene(−); G2/M checkpoint, effector of cytokine signaling and Jak/STAT(3/5)5
    CaMKI(−); Ca2+-dependent signal transduction, neuronal differentiation99
Substrates (downstream function)
    Cdc25CRegulation of mitotic entry by activation of the cdc2-cyclin B complex25, 72, 78, 103
    Class II HDACControl of gene expression and master regulator of subcellular trafficking28, 50
    CRTC2/TORC2Gluconeogenesis regulator via LKB1/AMPK/TORC2 signaling, PPARγ1a coactivator49
    Dlg/PSD-95Synaptogenesis and neuromuscular junction, tumor suppressor (102)104
    DisheveledWnt signaling, translocation of Dsh from cytoplasmic vesicles to cortex73, 94
    KSR1Regulation of the Ras-MAPK pathway68, 69
    MAP2/4/TAUDynamic instability (67, 83) of microtubules, Alzheimer''s dementia (30)11, 31-33, 47, 70, 96
    Mib/NotchMind bomb (Mib degradation and repression of Notch signaling results in neurogenesis)57, 74, 81
    Par3/OSKAR/LglCytoplasmic protein segregation, cell polarity, and asymmetric cell division7, 10
    Pkp2Desmosome assembly and organization; nuclear shuttling68, 69
    PTPH1Linkage between Ser/Thr and Tyr phosphorylation-dependent signaling103
    Rab11-FIPRegulation of endocytosis (23), trafficking of E-cadherin (64)34
Open in a separate windowaLKB1 also is known as Par-4; MARKK also is known as Ste20-like; (−), inhibitory/negative regulation has been shown; GPCR, G protein-coupled receptors. MARKK is highly homologous to TAO-1 (thousand-and-one amino acid kinase) (46).The mammalian Par-1 family contains four members (Table (Table2).2). Physiological functions of the Par-1b kinase have been studied using targeted gene knockout approaches in mice (9, 44). Two independently derived mouse lines null for Par-1b have implicated this protein kinase in diverse physiological processes, including fertility (9), immune system homeostasis (44), learning and memory (86), the positioning of nuclei in pancreatic beta cells (35, 38), and growth and metabolism (43).

TABLE 2.

Terminology and localization of mammalian Par-1 family members
SynonymsaSubcellular localization
Par-1a, MARK3, C-TAK1, p78/KP78, 1600015G02Rik, A430080F22Rik, Emk2, ETK-1, KIAA4230, mKIAA1860, mKIAA4230, M80359Basolateralb/apicalc
Par-1b, EMK, MARK2, AU024026, mKIAA4207Basolateral
Par1c, MARK1Basolateral
Par1d, MARK4, MARKL1Not asymmetricd
Open in a separate windowaPar should not to be confused with protease-activated receptor 1 (PAR1 [29]); C-TAK1, Cdc twenty-five C-associated kinase 1; MARK, microtubule affinity regulating kinase; MARKL, MAP/microtubule affinity-regulating kinase-like 1.bBasolateral to a lesser degree than Par-1b (37).cHuman KP78 is asymmetrically localized to the apical surface of epithelial cells (76).dVariant that does not show asymmetric localization in epithelial cells when overexpressed (95).Beyond Par-1b, most information regarding the cell biological functions of the Par-1 kinases comes from studies of Par-1a. Specifically, Par-1a has been implicated in pancreatic (76) and hepatocarcinogenesis (51), as well as colorectal tumors (77), hippocampal function (100), CagA (Helicobacter pylori)-associated epithelial cell polarity disruption (82), and Peutz-Jeghers syndrome (48), although the latter association has been excluded recently (27). As a first step toward determining unique and redundant functions of Par-1 family members, mice disrupted for a second member of the family (Par-1a/MARK3/C-TAK1) were generated. We report that Par-1a−/− mice are viable and develop normally, and adult mice are hypermetabolic, have decreased white and brown adipose tissue mass, and unaltered glucose/insulin handling. However, when challenged by a high-fat diet (HFD), Par-1a−/− mice exhibit resistance to hepatic steatosis, resistance to glucose intolerance, and the delayed onset of obesity relative to that of control littermates. Strikingly, overnight starvation results in a complete depletion of glycogen and lipid stores along with an increase in autophagic vacuoles in the liver of Par-1a−/− but not Par-1b−/− mice. Correspondingly, Par-1a−/− mice develop hypoketotic hypoglycemia. These findings reveal unique metabolic functions of two Par-1 family members.  相似文献   

5.
6.
7.
8.
The human gut microbe Bacteroides fragilis can alter the expression of its surface molecules, such as capsular polysaccharides and SusC/SusD family outer membrane proteins, through reversible DNA inversions. We demonstrate here that DNA inversions at 12 invertible regions, including three gene clusters for SusC/SusD family proteins, were controlled by a single tyrosine site-specific recombinase (Tsr0667) encoded by BF0667 in B. fragilis strain YCH46. Genetic disruption of BF0667 diminished or attenuated shufflon-type DNA inversions at all three susC/susD genes clusters, as well as simple DNA inversions at nine other loci, most of which colocalized with susC/susD family genes. The inverted repeat sequences found within the Tsr0667-regulated invertible regions shared the consensus motif sequence AGTYYYN4GDACT. Tsr0667 specifically mediated the DNA inversions of 10 of the 12 regions, even under an Escherichia coli background when the invertible regions were exposed to BF0667 in E. coli cells. Thus, Tsr0667 is an additional globally acting DNA invertase in B. fragilis, which probably involves the selective expression of SusC/SusD family outer membrane proteins.The human gut harbors an abundant and diverse microbiota. Bacteroides is one of the most abundant genera of human gut microflora (10, 17, 20), and the biological activities of Bacteroides species are deeply integrated into human physiology through nutrient degradation, the production of short-chain fatty acids, or immunomodulatory molecules (11-14, 24). Recent genomic analyses of Bacteroides have revealed that the bacteria possess redundant abilities not only to bind and degrade otherwise indigestible dietary polysaccharides but also to produce vast arrays of capsular polysaccharide (5, 19, 38, 39). These functional redundancies have been established by the extensive duplication of various genes that encode molecules such as glycosylhydrolases, glycosyltransferases, and outer membrane proteins of the SusC/SusD family (starch utilization system) known to be involved in polysaccharide recognition and transport (7, 27, 28, 30). It has been assumed that these functional redundancies of Bacteroides contribute to the stability of the gut ecosystem (3, 21, 23, 32, 39).Another characteristic feature common in Bacteroides species is that the expression of some of the genes is altered in an on-off manner by reversible DNA inversions at gene promoters or within the protein-coding regions (5, 9, 19, 38, 39). These phase-variable phenotypes are associated with surface architectures such as capsular polysaccharides and SusC/SusD family proteins (5, 6, 16, 19). Our previous genomic analyses of Bacteroides fragilis strain YCH46 revealed that it contained as many as 31 invertible regions in its chromosome (19). These invertible regions can be grouped into six classes according to the internal motif sequences within inverted repeat sequences (IRs) (Table (Table1).1). The DNA inversions within these regions are thought to be controlled by site-specific DNA invertases specific to each class. B. fragilis strain YCH46 contains 33 tyrosine site-specific recombinases (Tsr) genes and four serine site-specific recombinases (Ssr) genes. Generally, DNA invertases mediate DNA inversions at adjacent regions, such as FimB and FimE, that flip their immediate downstream promoters to generate a phase-variable phenotype of type I pili in Escherichia coli (15). B. fragilis is unique in that this anaerobe possesses not only locally acting DNA invertases but also globally acting DNA invertases that mediate DNA inversions at distant loci (8, 29). It has been reported that B. fragilis possesses at least two types of master DNA invertase that regulate DNA inversions at multiple loci simultaneously (8, 29). One is Mpi, an Ssr that mediates the on-off switching of 13 promoter regions (corresponding to class I regions in B. fragilis strain YCH46), including seven promoter regions for capsular polysaccharide biosynthesis in B. fragilis strain NCTC9343 (8). The other master DNA invertase is Tsr19, a Tsr that regulates DNA inversions at two distantly located promoter regions (corresponding to class IV regions in B. fragilis strain YCH46) associated with the large encapsulation phenotype (6, 26, 29). The invertible regions contain specific consensus motifs within the IRs corresponding to each DNA invertase and constitute a regulatory unit. We designated this type of regulatory unit as an “inverlon,” which consists of at least two invertible regions controlled by a single master DNA invertase.

TABLE 1.

Classification of the invertible regions in B. fragilis strain YCH46 based on internal motif sequences within IRs
ClassaNo.Consensus motif sequencesbMaster DNA invertase genecRegulated genesSource or reference(s)
I14ARACGTWCGTBF2765 (mpi)Capsular polysaccharide biosynthesis genes8
II10AGTTC{N5}GAACTBF0667susC/susD paralogsThis study
III3GTTAC{N7}GTAACBF3038, BF4033, BF4283Putative outer membrane protein genes36
IV2TACTTANTAGGTAANAGAABF2766Extracellular polysacharide biosynthesis genes6, 26, 29
V1TCTGCAAAGNCTTTGCAGABF0667susC/susD paralogsThis study
VI1ACTAAGTTCTATCGGBF0667susC/susD paralogsThis study
Open in a separate windowaOur previous classification of the invertible regions identified in B. fragilis strain YCH46 genome (19).bConsensus motif sequences found within IRs are shown. R = A or G, W = A or T, and N = A, G, C, or T.cThe gene identifications in B. fragilis strain YCH46 genome are shown.Our previous studies indicated that an additional inverlon other than the Mpi- and Tsr19-regulated inverlons is present in B. fragilis, based on the finding that at least 10 invertible regions (corresponding to class II regions in B. fragilis strain YCH46) contain a particular consensus motif sequence (AAGTTCN5GAACTT) within their IRs (19) but do not appear to colocalize with a DNA invertase gene. The majority of the class II regions were associated with the selective switching of a particular set of susC/susD family genes. Since the SusC/SusD family of outer membrane proteins play an important role in polysaccharide utilization by Bacteroides (3, 23, 32), the inverlon associated with the phase variation of SusC/SusD family proteins would likely be involved in the survival of this anaerobe in the distal gut.In the present study, we sought to identify the DNA invertase regulating the additional inverlon in B. fragilis. Our results indicated that the Tsr encoded by BF0667 is a master DNA invertase for this inverlon (designated the Tsr0667-inverlon) in B. fragilis.  相似文献   

9.
10.
11.
12.
The three-dimensional structure of adeno-associated virus (AAV) serotype 6 (AAV6) was determined using cryo-electron microscopy and image reconstruction and using X-ray crystallography to 9.7- and 3.0-Å resolution, respectively. The AAV6 capsid contains a highly conserved, eight-stranded (βB to βI) β-barrel core and large loop regions between the strands which form the capsid surface, as observed in other AAV structures. The loops show conformational variation compared to other AAVs, consistent with previous reports that amino acids in these loop regions are involved in differentiating AAV receptor binding, transduction efficiency, and antigenicity properties. Toward structure-function annotation of AAV6 with respect to its unique dual glycan receptor (heparan sulfate and sialic acid) utilization for cellular recognition, and its enhanced lung epithelial transduction compared to other AAVs, the capsid structure was compared to that of AAV1, which binds sialic acid and differs from AAV6 in only 6 out of 736 amino acids. Five of these residues are located at or close to the icosahedral 3-fold axis of the capsid, thereby identifying this region as imparting important functions, such as receptor attachment and transduction phenotype. Two of the five observed amino acids are located in the capsid interior, suggesting that differential AAV infection properties are also controlled by postentry intracellular events. Density ordered inside the capsid, under the 3-fold axis in a previously reported, conserved AAV DNA binding pocket, was modeled as a nucleotide and a base, further implicating this capsid region in AAV genome recognition and/or stabilization.Adeno-associated viruses (AAVs) are nonpathogenic single-stranded DNA (ssDNA) parvoviruses that belong to the Dependovirus genus and require helper viruses, such as Adenovirus or Herpesvirus, for lytic infection (4, 8, 22, 67). These viruses package a genome of ∼4.7 kb inside an icosahedral capsid (∼260 Å in diameter) with a triangulation number equal to 1 assembled from a total of 60 copies of their overlapping capsid viral protein (VP) 1 (VP1), VP2, and VP3 in a predicted ratio of 1:1:8/10 (10). The VPs are encoded from a cap open reading frame (ORF). VP3 is 61 kDa and constitutes 90% of the capsid''s protein composition. The less abundant VPs, VP1 (87 kDa) and VP2 (73 kDa), share the same C-terminal amino acid sequence with VP3 but have additional N-terminal sequences. A rep ORF codes for four overlapping proteins required for replication and DNA packaging.To date, more than 100 AAV isolates have been identified (21). Among the human and nonhuman primate AAVs isolated, 12 serotypes (AAV serotype 1 [AAV1] to AAV12) have been described and are classified into six phylogenetic clades on the basis of their VP sequences and antigenic reactivities, with AAV4 and AAV5 considered to be clonal isolates (21). AAV1 and AAV6, which represent clade A, differ by only 6 out of 736 VP1 amino acids (5 amino acids within VP3) and are antigenically cross-reactive. Other clade representatives include AAV2 (clade B), AAV2-AAV3 hybrid (clade C), AAV7 (clade D), AAV8 (clade E), and AAV9 (clade F) (21).The AAVs are under development as clinical gene delivery vectors (e.g., see references 5, 9, 12, 13, 24, 25, 53, and 61), with AAV2, the prototype member of the genus, being the most extensively studied serotype for this application. AAV2 has been successfully used to treat several disorders, but its broad tissue tropism makes it less effective for tissue-specific applications and the prevalence of preexisting neutralizing antibodies in the human population (11, 43) limits its utilization, especially when readministration is required to achieve a therapeutic outcome. Efforts have thus focused on characterizing the capsid-associated tissue tropism and transduction properties conferred by the capsid of representative serotypes of other clades (21). Outcomes of these studies include the observation that AAV1 and AAV6, for example, transduce liver, muscle, and airway epithelial cells more efficiently (e.g., up to 200-fold) than AAV2 (27, 28, 30). In addition, the six residues (Table (Table1)1) that differ between the VPs of AAV1 and AAV6 (a natural recombinant of AAV1 and AAV2 [56]) confer functional disparity between these two viruses. For example, AAV6 shows ∼3-fold higher lung cell epithelium transduction than AAV1 (27), and AAV1 and AAV6 bind terminally sialylated proteoglycans as their primary receptor, whereas AAV6 additionally binds to heparan sulfate (HS) proteoglycans with moderate affinity (70, 71). Therefore, a comparison of the AAV1 and AAV6 serotypes and, in particular, their capsid structures can help pinpoint the capsid regions that confer differences in cellular recognition and tissue transduction.

TABLE 1.

Amino acid differences between AAV1 and AAV6 and their reported mutants
AAVAmino acid at positiona:
Glycan targetbReference
129418531532584598642
AAV1LEEDFANS70
AAV1-E/KLEKDFANHS+ (and S)c70
AAV6FDKDLVHHS and S70
AAV6.1FDEDLVHHS (and S)c40, 70
AAV6.2LDKDLVHHS (and S)c40, 70
AAV6R2LDEDLVHHS (and S)c40
HAE1LEEDLVN(HS and S)d39
HAE2LDKDLVN(HS and S)d39
shH10FDKNLVNHS (and S-inde)33
Open in a separate windowaMutant residues in boldface have an AAV6 parental original; those underlined have an AAV1 parental origin.bS, sialic acid; HS, heparan sulfate; HS+, HS positive.cThe sialic acid binding phenotypes of these mutants were not discussed in the respective publications but are assumed to be still present.dThe glycan targets for these mutants were not discussed in this publication; thus, the phenotypes indicated are assumed.eThis mutant is sialic acid independent (S-ind) for cellular transduction.The structures of AAV1 to AAV5 and AAV8 have been determined by X-ray crystallography and/or cryo-electron microscopy and image reconstruction (cryo-EM) (23, 36, 47, 52, 66, 73; unpublished data), and preliminary characterization of crystals has also been reported for AAV1, AAV5, AAV7, and AAV9 (15, 45, 46, 55). The capsid VP structures contain a conserved eight-stranded (βB to βI) β-barrel core and large loop regions between the strands that form the capsid surface. The capsid surface is characterized by depressions at the icosahedral 2-fold axes of symmetry, finger-like projections surrounding the 3-fold axes, and canyon-like depressions surrounding the 5-fold axes. A total of nine variable regions (VRs; VRI to VRIX) were defined when the two most disparate structures, AAV2 and AAV4, were compared (23). The VRs contain amino acids that contribute to slight differences in surface topologies and distinct functional phenotypes, such as in receptor binding, transduction efficiency, and antigenic reactivity (10, 23, 37, 47).The structure of virus-like particles (VLPs) of AAV6, produced in a baculovirus/Sf9 insect cell expression system, has been determined by two highly complementary approaches, cryo-EM and X-ray crystallography. The AAV6 VP structure contains the general features already described for the AAVs and has conformational differences in the VRs compared to the VRs of other AAVs. The 9.7-Å-resolution cryoreconstructed structure enabled the localization of the C-α positions of five of the six amino acids that differ between highly homologous AAV6 and AAV1 but did not provide information on the positions of the side chains or their orientations. The X-ray crystal structure determined to 3.0-Å resolution enabled us to precisely map the atomic positions of these five residues at or close to the icosahedral 3-fold axes of the capsid. Reported mutagenesis and biochemical studies had functionally annotated the six residues differing between AAV1 and AAV6 with respect to their roles in receptor attachment and differential cellular transduction. Their disposition identifies the 3-fold capsid region as playing essential roles in AAV infection.  相似文献   

13.
14.
The Cry3Aa and Cry3Bb insecticidal proteins of Bacillus thuringiensis are used in biopesticides and transgenic crops to control larvae of leaf-feeding beetles and rootworms. Cadherins localized in the midgut epithelium are identified as receptors for Cry toxins in lepidopteran and dipteran larvae. Previously, we discovered that a peptide of a toxin-binding cadherin expressed in Escherichia coli functions as a synergist for Cry1A toxicity against lepidopteran larvae and Cry4 toxicity against dipteran larvae. Here we report that the fragment containing the three most C-terminal cadherin repeats (CR) from the cadherin of the western corn rootworm binds toxin and enhances Cry3 toxicity to larvae of naturally susceptible species. The cadherin fragment (CR8 to CR10 [CR8-10]) of western corn rootworm Diabrotica virgifera virgifera was expressed in E. coli as an inclusion body. By an enzyme-linked immunosorbent microplate assay, we demonstrated that the CR8-10 peptide binds α-chymotrypsin-treated Cry3Aa and Cry3Bb toxins at high affinity (11.8 nM and 1.4 nM, respectively). Coleopteran larvae ingesting CR8-10 inclusions had increased susceptibility to Cry3Aa or Cry3Bb toxin. The Cry3 toxin-enhancing effect of CR8-10 was demonstrated for Colorado potato beetle Leptinotarsa decemlineata, southern corn rootworm Diabrotica undecimpunctata howardi, and western corn rootworm. The extent of Cry3 toxin enhancement, which ranged from 3- to 13-fold, may have practical applications for insect control. Cry3-containing biopesticides that include a cadherin fragment could be more efficacious. And Bt corn (i.e., corn treated with B. thuringiensis to make it resistant to pests) coexpressing Cry3Bb and CR8-10 could increase the functional dose level of the insect toxic activity, reducing the overall resistance risk.The Cry3 class of Bacillus thuringiensis Cry proteins is known for toxicity to coleopteran larvae in the family Chrysomelidae. Cry3Aa and Cry3Bb proteins are highly toxic to Colorado potato beetle (CPB) Leptinotarsa decemlineata (Coleoptera: Chrysomelidae), and both were used for the development of Bt crops (crops treated with B. thuringiensis to make them resistant to pests) and Bt biopesticides. Due to the limited efficacy of Cry3-based biopesticides/plants and the success of competing chemical pesticides, these biopesticides have had limited usage and sales (12). Cry3Bb is toxic to corn rootworms (8, 17), and a modified version is expressed in commercialized MON863 corn hybrids (26).Cry3 toxins have a mode of action that is similar to, yet distinct from, the action of lepidopteran-active Cry1 toxins. The Cry3A protoxin (73 kDa) lacks the large C-terminal region of the 130-kDa Cry1 protoxins, which is removed by proteases during activation to toxin. The Cry3A protoxin is activated to a 55-kDa toxin and then further cleaved within the toxin molecule (5, 18). Activated Cry3A toxin binds to brush border membrane vesicles with a Kd (dissociation constant) of ∼37 nM (19) and recognizes a 144-kDa binding protein in brush border membrane vesicles prepared from the yellow mealworm Tenebrio molitor (Coleoptera: Tenebrionidae) (2). Recently, Ochoa-Campuzano et al. (20) identified an ADAM metalloprotease as a receptor for Cry3Aa toxin in CPB larvae.Structural differences between Cry3Bb and Cry3Aa toxins must underlie the unique rootworm activities of Cry3Bb toxin. As noted by Galitsky et al. (11), differences in toxin solubility, oligomerization, and binding are reported for these Cry3 toxins. Recently, Cry3Aa was modified to have activity against western corn rootworm (WCRW) Diabrotica virgifera virgifera (Coleoptera: Chrysomelidae) (27). Those authors introduced a chymotrypsin/cathepsin G cleavage site into domain 1 of Cry3Aa that allowed the processing of the 65-kDa form to a 55-kDa toxin that bound rootworm midgut.Cadherins function as receptors for Cry toxins in lepidopteran and dipteran larvae. A critical Cry1 toxin binding site is localized within the final cadherin repeat (CR), CR12, of cadherins from tobacco hornworm Manduca sexta (Lepidoptera: Sphingidae) and tobacco budworm Heliothis virescens (Lepidoptera: Noctuidae) (14, 28). Unexpectedly, a fragment of B. thuringiensis R1 cadherin, the Cry1A receptor from M. sexta, not only bound toxin but enhanced Cry1A toxicity against lepidopteran larvae (6). If the binding residues within CR12 were removed, the resulting peptide lost the ability to bind toxin and lost its function as a toxin synergist. Recently, we identified a cadherin from mosquito Anopheles gambiae (Diptera: Culicidae) that binds Cry4Ba toxin and probably functions as a receptor. We discovered a similar effect where a fragment of a cadherin from A. gambiae enhanced the toxicity of the mosquitocidal toxin Cry4Ba to mosquito larvae (15). Sayed et al. (22) identified a novel cadherin-like gene in WCRW and proposed this protein as a candidate Bt toxin receptor. The cadherin-like gene is highly expressed in the midgut tissue of larval stages. The encoded protein is conserved in structure relative to that of other insect midgut cadherins.In this study, we hypothesized that a fragment from a beetle cadherin that contains a putative Bt toxin binding region might enhance the insecticidal toxicities of Cry3Aa and Cry3Bb toxins. The region spanning CR8 to CR10 (CR8-10) of the WCRW cadherin (22) was cloned and expressed in E. coli. This cadherin fragment significantly enhanced the toxicities of Cry3Aa and Cry3Bb toxins to CPB and rootworms.  相似文献   

15.
16.
17.
18.
Rotaviruses, the single most important agents of acute severe gastroenteritis in children, are nonenveloped viruses formed by a three-layered capsid that encloses a genome formed by 11 segments of double-stranded RNA. The mechanism of entry of these viruses into the host cell is not well understood. The best-studied strain, RRV, which is sensitive to neuraminidase (NA) treatment of the cells, uses integrins α2β1 and αvβ3 and the heat shock protein hsc70 as receptors and enters MA104 cells through a non-clathrin-, non-caveolin-mediated pathway that depends on a functional dynamin and on the presence of cholesterol on the cell surface. In this work, using a combination of pharmacological, biochemical, and genetic approaches, we compared the entry characteristics of four rotavirus strains known to have different receptor requirements. We chose four rotavirus strains that represent all phenotypic combinations of NA resistance or sensitivity and integrin dependence or independence. We found that even though all the strains share their requirements for hsc70, dynamin, and cholesterol, three of them differ from the simian strain RRV in the endocytic pathway used. The human strain Wa, porcine strain TFR-41, and bovine strain UK seem to enter the cell through clathrin-mediated endocytosis, since treatments that inhibit this pathway block their infectivity; consistent with this entry route, these strains were sensitive to changes in the endosomal pH. The inhibition of other endocytic mechanisms, such as macropinocytosis or caveola-mediated uptake, had no effect on the internalization of the rotavirus strains tested here.Endocytosis is a cellular process that involves the formation of a vesicle whose cargo is transported from the extracellular milieu to the interior of the cell. Several endocytic pathways have been described, and all of them have been shown to be used by viruses during cell entry. These pathways include clathrin-mediated endocytosis, uptake via caveolae, macropinocytosis, phagocytosis, and a novel non-clathrin-, non-caveola-mediated pathway that is currently not well characterized (32). While detailed information about the entry of several enveloped viruses is now available (4, 35, 49, 53, 56), the mechanism by which nonenveloped viruses enter cells is not well understood. Two general mechanisms have been proposed to be used by these viruses to reach the cell''s cytoplasm: direct penetration at the cell surface, during which the viral particles are directly translocated from the external milieu into the cytoplasm, or internalization through endocytic processes (55).Rotaviruses, members of the family Reoviridae, are the leading etiologic agent of viral gastroenteritis in infants and young children worldwide, being responsible for an estimated 500,000 deaths each year (41). These nonenveloped viruses are formed by three concentric layers of protein that surround the viral genome, formed by 11 segments of double-stranded RNA. The outermost layer of the virion is formed by two proteins, VP4 and VP7, which are involved in the early interactions of the virus with its host cell (7, 27). VP4 is involved in receptor binding and cell penetration. The role of VP7 is less clear, although it has been shown that it interacts with the cell surface molecules at a postattachment step (17). After binding to the cell surface, the virus penetrates the plasma membrane to productively infect the cell. This penetration depends on the trypsin treatment of the virus, which results in the specific cleavage of VP4 to polypeptides VP8 and VP5. This cleavage promotes VP4 rearrangements in the viral particles that rigidify the spikes (7, 11).Despite the fact that, in vivo, rotaviruses primarily infect the mature enterocytes of the small intestine, studies of the infection of this type of cells have been limited due to the lack of established intestinal cell lines of small intestine origin. Given the absence of a better model, most of the studies on the entry and replication cycle of rotavirus have been conducted either in the epithelial monkey kidney cell line MA104 or in the human colon carcinoma cell line Caco-2, which are highly permissible to these viruses.Using as a model MA104 cells and the simian rotavirus RRV, we have proposed that rotavirus cell entry is a complex multistep process that involves the two virus surface proteins and several cell receptors, including sialic acids, gangliosides, integrins α2β1, α4β1, αvβ3, and αxβ2, and the heat shock cognate protein hsc70 (22). We have also shown that depletion of cholesterol from the cellular membrane severely impairs the infectivity of rotavirus (19, 50) and have suggested that sphingolipid- and cholesterol-enriched membrane lipid microdomains might be involved in rotavirus cell entry, since the virus and its receptors associate with these domains at early times during infection (23). However, there are some rotavirus strains that may not use all these molecules; some rotavirus strains are resistant to the neuraminidase (NA) treatment of the cell, and thus, they have been classified as NA resistant (6, 34). Additionally, the infectivity of some viral strains is not blocked by anti-integrin antibodies, suggesting the existence of rotavirus strains that are integrin independent (Table (Table1)1) (17).

TABLE 1.

Cellular receptor requirements of different rotavirus strains
StrainOriginNeuraminidase sensitivityIntegrin dependentReferences
RRVSimianYesYes5, 6, 17
TFR-41PorcineYesNo6, 17
UKBovineNoNo6, 17
WaHumanNoYes5, 17, 34
Open in a separate windowThe precise mechanism utilized by rotavirus to enter the cell is, however, not yet defined. Recently, we reported that the entry of the simian rotavirus strain RRV is independent of clathrin- and caveola-mediated endocytosis; however, it is dependent on dynamin (a protein involved in the scission of the endocytic vesicles from the cellular membrane) and requires the presence of cholesterol in the cell membrane (50). In this work, using a combination of pharmacological, biochemical, and genetic approaches, we compared the entry characteristics of four rotavirus strains known to have different receptor requirements. We found that all the strains tested share the requirement for hsc70, cholesterol, and dynamin. Unexpectedly, we found that there were differences in the type of endocytic route utilized by three of the strains compared to that of simian strain RRV. Bovine strain UK, porcine strain TFR-41, and human strain Wa more likely enter the cell through a clathrin-dependent mechanism, since treatments that inhibit this process block the infectivity of these rotavirus strains; in contrast, the entry of RRV, as previously shown (50), is independent of this pathway. The inhibition of other endocytic mechanisms, such as macropinocytosis or caveola-mediated uptake, had no effect on the entry of the rotavirus strains tested here.  相似文献   

19.
20.
A 30-probe assay was developed for simultaneous classification of Listeria monocytogenes isolates by lineage (I to IV), major serogroup (4b, 1/2b, 1/2a, and 1/2c), and epidemic clone (EC) type (ECI, ECIa, ECII, and ECIII). The assay was designed to facilitate rapid strain characterization and the integration of subtype data into risk-based inspection programs.Listeria monocytogenes is a facultative intracellular pathogen that can cause serious invasive illness (listeriosis) in humans and other animals. L. monocytogenes is responsible for over 25% of food-borne-disease-related deaths attributable to known pathogens and is a leading cause of food recalls due to microbial adulteration (12, 21). However, not all L. monocytogenes subtypes contribute equally to human illness, and substantial differences in the ecologies and virulence attributes of different L. monocytogenes subtypes have been identified (9, 13, 14, 23, 24, 33, 35, 36). Among the four major evolutionary lineages of L. monocytogenes, only lineages I and II are commonly isolated from contaminated food and human listeriosis patients (19, 27, 29, 33). Lineage I strains are overrepresented among human listeriosis isolates, particularly those associated with epidemic outbreaks, whereas lineage II strains are overrepresented in foods and the environment (13, 14, 24). Lineage III strains account for approximately 1% of human listeriosis cases but are common among animal listeriosis isolates and appear to be a host-adapted group that is poorly adapted to food-processing environments (6, 34-36). The ecological and virulence attributes of lineage IV are poorly understood, as this lineage is rare and was only recently described based on a small number of strains (19, 26, 29, 33).L. monocytogenes is differentiated into 13 serotypes; however, four major serogroups (4b, 1/2b, 1/2a, and 1/2c) from within lineages I and II account for more than 98% of human and food isolates (16, 31). Serogroups refer to evolutionary complexes typified by a predominant serotype but which include very rare serotypes that represent minor evolutionary variants (7, 9, 33). Phylogenetic analyses have indicated that rare serotypes may have evolved recently, or even multiple times, from one of the major serotypes (9), and numerous molecular methods fail to discriminate minor serotypes as independent groups (1, 4, 7, 9, 18, 22, 33, 38, 39). Serotyping is one of the most common methods for L. monocytogenes subtyping, and serogroup classifications are a useful component of strain characterization because ecotype divisions appear largely congruent with serogroup distinctions (16, 34). Serogroup 4b strains are of particular public health concern because contamination with these strains appears to increase the probability that a ready-to-eat (RTE) food will be implicated in listeriosis (16, 28). Serogroup 4b strains account for approximately 40% of sporadic listeriosis and also are responsible for the majority of listeriosis outbreaks despite being relatively rare contaminants of food products (9, 13, 17, 30, 34). In addition, serogroup 4b strains are associated with more severe clinical presentations and higher mortality rates than other serogroups (11, 16, 20, 31, 34). Serogroups 1/2a and 1/2b are overrepresented among food isolates but also contribute significantly to human listeriosis, whereas serogroup 1/2c rarely causes human illness and may pose a lower risk of listeriosis for humans (16). Serogroup-specific differences in association with human listeriosis are consistent with the prevalence of virulence-attenuating mutations in inlA within these serogroups (32, 34); however, a number of additional factors likely contribute to these differences.Four previously described epidemic clones (ECs; ECI, ECIa, ECII, and ECIII) of L. monocytogenes have been implicated in numerous listeriosis outbreaks and have contributed significantly to sporadic illness (15, 34). ECI, ECIa, and ECII are distinct groups within serogroup 4b that were each responsible for repeated outbreaks of listeriosis in the United States and Europe. ECIII is a lineage II clone of serotype 1/2a that persisted in the same processing facility for more than a decade prior to causing a multistate outbreak linked to contaminated turkey (15, 25). While there has been speculation that epidemic clones possess unique adaptations that explain their frequent involvement in listeriosis outbreaks (9, 34, 37), it is not clear that epidemic clones are more virulent than other strains with the same serotype. However, contamination of RTE food with EC strains would be cause for increased concern due to the previous involvement of these clones in major outbreaks of listeriosis (16).As a result of the L. monocytogenes subtype-specific differences in ecology, virulence, and association with human illness, molecular subtyping technologies have the potential to inform assessments of relative risk and to improve risk-based inspection programs. The objective of the present study was to develop a single assay for rapid and accurate classification of L. monocytogenes isolates by lineage, major serogroup, and epidemic clone in order to facilitate strain characterization and the integration of subtype data into inspection programs that are based on assessment of relative risk.A database of more than 5.3 Mb of comparative DNA sequences from 238 L. monocytogenes isolates (9, 33-35) was scanned for single nucleotide polymorphisms that could be used to differentiate lineages, major serogroups, and epidemic clones via a targeted multilocus genotyping (TMLGT) approach. The acronym TMLGT is used to distinguish this approach from previously published multilocus genotyping (MLGT) assays that were lineage specific and designed for haplotype discrimination (9, 33). To provide for simultaneous interrogation of the selected polymorphisms via TMLGT, six genomic regions (Table (Table1)1) were coamplified in a multiplex PCR. While the previous MLGT assays were based on three lineage-specific multiplexes and required prior identification of lineage identity, TMLGT was designed to target variation across all of the lineages simultaneously and is based on a unique set of amplicons. PCR was performed in 50-μl volumes with 1× High Fidelity PCR buffer (Invitrogen Life Technologies), 2 mM MgSO4, 100 μM deoxynucleoside triphosphate (dNTP), 300 nM primer, 1.5 U Platinum Taq high-fidelity DNA polymerase (Invitrogen Life Technologies), and 100 ng of genomic DNA. PCR consisted of an initial denaturation of 90 s at 96°C, followed by 40 cycles of 30 s at 94°C, 30 s at 50°C, and 90 s at 68°C. Amplification products were purified using Montage PCR cleanup filter plates (Millipore) and served as a template for allele-specific primer extension (ASPE) reactions utilizing subtype-specific probes.

TABLE 1.

Primers used in multiplex amplification for the TMLGT assay
AmpliconPositionaGene(s)PrimerSequence (5′-3′)b
INLa455381-456505inlAinl2-a1GTCCTTGATAGTCTACTG
inl2-a2ACCAAATTAGTAATCTAGCAC
INLb457726-458752inlBinl-f1dGAATTRTTTAGYCAAGAATGT
inlb-rCTACCGGRACTTTATAGTAYG
LMO325116-326096lmo0298-lmo0300lmo-a1AAGGCTTACAAGATGGCT
lmo1a-1rAAATAATAYGTGATACCGAC
VGCa205366-206622plcA, hlyplca-fCTCATCGTATCRTGTGTACC
hly-rTCTGGAAGGTCKTGTAGGTTC
VGCb208447-209465mplra_mpl-fGTGGAYAGAACTCATAAAGG
ra_mpl-rACTCCCTCCTYGTGATASGCT
VGCc209728-211239actAvgc1a-2fTTCMATRCCAGCAGAACG
vgc1a-2rGCAGACCTAATAGCAATGTTG
Open in a separate windowaCorresponding nucleotide positions in the complete genome sequence of L. monocytogenes strain EGD-e (GenBank accession number NC_003210).bSee IUPAC codes for definition of degenerate bases.ASPE was performed in multiplex reactions including 30 probes, with each lineage (I to IV), major serogroup (4b, 1/2b, 1/2a, and 1/2c), and epidemic clone (ECI, ECIa, ECII, and ECIII) targeted by two different probes (Table (Table2).2). In addition, positive-control probes were included to confirm the presence of each amplicon in the multiplex PCR. As serogroups and epidemic clones are nested within a particular lineage, probes for these groups were designed to be specific within the appropriate lineage and values for these probes were evaluated only for isolates of the appropriate lineage. For example, serogroup 1/2a probes were evaluated only for isolates that were positive for lineage II probes. ASPE probes were designed with a unique 5′ sequence tag specific to individual sets of xMAP fluorescent polystyrene microspheres (Luminex Corporation) used to sort extension products. Extension and hybridization reactions were performed as described previously (9) except microspheres were twice pelleted by centrifugation (4 min at 2,250 × g) and resuspended in 75 μl 1× TM buffer prior to being pelleted and resuspended in 100 μl 1× TM buffer containing 2 μg/ml streptavidin-R-phycoerythrin (Invitrogen Life Technologies). Samples were incubated for 15 min at 37°C prior to detecting the microsphere complexes with a Luminex 100 flow cytometer (Luminex Corporation). The median fluorescence intensity (MFI) from biotinylated extension products attached to 100 microspheres was measured for each probe. The average MFI from three template-free control samples was also determined and subtracted from the raw MFI of each sample to account for background fluorescence. Probe performance was initially evaluated via the index of discrimination (ID) as described by Ducey et al. (9), and probes with ID values less than 2.0 were redesigned.

TABLE 2.

TMLGT probes and probe performance data
ProbebTarget (n)cProbe sequencedIDeSensitivity (%)Specificity (%)
VGCb-21Lineage I (506)AATCCTTTCTTTAATCTCAAATCAgcggaagcttgggaagcggtc7.3100100
VGCa-94Lineage ICTTTCTATCTTTCTACTCAATAATcaacccgatgttcttcctgtc51.7100100
VGCc-8Lineage II (340)AATCCTTTTACATTCATTACTTACattagctgattcgctttcct14.1100100
INLb-51Lineage IITCATTTCAATCAATCATCAACAATagcgccaataaagctggc21.9100100
VGCb-19Lineage III (50)TCAATCAATTACTTACTCAAATACccgctattaaaatgtactcca31.0100100
VGCb-29Lineage IIIAATCTTACTACAAATCCTTTCTTTggtataccgctattaaaatgt45.1100100
LMO-17Lineage IV (10)CTTTAATCCTTTATCACTTTATCAgaaccaaacaatgttattggt11.8100100
VGCa-27Lineage IVCTTTTCAAATCAATACTCAACTTTttaacgacggtaacgtgccac58.3100100
INLb-84Serogroup 4b (213)TCAACTAACTAATCATCTATCAATggtaaaaatatgcgaatattg9.7100100
INLb-85Serogroup 4bATACTACATCATAATCAAACATCActcgtgaacaagctttcc5.5100100
INLb-16Serogroup 1/2b (293)AATCAATCTTCATTCAAATCATCAggtaaaaatatgcgtatctta11.7100100
INLb-100Serogroup 1/2bCTATCTTTAAACTACAAATCTAACgtgaataagctatcggtctat13.0100100
LMO-42Serogroup 1/2a (268)CTATCTTCATATTTCACTATAAACtggcgttgctgrctaagtttg6.6100100
VGCb-40Serogroup 1/2aCTTTCTACATTATTCACAACATTAaatcaagcsgctcatatgaag10.410098.6
LMO-9Serogroup 1/2c (72)TAATCTTCTATATCAACATCTTACtttactggtgaaatggcg13.5100100
VGCb-5Serogroup 1/2cCAATTCAAATCACAATAATCAATCaagattacgaatcgcttccac20.898.6100
LMO-10ECI (111)ATCATACATACATACAAATCTACAatgattaaaagtcagggaaag19.0100100
LMO-28ECICTACAAACAAACAAACATTATCAAaatcgaggcttacgaacgt23.7100100
VGCc-80ECIa (44)CTAACTAACAATAATCTAACTAACactacaacgaaaacagcgc10.7100100
VGCa-35ECIaCAATTTCATCATTCATTCATTTCAgttacttttatgtcgagt9.2100100
LMO-12ECII (35)TACACTTTCTTTCTTTCTTTCTTTataccgattatttggacggtt3.8100100
LMO-30ECIITTACCTTTATACCTTTCTTTTTACgacttgtagcagttgatttcaa7.5100100
VGCc-45ECIII (10)TCATTTCACAATTCAATTACTCAActcttatttgcttttgttggtc21.110099.4
INLa-3ECIIITACACTTTATCAAATCTTACAATCgagcttaatgaaaatcagcta17.010099.4
INLa-1INLa controlCTTTAATCTCAATCAATACAAATCagaagtggaagctgggaaNAaNANA
INLb-13INLb controlCAATAAACTATACTTCTTCACTAAtgcacctaaacctccgacNANANA
LMO-88LMO controlTTACTTCACTTTCTATTTACAATCccgtttccttatgccacaNANANA
VGCa-23VGCa controlTTCAATCATTCAAATCTCAACTTTcaagycctaagacgccaatcgNANANA
VGCb-25VGCb controlCTTTTCAATTACTTCAAATCTTCAgcatgcgttagttcatgrccaNANANA
VGCc-82VGCc controlTACATACACTAATAACATACTCATgactgcatgctagaatctaagNANANA
Open in a separate windowaNA, not applicable for positive amplicon control probes.bLuminex microsphere sets (Luminex Corporation) used for hybridization reactions are indicated following the hyphen.cn, number of isolates representing the target subtype among the 906 tested isolates.dThe 5′ sequence tag portions of extension probes are capitalized. See IUPAC codes for definitions of degenerate bases.eID, index of discrimination.Validation of the TMLGT assay was performed using 906 L. monocytogenes isolates for which the lineage, major serogroup, and epidemic clone type had been determined independently (see Table S1 in the supplemental material). A subset of 92 isolates, including at least five isolates from each lineage, serogroup, and epidemic clone type, was used to evaluate the discriminatory power of subtype-specific probes and the repeatability of the assay (see Table S1). Two independent runs of the 30-probe TMLGT assay produced identical results for these 92 isolates. In addition, genotypes matched expectations for all isolate/probe combinations, and the fluorescence intensities for positive genotypes (those targeted by a particular probe) were 3.8 to 58.3 (mean, 18.5) times as high as background values for isolates with negative genotypes (those not targeted by a particular probe) (Table (Table2).2). The performances of individual probes also were assessed in terms of sensitivity and specificity, where sensitivity is defined as the percentage of positive samples that produced positive results and specificity indicates the percentage of negative samples that produce negative results (5). Based on results from all 906 isolates analyzed by TMLGT, probe sensitivity was at least 98.6% and 23 of the 24 subtype-specific probes exhibited 100% sensitivity (Table (Table2).2). The specificities for all probes were also greater than 98.6%, and 21 of the 24 subtype-specific probes exhibited 100% specificity (Table (Table22).All but three of the 906 isolates in the validation panel were fully and accurately typed relative to lineage, serogroup, and epidemic clone by using the TMLGT assay (typeability, 99.9%; accuracy of isolate assignment, 99.8%). One of the lineage II isolates, NRRL B-33880, could not be assigned to a serogroup based on the TMLGT results because this isolate was positive for one of the serogroup 1/2a probes (VGCb-40) and one of the serogroup 1/2c probes (LMO-9). This isolate was previously identified as a member of serogroup 1/2c based on mapping lineage-specific MLGT data onto a multilocus phylogeny (34) but produced a serogroup 1/2a-specific banding pattern (data not shown) with the multiplex PCR assay described by Doumith et al. (7). Similar strains, including the common laboratory strain EGD-e, were found to have genomes that are more similar to serogroup 1/2c strains than to strains from the 1/2a serogroup (8, 33) and likely represent intermediates in the evolution of the 1/2c clade from 1/2a ancestors. There is a poor correlation between genomic and antigenic variation for such isolates (34), consistent with the ambiguous results produced by application of the TMLGT assay to NRRL B-33880. The two other problematic isolates, NRRL B-33555 and NRRL B-33559, were accurately identified based on TMLGT data as lineage II isolates from the 1/2a serogroup. However, these two isolates were positive for both ECIII-specific probes in the TMLGT assay but have lineage-specific MLGT haplotypes (Lm2.46), indicating that they are representatives of a sister group closely related to ECIII (33).In 2005, the Food Safety and Inspection Service (FSIS) implemented an approach to inspection that includes consideration of relative risk in order to determine L. monocytogenes sampling frequency among establishments that produce certain RTE products. This approach incorporates information on production volume, outgrowth potential in the product, steps taken to prevent postlethality contamination, and FSIS sampling history. However, L. monocytogenes subtype-specific variation in ecology and virulence indicates that information on the lineage, major serogroup, and epidemic clone identities of isolates could be used to inform assessments of relative risk and to improve inspection programs that are based on consideration of risk. Several PCR-based methods have been described for differentiation of various combinations of these subgroups (1-3, 5, 7, 10, 35, 37); however, these approaches have focused on a single subgroup or a smaller set of subgroups than is differentiated by TMLGT analysis. Although we previously developed a set of three MLGT assays that can be used to differentiate all of the major serogroups and epidemic clones of L. monocytogenes (9, 33, 34), those assays did not include probes for lineage discrimination and require identification of the lineage prior to application of one of three unique sets of probes. In addition, the MLGT assays were designed to maximize strain discrimination, as opposed to subgroup identification, and require the use of at least twice as many probes as is needed for TMLGT analysis. MLGT data analysis is also more complicated than analysis of TMLGT data, and serogroup or epidemic clone type identification via MLGT requires phylogenetic analyses to place novel haplotypes within an established phylogenetic framework.In the present study, we developed the first assay for simultaneous discrimination of the four lineages, the four major serogroups, and the four previously described epidemic clones of L. monocytogenes. The assay includes multiple markers for each of these subtype probes as well as control probes to ensure that negative probe data were not the result of amplification failure, providing a high degree of internal validation required for use in inspection programs that consider risk in making sampling decisions. In addition, the utility of the assay has been validated with a large and diverse panel of 906 isolates, including 567 isolates from FSIS surveillance of RTE products and processing facilities (see Table S1 in the supplemental material). Data produced by the TMLGT assay are amenable to high-throughput analysis, and a simple spreadsheet utility has been developed to semiautomate subtype identifications and to alert investigators to potentially conflicting probe data (available upon request). In addition to having a potential application in inspection programs, the TMLGT assay provides a rapid and accurate means of characterizing L. monocytogenes isolates from different environments, which would facilitate pathogen tracking and improve understanding of L. monocytogenes ecology.   相似文献   

设为首页 | 免责声明 | 关于勤云 | 加入收藏

Copyright©北京勤云科技发展有限公司  京ICP备09084417号