共查询到20条相似文献,搜索用时 421 毫秒
2.
Presented here is the first report describing the detection of potentially diarrheal Vibrio parahaemolyticus strains isolated from cultured bivalves on the Mediterranean coast, providing data on the presence of both tdh- and trh-positive isolates. Potentially diarrheal V. parahaemolyticus strains were isolated from four species of bivalves collected from both bays of the Ebro delta, Spain.Gastroenteritis caused by Vibrio parahaemolyticus has been reported worldwide, though only sporadic cases have been reported in Europe ( 7, 14). The bacterium can be naturally present in seafood, but pathogenic isolates capable of inducing gastroenteritis in humans are rare in environmental samples (2 to 3%) ( 15) and are often not detected ( 10, 19, 20).The virulence of V. parahaemolyticus is based on the presence of a thermostable direct hemolysin ( tdh) and/or the thermostable direct hemolysin-related gene ( trh) ( 1, 5). Both are associated with gastrointestinal illnesses ( 2, 9).Spain is not only the second-largest producer in the world of live bivalve molluscs but also one of the largest consumers of bivalve molluscs, and Catalonia is the second-most important bivalve producer of the Spanish Autonomous Regions. Currently, the cultivation of bivalves in this area is concentrated in the delta region of the Ebro River. The risk of potentially pathogenic Vibrio spp. in products placed on the market is not assessed by existing legislative indices of food safety in the European Union, which emphasizes the need for a better knowledge of the prevalence of diarrheal vibrios in seafood products. The aim of this study was to investigate the distribution and pathogenic potential of V. parahaemolyticus in bivalve species exploited in the bays of the Ebro delta.Thirty animals of each species of Mytilus galloprovincialis, Crassostrea gigas, Ruditapes decussatus, and Ruditapes philippinarum were collected. They were sampled from six sites of the culture area, three in each bay of the Ebro River delta, at the beginning (40°37′112"N, 0°37′092"E [Alfacs]; 40°46′723"N, 0°43′943"E [Fangar]), middle (40°37′125"N, 0°38′570"E [Alfacs]; 40°46′666"N, 0°45′855"E [Fangar]), and end (40°37′309"N, 0°39′934"E [Alfacs]; 40°46′338"N, 0°44′941"E [Fangar]) of the culture polygon. Clams were sampled from only one site per bay as follows: in the Alfacs Bay from a natural bed of R. decussatus (40°37′44"N, 0°38′0"E) and in the Fangar Bay from an aquaculture bed of R. philippinarum (40°47′3"N, 0°43′8"E). In total, 367 samples were analyzed in 2006 (180 oysters, 127 mussels, 30 carpet shell clams, and 30 Manila clams) and 417 samples were analyzed in 2008 (178 oysters, 179 mussels, 30 carpet shell clams, and 30 Manila clams).All animals were individually processed and homogenized, and 1 ml of the homogenate was inoculated into 9 ml of alkaline peptone water (Scharlau, Spain). Following a 6-h incubation at 37°C, one loopful of the contents of each tube of alkaline peptone water was streaked onto CHROMagar vibrio plates (CHROMagar, France) and incubated for 18 h at 37°C. Mauve-purple colonies were purified, and each purified isolate was cryopreserved at −80°C (135 isolates in 2006 and 96 in 2008). From the initial homogenate portion, 100 μl was inoculated onto marine agar (Scharlau, Spain) and onto thiosulfate citrate-bile salts-sucrose agar (Scharlau, Spain) for total heterotrophic marine bacteria counts and total vibrio counts, respectively (Table ). TABLE 1.Vibrio parahaemolyticus isolates, serotypes, and origins and total number of vibrios/heterotrophic bacteria contained in the bivalve aIsolate | Date of collection | Organism and site of origin | Temp (°C) | Salinity (‰) | Gene(s) | Serotype | Bacterial count using indicated medium (CFU ml−1)
|
---|
TCBS agar | Marine agar |
---|
I745 | 8 August 2006 | Mg-F | 24.5 | 37 | tdh | ND | 1.5 × 104 | 1.2 × 104 | I793 | 14 August 2006 | Cg-A | 25 | 35 | tdh | ND | 9.2 × 102 | 8.5 × 103 | I805 | 14 August 2006 | Cg-A | 25 | 35 | tdh | O2:KUT | 7.2 × 102 | 9 × 103 | I806 | 14 August 2006 | Cg-A | 25 | 35 | tdh and trh | O3:K33 | 1.9 × 103 | 4.6 × 103 | I809 | 14 August 2006 | Cg-A | 25 | 35 | tdh | O2:K28 | 8 × 104 | 7.3 × 102 | I678 | 4 July 2006 | Rd-A | 28.6 | 36 | tdh | O2:K28 | 3.1 × 105 | 2.5 × 105 | I628 | 4 July 2006 | Rd-A | 28.6 | 36 | tdh | O4:KUT | 2.9 × 104 | 8.4 × 104 | I775 | 8 August 2006 | Cg-A | 24.5 | 37 | tdh | ND | 4.21 × 103 | 1.1 × 104 | I691 | 4 July 2006 | Rd-A | 28.6 | 36 | trh | O1:K32 | 2.2 × 105 | 2.6 × 105 | I712 | 27 July 2006 | Mg-A | 29.4 | 35.5 | trh | O1:KUT | 8.6 × 103 | 8.4 × 103 | I765 | 8 August 2006 | Cg-F | 24.5 | 37 | trh | O4:K34 | 1 × 104 | Uncountable | I980 | 22 July 2008 | Cg-A | 26.7 | 33.5 | tdh | O1:K32 | 2.7 × 104 | 1.3 × 104 | I981 | 22 July 2008 | Cg-A | 26.7 | 33.5 | trh | O1:KUT | 1 × 104 | 2.2 × 104 | I993 | 22 July 2008 | Cg-A | 26.7 | 33.5 | tdh | O5:K17 | 3 × 103 | 1.1 × 104 | I994 | 29 July 2008 | Mg-A | 27.7 | 37 | trh | O3:KUT | 3.4 × 103 | 7 × 103 | I1031 | 5 August 2008 | Cg-F | 27.7 | 37 | tdh | O5:KUT | 5.5 × 104 | 3.3 × 104 | I1034 | 5 August 2008 | Cg-F | 27.7 | 37 | tdh | O3:KUT | 8.7 × 104 | 4 × 104 | I1040 | 5 August 2008 | Cg-F | 27.7 | 37 | tdh | O3:KUT | 1.6 × 104 | 3.2 × 104 | I1042 | 5 August 2008 | Cg-F | 27.7 | 37 | tdh and trh | ND | 2.8 ×104 | 3 × 104 | I1050 | 5 August 2008 | Cg-F | 27.7 | 37 | tdh | O1:KUT | 4.7 × 104 | 7.3 × 104 | I1063 | 20 August 2008 | Mg-F | 25.9 | 36 | tdh | O3:KUT | 7.9 ×104 | 1.4 × 104 | I1065 | 20 August 2008 | Mg-F | 25.9 | 36 | tdh | O2:KUT | 2.2 × 103 | 1.2 × 104 | I1068 | 20 August 2008 | Mg-F | 25.9 | 36 | tdh | O5:KUT | 2.6 × 104 | 5.2 × 104 | I1069 | 20 August 2008 | Mg-F | 25.9 | 36 | tdh | O3:KUT | 2.4 × 103 | 5.3 × 104 | I1073 | 20 August 2008 | Mg-F | 25.9 | 36 | tdh | O5:KUT | 2.3 × 103 | 7.5 × 103 | I1074 | 20 August 2008 | Mg-F | 25.9 | 36 | tdh | O3:KUT | 7.6 × 104 | 6.9 × 104 | I1077 | 20 August 2008 | Mg-F | 25.9 | 36 | tdh | O4:KUT | 1.7 × 103 | 1.6 × 103 | I1079 | 20 August 2008 | Mg-F | 25.9 | 36 | trh | O3:KUT | 2.5 × 103 | 1.1 × 104 | I1092 | 20 August 2008 | Mg-F | 25.9 | 36 | tdh | ND | 1.7 × 103 | 1.6 × 103 | I1130 | 25 August 2008 | Rd-A | 26.4 | 35 | tdh | ND | 1.7 × 104 | 3.8 × 104 | I1143 | 25 August 2008 | Rd-A | 26.4 | 35 | tdh | ND | 1.1 × 104 | 1.9 × 104 | I1165 | 25 August 2008 | Rd-A | 26.4 | 35 | trh | O2:KUT | 4.4 × 104 | 6.8 × 104 | I1133 | 25 August 2008 | Rp-F | 25.5 | 36.5 | tdh | ND | 3.4 × 104 | 4 × 104 | I1134 | 25 August 2008 | Rp-F | 25.5 | 36.5 | tdh | ND | 3.9 × 104 | 5.8 × 104 | I1158 | 25 August 2008 | Rp-F | 25.5 | 36.5 | trh | O4:KUT | 6.6 × 104 | 4.7 × 104 | I1161 | 25 August 2008 | Rp-F | 25.5 | 36.5 | trh | O3:KUT | 2.2 × 104 | 6.6 × 104 | Open in a separate windowaMg, Mytilus galloprovincialis; Cg, Crassostrea gigas; Rd, Ruditapes decussatus; Rp, R. phillipinarum; A, Alfacs; F, Fangar; ND, not determined; TCBS, thiosulfate citrate-bile salts-sucrose.Total DNA was extracted from each purified isolate using the Wizard genomic DNA purification kit (Promega), following the instructions of the manufacturer. A one-step PCR analysis was performed to identify/confirm which isolates were tl positive (species marker for V. parahaemolyticus). Further detection of the tdh or trh gene was carried out on all positive tl strains. All PCR analyses were carried out using the primers described by Bej et al. ( 2) with the following amplification conditions on the thermocycler (Eppendorf Mastercycler Personal): an initial denaturation at 95°C for 8 min, followed by 40 cycles of a 1-min denaturation at 94°C, annealing at 55°C for 1 min, elongation at 72° for 1 min, and a final extension of 10 min at 72°C. Positive and negative controls were included in all reaction mixtures: two positive controls, tl and tdh CAIM 1400 and trh CAIM 1772 (Collection of Aquatic Important Microorganisms [ http://www.ciad.mx/caim/CAIM.html]), and negative control DNA-free molecular grade water (Sigma-Aldrich, Spain). Expected amplicons were visualized in 2% agarose gels stained with ethidium bromide.Fifty-eight isolates contained the gene tl in 2006 and 96 in 2008, which confirmed their identity as V. parahaemolyticus. In 2006, the distribution of the 58 isolates was as follows: 7 from 127 mussels, 34 from 180 oysters, and 17 from 30 R. decussatus clams. No tl-positive isolates were found in R. philippinarum. PCR analysis of the tl-positive isolates for the presence of the tdh or trh gene indicated that eight isolates contained the tdh gene and four contained the trh gene. In 2008, the source of the confirmed V. parahaemolyticus isolates was as follows: 31 from 88 oysters, 44 from 89 mussels, 9 from 30 R. decussatus clams, and 12 from 30 R. philippinarum clams. Of these, 17 were found to contain the tdh gene and 7 contained the trh gene. Two isolates (I806 and I1042) contained both toxigenic genes, tdh and trh.Putative tdh- and trh-positive PCR products were purified using the QIAquick PCR purification kit (Qiagen) following the manufacturer''s instructions and were sequenced bidirectionally by Macrogen Inc. Sequences were aligned using BioEdit ( 8) and analyzed using BLAST (National Center for Biotechnology Information). None of the toxigenic isolates was found positive by PCR analysis for the presence of open reading frame 8 of the phage 237 ( 16), a marker for the pandemic strain O3:K6.The isolates were fingerprinted by repetitive extragenic palindromic PCR (rep-PCR) as described previously ( 3), and the resulting electrophoretic band patterns were analyzed with the GelCompar II software (v4.5; Applied Maths). The similarity matrix was calculated with the Jaccard coefficient with a band position tolerance of 0.8%, and the dendrogram was constructed with the Ward algorithm. A high level of genomic diversity was found among the 32 toxigenic isolates characterized by rep-PCR. Three clonal groups were identified (those having identical rep-PCR band patterns) (Fig. ). Open in a separate windowrep-PCR dendrogram of toxigenic isolates of V. parahaemolyticus isolated in the Ebro delta. Letters denote clonal groups of isolates.In vitro antibiotic susceptibility tests were performed using the diffusion disc test following a previously described protocol ( 18). The antibiotics used were gentamicin (10 μg), oxolinic acid (10 μg), amoxicillin (25 μg), polymyxin B (300 UI), vancomycin (30 μg), trimethoprim sulfamethoxazole (1.25/23.75 μg), nitrofurantoin (300 μg), doxycyclin (30 μg), ceftazidime (30 μg), streptomycin (10 μg), neomycin (30 UI), penicillin (6 μg), flumequine (30 μg), tetracycline (30 μg), ampicillin (10 μg), kanamycin (30 μg), ciprofloxacin (5 μg), and sulfonamide (300 μg). All tests were performed in duplicate. A Student t test for two samples with unequal variance was performed to compare the sensitivity of all 2006 isolates against the sensitivity of 2008 isolates for each antibiotic (Microsoft Office Excel 97-2003). Antibiogram results revealed a lower susceptibility in 2008 than in 2006, indicating a possible shift in overall susceptibility. Results from the t test indicated that significantly lower susceptibility in 2008 was detected ( P ≤ 0.05; n = 36) for the following antibiotics: vancomycin, polymyxin B, ampicillin, amoxicillin, gentamicin, neomycin, trimethoprim sulfamethoxazole, nitrofurantoin, doxycyclin, ceftazidime, tetracycline, flumequine, and ciprofloxacin.The serological types for 27 strains were determined by the agglutination method using commercially available V. parahaemolyticus antisera (Denka Seiken Ltd.; Cosmos Biomedical Ltd, United Kingdom) following the manufacturer''s instructions. Potentially toxigenic V. parahaemolyticus isolates collected in 2006 were serologically heterogeneous (8 out of the 11 isolates) (Table ). In isolates collected in 2008, results were more homogenous, with seven serotypes found among 19 isolates analyzed. The O3:K6 serotype was not detected in any of the strains analyzed, in agreement with the open reading frame 8 PCR results.The present study is the first to report the detection of potentially diarrheal V. parahaemolyticus strains isolated from cultured bivalves on Spanish Mediterranean coasts, providing data on the presence of both tdh- and trh-positive isolates. V. parahaemolyticus has previously been detected in several European countries ( 4, 13, 21, 22). A recent study carried out in Spain detected tdh-positive V. parahaemolyticus strains from patients who had consumed fresh oysters in a market in Galicia on the Atlantic coast of Spain ( 12) and potentially pathogenic V. parahaemolyticus strains have also been reported in France ( 17). These studies indicate that the risk of infections caused by V. parahaemolyticus in Europe is low compared to that in America or Asia ( 15). However, this risk could have been underestimated, since V. parahaemolyticus is not included in the current European surveillance programs, such as the European Network for Epidemiological Surveillance and Control of Communicable Diseases.Toxigenic V. parahaemolyticus strains detected in this study were genomically and serologically heterogeneous. The pandemic serotype O3:K6 was not detected, and although attempts to isolate O3:K6 from the environment and from seafood have not always been successful in previous studies reviewed by Nair and coauthors ( 15), this finding seems to be in agreement with the fact that no outbreak of diarrhea was observed in the area. Interestingly, isolates I806 and I1042 have been found positive for both tdh and trh in PCR tests. The coexistence of tdh and trh genes has already been reported in isolates from Japan, the United States, and Mexico ( 3, 6, 11, 19, 23). To our knowledge, no occurrence of an environmental isolate positive for both tdh and trh had previously been reported in Europe. All isolates tested were slightly different in their antibiotic resistance profiles. Typically, a high level of resistance could be determined. The detection of tdh- and/or trh-positive V. parahaemolyticus strains for the first time on the Mediterranean coast emphasizes the need to monitor for the presence of potentially diarrheal vibrios and bacterial gastroenteritis, and these data should be taken into consideration to revise the European legislation on the requirements for shellfish harvested for consumption in order to include the surveillance of these pathogens in Europe. 相似文献
3.
Riboflavin significantly enhanced the efficacy of simulated solar disinfection (SODIS) at 150 watts per square meter (W m −2) against a variety of microorganisms, including Escherichia coli, Fusarium solani, Candida albicans, and Acanthamoeba polyphaga trophozoites (>3 to 4 log 10 after 2 to 6 h; P < 0.001). With A. polyphaga cysts, the kill (3.5 log 10 after 6 h) was obtained only in the presence of riboflavin and 250 W m −2 irradiance.Solar disinfection (SODIS) is an established and proven technique for the generation of safer drinking water ( 11). Water is collected into transparent plastic polyethylene terephthalate (PET) bottles and placed in direct sunlight for 6 to 8 h prior to consumption ( 14). The application of SODIS has been shown to be a simple and cost-effective method for reducing the incidence of gastrointestinal infection in communities where potable water is not available ( 2- 4). Under laboratory conditions using simulated sunlight, SODIS has been shown to inactivate pathogenic bacteria, fungi, viruses, and protozoa ( 6, 12, 15). Although SODIS is not fully understood, it is believed to achieve microbial killing through a combination of DNA-damaging effects of ultraviolet (UV) radiation and thermal inactivation from solar heating ( 21).The combination of UVA radiation and riboflavin (vitamin B 2) has recently been reported to have therapeutic application in the treatment of bacterial and fungal ocular pathogens ( 13, 17) and has also been proposed as a method for decontaminating donor blood products prior to transfusion ( 1). In the present study, we report that the addition of riboflavin significantly enhances the disinfectant efficacy of simulated SODIS against bacterial, fungal, and protozoan pathogens.Chemicals and media were obtained from Sigma (Dorset, United Kingdom), Oxoid (Basingstoke, United Kingdom), and BD (Oxford, United Kingdom). Pseudomonas aeruginosa (ATCC 9027), Staphylococcus aureus (ATCC 6538), Bacillus subtilis (ATCC 6633), Candida albicans (ATCC 10231), and Fusarium solani (ATCC 36031) were obtained from ATCC (through LGC Standards, United Kingdom). Escherichia coli (JM101) was obtained in house, and the Legionella pneumophila strain used was a recent environmental isolate. B. subtilis spores were produced from culture on a previously published defined sporulation medium ( 19). L. pneumophila was grown on buffered charcoal-yeast extract agar ( 5). All other bacteria were cultured on tryptone soy agar, and C. albicans was cultured on Sabouraud dextrose agar as described previously ( 9). Fusarium solani was cultured on potato dextrose agar, and conidia were prepared as reported previously ( 7). Acanthamoeba polyphaga (Ros) was isolated from an unpublished keratitis case at Moorfields Eye Hospital, London, United Kingdom, in 1991. Trophozoites were maintained and cysts prepared as described previously ( 8, 18).Assays were conducted in transparent 12-well tissue culture microtiter plates with UV-transparent lids (Helena Biosciences, United Kingdom). Test organisms (1 × 10 6/ml) were suspended in 3 ml of one-quarter-strength Ringer''s solution or natural freshwater (as pretreated water from a reservoir in United Kingdom) with or without riboflavin (250 μM). The plates were exposed to simulated sunlight at an optical output irradiance of 150 watts per square meter (W m −2) delivered from an HPR125 W quartz mercury arc lamp (Philips, Guildford, United Kingdom). Optical irradiances were measured using a calibrated broadband optical power meter (Melles Griot, Netherlands). Test plates were maintained at 30°C by partial submersion in a water bath.At timed intervals for bacteria and fungi, the aliquots were plated out by using a WASP spiral plater and colonies subsequently counted by using a ProtoCOL automated colony counter (Don Whitley, West Yorkshire, United Kingdom). Acanthamoeba trophozoite and cyst viabilities were determined as described previously ( 6). Statistical analysis was performed using a one-way analysis of variance (ANOVA) of data from triplicate experiments via the InStat statistical software package (GraphPad, La Jolla, CA).The efficacies of simulated sunlight at an optical output irradiance of 150 W m −2 alone (SODIS) and in the presence of 250 μM riboflavin (SODIS-R) against the test organisms are shown in Table . With the exception of B. subtilis spores and A. polyphaga cysts, SODIS-R resulted in a significant increase in microbial killing compared to SODIS alone ( P < 0.001). In most instances, SODIS-R achieved total inactivation by 2 h, compared to 6 h for SODIS alone (Table ). For F. solani, C. albicans, ands A. polyphaga trophozoites, only SODIS-R achieved a complete organism kill after 4 to 6 h ( P < 0.001). All control experiments in which the experiments were protected from the light source showed no reduction in organism viability over the time course (results not shown). TABLE 1.Efficacies of simulated SODIS for 6 h alone and with 250 μM riboflavin (SODIS-R) Organism | Conditiona | Log10 reduction in viability at indicated h of exposureb
|
---|
1 | 2 | 4 | 6 |
---|
E. coli | SODIS | 0.0 ± 0.0 | 0.2 ± 0.1 | 5.7 ± 0.0 | 5.7 ± 0.0 | | SODIS-R | 1.1 ± 0.0 | 5.7 ± 0.0 | 5.7 ± 0.0 | 5.7 ± 0.0 | L. pneumophila | SODIS | 0.7 ± 0.2 | 1.3 ± 0.3 | 4.8 ± 0.2 | 4.8 ± 0.2 | | SODIS-R | 4.4 ± 0.0 | 4.4 ± 0.0 | 4.4 ± 0.0 | 4.4 ± 0.0 | P. aeruginosa | SODIS | 0.7 ± 0.0 | 1.8 ± 0.0 | 4.9 ± 0.0 | 4.9 ± 0.0 | | SODIS-R | 5.0 ± 0.0 | 5.0 ± 0.0 | 5.0 ± 0.0 | 5.0 ± 0.0 | S. aureus | SODIS | 0.0 ± 0.0 | 0.0 ± 0.0 | 6.2 ± 0.0 | 6.2 ± 0.0 | | SODIS-R | 0.2 ± 0.1 | 6.3 ± 0.0 | 6.3 ± 0.0 | 6.3 ± 0.0 | C. albicans | SODIS | 0.2 ± 0.0 | 0.4 ± 0.1 | 0.5 ± 0.1 | 1.0 ± 0.1 | | SODIS-R | 0.1 ± 0.0 | 0.7 ± 0.1 | 5.3 ± 0.0 | 5.3 ± 0.0 | F. solani conidia | SODIS | 0.2 ± 0.1 | 0.3 ± 0.0 | 0.2 ± 0.0 | 0.7 ± 0.1 | | SODIS-R | 0.3 ± 0.1 | 0.8 ± 0.1 | 1.3 ± 0.1 | 4.4 ± 0.0 | B. subtilis spores | SODIS | 0.3 ± 0.0 | 0.2 ± 0.0 | 0.0 ± 0.0 | 0.1 ± 0.0 | | SODIS-R | 0.1 ± 0.1 | 0.2 ± 0.1 | 0.3 ± 0.3 | 0.1 ± 0.0 | | SODIS (250 W m−2) | 0.1 ± 0.0 | 0.1 ± 0.1 | 0.1 ± 0.1 | 0.0 ± 0.0 | | SODIS-R (250 W m−2) | 0.0 ± 0.0 | 0.0 ± 0.0 | 0.2 ± 0.0 | 0.4 ± 0.0 | | SODIS (320 W m−2) | 0.1 ± 0.1 | 0.1 ± 0.0 | 0.0 ± 0.1 | 4.3 ± 0.0 | | SODIS-R (320 W m−2) | 0.1 ± 0.0 | 0.1 ± 0.1 | 0.9 ± 0.0 | 4.3 ± 0.0 | A. polyphaga trophozoites | SODIS | 0.4 ± 0.2 | 0.6 ± 0.1 | 0.6 ± 0.2 | 0.4 ± 0.1 | | SODIS-R | 0.3 ± 0.1 | 1.3 ± 0.1 | 2.3 ± 0.4 | 3.1 ± 0.2 | | SODIS, naturalc | 0.3 ± 0.1 | 0.4 ± 0.1 | 0.5 ± 0.2 | 0.3 ± 0.2 | | SODIS-R, naturalc | 0.2 ± 0.1 | 1.0 ± 0.2 | 2.2 ± 0.3 | 2.9 ± 0.3 | A. polyphaga cysts | SODIS | 0.4 ± 0.1 | 0.1 ± 0.3 | 0.3 ± 0.1 | 0.4 ± 0.2 | | SODIS-R | 0.4 ± 0.2 | 0.3 ± 0.2 | 0.5 ± 0.1 | 0.8 ± 0.3 | | SODIS (250 W m−2) | 0.0 ± 0.1 | 0.2 ± 0.3 | 0.2 ± 0.1 | 0.1 ± 0.2 | | SODIS-R (250 W m−2) | 0.4 ± 0.2 | 0.3 ± 0.2 | 0.8 ± 0.1 | 3.5 ± 0.3 | | SODIS (250 W m−2), naturalc | 0.0 ± 0.3 | 0.2 ± 0.1 | 0.1 ± 0.1 | 0.2 ± 0.1 | | SODIS-R (250 W m−2), naturalc | 0.1 ± 0.1 | 0.2 ± 0.2 | 0.6 ± 0.1 | 3.4 ± 0.2 | Open in a separate windowaConditions are at an intensity of 150 W m −2 unless otherwise indicated. bThe values reported are means ± standard errors of the means from triplicate experiments. cAdditional experiments for this condition were performed using natural freshwater.The highly resistant A. polyphaga cysts and B. subtilis spores were unaffected by SODIS or SODIS-R at an optical irradiance of 150 W m −2. However, a significant reduction in cyst viability was observed at 6 h when the optical irradiance was increased to 250 W m −2 for SODIS-R only ( P < 0.001; Table ). For spores, a kill was obtained only at 320 W m −2 after 6-h exposure, and no difference between SODIS and SODIS-R was observed (Table ). Previously, we reported a >2-log kill at 6 h for Acanthamoeba cysts by using SODIS at the higher optical irradiance of 850 W m −2, compared to the 0.1-log 10 kill observed here using the lower intensity of 250 W m −2 or the 3.5-log 10 kill with SODIS-R.Inactivation experiments performed with Acanthamoeba cysts and trophozoites suspended in natural freshwater gave results comparable to those obtained with Ringer''s solution ( P > 0.05; Table ). However, it is acknowledged that the findings of this study are based on laboratory-grade water and freshwater and that differences in water quality through changes in turbidity, pH, and mineral composition may significantly affect the performance of SODIS ( 20). Accordingly, further studies are indicated to evaluate the enhanced efficacy of SODIS-R by using natural waters of varying composition in the areas where SODIS is to be employed.Previous studies with SODIS under laboratory conditions have employed lamps delivering an optical irradiance of 850 W m −2 to reflect typical natural sunlight conditions ( 6, 11, 12, 15, 16). Here, we used an optical irradiance of 150 to 320 W m −2 to obtain slower organism inactivation and, hence, determine the potential enhancing effect of riboflavin on SODIS.In conclusion, this study has shown that the addition of riboflavin significantly enhances the efficacy of simulated SODIS against a range of microorganisms. The precise mechanism by which photoactivated riboflavin enhances antimicrobial activity is unknown, but studies have indicated that the process may be due, in part, to the generation of singlet oxygen, H 2O 2, superoxide, and hydroxyl free radicals ( 10). Further studies are warranted to assess the potential benefits from riboflavin-enhanced SODIS in reducing the incidence of gastrointestinal infection in communities where potable water is not available. 相似文献
4.
The transfer range of phage genes was investigated at the single-cell level by using an in situ DNA amplification technique. After absorption of phages, a phage T4 gene was maintained in the genomes of non-plaque-forming bacteria at frequencies of 10 −2 gene copies per cell. The gene transfer decreased the mutation frequencies in nonhost recipients.Recently, whole-genome analyses have revealed that many bacterial genomes contain foreign genes, especially phage genes ( 9). The phage genes in bacterial genomes include genes for virulence or fitness factors such as extracellular toxins, superantigens, lipopolysaccharide-modifying enzymes, and proteins conferring serum resistance, etc. ( 1). These findings suggest that the horizontal transfer of phage genes has contributed significantly to the acquisition of new genetic traits and to the genetic diversity of bacteria ( 1, 9, 10). To truly appreciate the mechanisms behind phage-associated evolution, it is important to understand the frequency and range of transfer of phage genes.Most phage genomes consist of many genes derived from different origins ( 5, 8). Some genes are similar to those of other phages with phylogenetically different hosts or are found in the genomes of bacteria that are not the phage hosts. The mosaic nature of phage genomes has been known for some time, and a body of molecular genetic studies of phages to explain the mechanisms that drive this feature have been attempted previously ( 1, 5). More importantly, the horizontal transfer of phage genes has emerged as a major factor in the evolution of the phage genome. Since recombination between phage and phage/prophage can occur when these elements coexist in the same cell, coinfection with multiple phage species may result in the production of hybrid phage genomes ( 5). The pathways by which phages exchange genetic material vary dramatically in concert with host ranges. However, conventional plaque assays have shown that the host ranges of the phages studied are narrow. We hypothesized that phage genes can be transferred to more diverse species than previously thought.In order to accurately quantify DNA movement, gene targeting that does not require cultivation or gene expression is necessary ( 7). In situ DNA amplification methods allow the visualization of specific DNA sequences inside bacterial cells. In this study, we employed cycling primed in situ amplification-fluorescent in situ hybridization (CPRINS-FISH) to examine the possible range and frequency of the transfer of phage genes. CPRINS uses one primer and results in linear amplification of the target DNA inside cells, and multiply labeled fluorescent probe sets are applied for detection of the amplicons to improve the specificity and sensitivity of CPRINS ( 3). Previously, CPRINS-FISH did clarify the movement of DNA of a specific gene among Escherichia coli cells at the single-cell level ( 4).Enterobacterial phages P1 and T4 infect E. coli and have been well studied. P1 can exist as circular DNA within the bacterial cell as if it were a plasmid. Phage T4 is capable of undergoing only a lytic life cycle and not the lysogenic life cycle. Conventional methods using plaque assays have shown that the host of P1 and T4 is E. coli, but orthologous phage genes have been found in bacteria other than E. coli ( 6, 8). In the present study, strains of Enterobacteriaceae were allowed to grow on agar medium after the phage was adsorbed, and the maintenance of the transferred phage gene in the bacterial genomes was examined at the community level by quantitative real-time PCR and at the single-cell level by CPRINS-FISH.The following bacterial strains were used for maintenance experiments: Citrobacter freundii IFO 12681, Enterobacter aerogenes BM 2688, E. coli NBRC 12713, a Proteus mirabilis clinical isolate, Salmonella enterica serovar Enteritidis IID 640, and Yersinia enterocolitica IID 981. The bacterial strains were grown in Luria-Bertani (LB) medium (1% tryptone, 0.5% yeast extract, 0.5% NaCl; Nacalai Tesque Inc., Kyoto, Japan) at 37°C overnight.Stationary-phase cultures of 500 μl were incubated with 500 μl of SM buffer (50 mmol liter −1 Tris-HCl [pH 7.5], 100 mmol liter −1 NaCl, 8 mmol liter −1 MgSO 4, 0.01% gelatin) containing the phage P1 kc NBRC 20008 ( 2) or T4GT7 ( 11) at 37°C for 10 min at a multiplicity of infection of 1:1 (ratio of PFU of the phage to CFU of the recipient bacterium). The concentration of bacterial cells was adjusted to 10 9 cells ml −1. After 10 min of incubation, the diluted cell suspension (10 5 cells) was filtered through a polycarbonate filter (Advantec, Tokyo, Japan) with a pore size of 0.2 μm and a diameter of 25 mm. Cells trapped on the filter were cultured on LB agar medium at 37°C for 24 h. The filter was transferred into a microtube, and cells on the filter were suspended in 1 ml of sterile deionized water. The numbers of cells in the suspension and cells remaining on the filter were determined by using an epifluorescence microscope (see below) after staining of the samples with 1 μg ml −1 of 4′,6-diamidino-2-phenylindole (DAPI; Sigma-Aldrich Japan, Tokyo). The level of recovery of cells from the filter into sterile deionized water was about 99%. The cultured cells were subjected to real-time PCR and CPRINS-FISH.For real-time PCR, bacterial DNA was extracted using a QIAamp DNA isolation kit (Qiagen, Tokyo, Japan). The cell suspension was mixed with 10 mg ml −1 of lysozyme solution and incubated at 37°C for 1 h. DNA extraction was then performed according to the kit manufacturer''s instructions. Table lists the oligonucleotide primers for PCR and CPRINS and the polynucleotide probes used in the present study. Tail fiber genes from phages P1 kc and T4GT7 were quantified by real-time PCR with a LightCycler system (Roche Diagnostics, Tokyo, Japan). LightCycler FastStart DNA master SYBR green I (Roche Diagnostics) was used with 5 mmol liter −1 Mg 2+ and 0.5 μmol liter −1 (each) primers targeting the tail fiber genes of P1 kc (P1-tail931f and P1-tail1148r) and T4GT7 (T4-tail2770f and T4-tail2983r). After a hot start for 10 min at 95°C, 40 cycles of PCR were run with denaturation at 94°C for 15 s, annealing at 60°C for 10 s, extension at 72°C for 10 s, and fluorescence detection at 83°C for 5 s. The known amounts of PCR products from the phage DNA (10 1 to 10 7 copies per reaction) were used for the standard curves to quantify the target DNA. To confirm the specificity of the reaction after real-time PCR, the PCR mixture was collected in a glass capillary and subjected to agarose gel electrophoresis in addition to a melting-curve analysis with the LightCycler system. The maintenance frequencies determined by real-time PCR were recorded as the copy number of the phage tail fiber gene per bacterial genome detected by staining with PicoGreen (Invitrogen, Tokyo, Japan) after cultivation of cells on LB agar medium for 24 h as described above. The frequencies were determined in triplicate for each sample. The increase in the phage gene copy number was determined by comparing the copy numbers in cells on the filter before and after cultivation. The phage gene copy number in cells on the filter was determined by the following formula: (total number of cells determined by DAPI staining) × (phage tail fiber gene copy number determined by real-time PCR)/(bacterial genome copy number determined by PicoGreen staining). TABLE 1.Probes and primers designed in this study Name | Target | Type | Nucleotide sequence (5′-3′) |
---|
P1-tail931f | Tail fiber gene of phage P1 | Primer | AACGACCCGAATTACAGCAC | P1-tail1148r | Tail fiber gene of phage P1 | Primer | AGTGCTGCTGCAAGCTCATA | T4-tail2770f | Tail fiber gene of phage T4 | Primer | AGCACAAATGGTGAGCACAG | T4-tail2983r | Tail fiber gene of phage T4 | Primer | TTGCTACCGTGTGGGTATGA | T4-tail2664 | Tail fiber gene of phage T4 | Probe | GGCTTCAAGTACTGACTTAGGTACTAAAACCACATCAAGCTTTGACTATGGTACG | T4-tail2720 | Tail fiber gene of phage T4 | Probe | AAGGGAACTAACAGTACGGGTGGACACACTCACTCTGGTAGTGGTTCTA | T4-tail2769 | Tail fiber gene of phage T4 | Probe | TAGCACAAATGGTGAGCACAGCCACTACATCGAGGCATGGAATGG | T4-tail2818 | Tail fiber gene of phage T4 | Probe | GGTGTAGGTGGTAATAAGATGTCATCATATGCCATATCATACAGGGCGGG | T4-tail2869 | Tail fiber gene of phage T4 | Probe | GGGAGTAACACTAATGCAGCAGGGAACCACAGTCACACTTTCTCTTTTGGG | T4-tail2922 | Tail fiber gene of phage T4 | Probe | TAGCAGTGCTGGCGACCATTCCCACTCTGTAGGTATTGGTGCTCATA | Open in a separate windowCPRINS-FISH targeting the tail fiber gene of phage T4GT7 was performed as described by Kenzaka et al. ( 3, 4), except for the probe/primer sequences and thermal conditions. After cell wall permeabilization by lysozyme treatment ( 3), the CPRINS reaction was performed under the following conditions: a hot start at 95°C for 9 min, denaturation at 94°C for 1 min, annealing at 60°C for 30 s, and extension at 72°C for 1.5 min for primer T4-tail2983r. Amplification was repeated for 30 cycles by using a thermal cycler (PTC-200; Bio-Rad Laboratories, Inc.). After amplification, filters were rinsed with 0.1% Nonidet P-40 and sterile deionized water, dehydrated in 99% ethanol, and vacuum dried. Hybridization with Alexa Fluor 546-labeled polynucleotide probes (T4-tail2664, T4-tail2720, T4-tail2769, T4-tail2818, T4-tail2869, and T4-tail2922), washing, and DAPI staining were performed as described in a previous study ( 4). In order to exclude the possibility of nonspecific probe binding to cell structures other than the target DNA in the target cells, FISH using laboratory strains without amplification of target DNA and CPRINS-FISH targeting the tail fiber genes in E. coli strains that did not carry the genes were performed.In order to examine the infection ranges of phages, plaque assays and direct counting of phages were performed. Plaque assays were performed with LB soft agar (0.8% agar) as described by Kenzaka et al. ( 4). For the direct counting, phages were stained with 5× SYBR gold (Invitrogen, Tokyo, Japan) and trapped onto an Anodisc filter (Whatman Japan, Tokyo) with a pore size of 0.02 μm and a diameter of 25 mm.The cells or phage particles on the filters were observed under an epifluorescence microscope (E-400; Nikon, Tokyo, Japan) with the Nikon filter sets UV-2A (EX300-350, DM400, and BA420) for DAPI, B-2A (EX450-490, DM505, and BA520) for SYBR gold, and HQ-CY3 (G535/50, FT565, and BP610/75) for Alexa Fluor 546. Images were acquired using a Retiga 2000R cooled charge-coupled device camera (QImaging, Surrey, BC, Canada), and at least 2,000 DAPI- or SYBR gold-stained objects per sample were counted. The maintenance frequencies determined by CPRINS-FISH were recorded as the number of CPRINS-FISH-positive cells divided by the total direct count of recipient cells after cultivation as described above. The frequencies were determined in triplicate for each sample.After cultivation on LB agar medium for 24 h, the total number of cells on the filter as determined by DAPI staining increased by 8.7 × 10 2- to 1.1 × 10 4-fold (Table ). Real-time PCR showed that the phage P1 kc gene copy number increased only in plaque-forming strains ( E. coli and E. aerogenes) and not in non-plaque-forming strains (Table ). In contrast, the phage T4GT7 gene copy number increased in both plaque-forming and non-plaque-forming strains by 7.6 × 10 1- to 7.0 × 10 4-fold. The maintenance frequencies were more than 10 −2 gene copies per bacterial genome (Table ). Direct observation via epifluorescence microscopy showed that progeny phages were not produced in the non-plaque-forming strains (Table ), and thus, fragments of phage genes were thought to integrate into the genomes of non-plaque-forming strains and replicate with the bacterial genomes. TABLE 2.Frequencies of maintenance of phage P1 kc and T4GT7 genes in Enterobacteriaceae strains Phage | Recipient | Result for infection range indicator:
| Increase in total no. of cellsc | Increase in phage gene copy no. (SD)d | Maintenance frequency (SD) as determined bye:
|
---|
Plaque formationa | Production of progenyb | Real-time PCR | CPRINS-FISH |
---|
P1kc | C. freundii | − | − | 7.0 × 103 | None | <1.5 × 10−3 | ND | | E. aerogenes | + | + | 1.7 × 103 | 7.7 × 103 (6.5 × 103) | 5.0 × 100 (4.2 × 100) | ND | | E. coli | + | + | 7.2 × 103 | 5.5 × 103 (2.7 × 103) | 9.1 × 10−1 (0.5 × 10−1) | ND | | P. mirabilis | − | − | 7.4 × 103 | None | <1.5 × 10−3 | ND | | S. Enteritidis | − | − | 8.4 × 103 | None | <1.7 × 10−4 | ND | | Y. enterocolitica | − | − | 4.6 × 103 | None | <1.8 × 10−4 | ND | T4GT7 | C. freundii | − | − | 1.5 × 103 | 7.5 × 103 (4.0 × 103) | 8.3 × 10−1 (4.4 × 10−1) | 8.6 × 10−2 (3.4 × 10−2) | | E. aerogenes | + | + | 8.7 × 102 | 1.2 × 103 (0.8 × 103) | 8.0 × 10−1 (5.0 × 10−1) | 4.0 × 10−1 (0.7 × 10−1) | | E. coli | + | + | 1.1 × 104 | 7.0 × 104 (2.7 × 104) | 8.0 × 101 (3.0 × 10) | 2.1 × 10−1 (0.4 × 10−1) | | P. mirabilis | − | − | 4.0 × 103 | 5.8 × 103 (4.2 × 103) | 3.3 × 10−1 (2.4 × 10−1) | 3.4 × 10−2 (2.2 × 10−2) | | S. Enteritidis | − | − | 1.0 × 104 | 7.6 × 101 (5.0 × 101) | 1.0 × 10−2 (0.7 × 10−2) | 8.8 × 10−2 (2.0 × 10−2) | | Y. enterocolitica | − | − | 3.6 × 103 | 1.6 × 104 (0.4 × 104) | 6.1 × 10−1 (1.6 × 10−1) | 2.2 × 10−2 (2.9 × 10−2) | Open in a separate windowaPlaque formation on soft agar was tested. bThe production of progeny phage particles was observed via epifluorescence microscopy. cThe increase ( n-fold) in the total number of cells during bacterial growth for 24 h was determined via epifluorescence microscopy. dThe increase ( n-fold) in the copy number of the phage tail fiber gene during bacterial growth for 24 h was determined by real-time PCR. Values in parentheses indicate standard deviations of results for triplicate samples. eMaintenance frequencies were determined by real-time PCR and CPRINS-FISH analyses targeting the phage tail fiber gene and are shown as the phage tail fiber gene copy numbers per bacterial genome and the numbers of gene-positive cells divided by the total numbers of cells, respectively. Values in parentheses indicate standard deviations of results for triplicate samples. ND, not determined.Real-time PCR provided a copy number for the target phage gene in the whole population, but the location of the target phage gene and the frequency of cells carrying the target gene were unclear. In addition, bacterial genomic DNA, which was measured using PicoGreen, included phage DNA, and thus the frequencies measured by dividing by the amount of bacterial genomic DNA were probably less accurate than those measured as described below. In order to confirm that the phage gene was located inside bacterial cells and determine a more accurate maintenance frequency for total cells, CPRINS-FISH targeting the tail fiber gene of phage T4GT7 was performed. CPRINS-FISH visualized the target phage gene in individual cells under an epifluorescence microscope (Fig. ). It showed that the frequencies of maintenance of the tail fiber gene, expressed as the number of gene-positive cells divided by the total number of cells, were 2.1 × 10 −1 to 4.0 × 10 −1 for plaque-forming strains after growth on LB medium for 24 h (Table ). Since phage T4GT7 is capable of undergoing only a lytic life cycle, CPRINS-FISH would detect cells in which the phage gene was replicating. For non-plaque-forming strains, the maintenance frequencies were 2.2 × 10 −2 to 8.8 × 10 −2 (Table ). If the gene was amplified by the CPRINS reaction outside bacterial cells, the amplicon would not accumulate inside bacterial cells and they would not exhibit bright fluorescence. Therefore, CPRINS-FISH proved that a part of the phage T4GT7 gene was located inside cells of non-plaque-forming strains. The tail fiber gene is responsible for the phage tail structure. The DNA sequences of the phage genes responsible for phage morphology have been found in many bacterial genomes ( 1, 5). Open in a separate windowVisualization of E. coli cells carrying the tail fiber gene transferred by phage T4GT7. (A) After being mixed with phages for 10 min, E. coli NBRC 12713 cells were cultured for 24 h and subjected to CPRINS-FISH targeting the phage gene. Only cells having amplified tail fiber gene products emitted the fluorescence of the Alexa Fluor 546-labeled probe under green excitation (exposure, 0.5 s). (B) All DAPI-stained bacterial cells were visualized under UV excitation (exposure time, 0.1 s).In order to explore the effect of integration of the phage gene into the bacterial genome on bacterial heredity, we determined the mutation frequency for a C. freundii strain that acquired the phage T4GT7 gene. Two colonies which acquired the phage T4GT7 gene were screened by colony PCR with T4-tail2770f and T4-tail2983r primers and designated Cik8-1 and Cik8-4. Mutation frequencies were determined with LB medium containing 150 μg ml −1of rifampin (rifampicin) or 10 μg ml −1of nalidixic acid. The mutation frequencies associated with nalidixic acid resistance decreased by 12- to 240-fold and the frequencies associated with rifampin resistance decreased by 40- to 83-fold compared to those for the parent strains (Fig. ). Mutation increases genetic variation. The decreased mutation frequency would contribute to the genetic stability of the genome in individual cells but not to genetic variation in the population. Our results show that phage T4GT7 was capable of affecting the genomic properties of C. freundii, which was thought previously not to be the host, although the mechanism by which mutation frequencies decreased remains unknown. Further experiments are required to clarify the molecular mechanism by which mutation frequencies altered after gene transfer. Open in a separate windowMutation frequencies for T4GT7-infected C. freundii strains. Mutation frequencies were determined with LB agar medium containing nalidixic acid or rifampin. Cik8-1 and Cik8-4 were strains which acquired a phage gene transferred from phage T4GT7. Cik1 and Cik2 were the parent strains.In summary, during growth on agar medium after the phage was allowed to be adsorbed by strains of Enterobacteriaceae, the phage P1 kc gene was not maintained in non-plaque-forming strains but the phage T4GT7 gene was maintained in more diverse species than previously expected. The transfer of foreign DNA molecules (DNA entry) into a bacterium is an important first step in genetic diversification through horizontal gene transfer. A previous study reported that phage P1 kc is capable of injecting DNA into non-plaque-forming E. coli cells ( 4), but the phage P1 kc gene was not maintained during bacterial growth in the present study. The results showing the difference in maintenance between phage P1 kc and T4GT7 genes suggest that the maintenance of transferred phage genes depends on phage gene sequences or other phage factors. When maintained, the phage gene could alter the mutation frequency for bacteria that acquired the gene, affecting the genomic variability at the population level. Conventionally, phage-bacterium interaction has been studied with certain models consisting of a phage and a bacterium in which the phage can multiply ( 12, 13). Our results indicate the importance of the dynamic of phage genes among diverse bacteria that were previously thought not to be hosts and the hereditary impact of phage gene transfer on such bacteria. 相似文献
7.
Bacteriophage-mediated horizontal gene transfer is one of the primary driving forces of bacterial evolution. The pac-type phages are generally thought to facilitate most of the phage-mediated gene transfer between closely related bacteria, including that of mobile genetic elements-encoded virulence genes. In this study, we report that staphylococcal cos-type phages transferred the Staphylococcus aureus pathogenicity island SaPIbov5 to non- aureus staphylococcal species and also to different genera. Our results describe the first intra- and intergeneric transfer of a pathogenicity island by a cos phage, and highlight a gene transfer mechanism that may have important implications for pathogen evolution.Classically, transducing phages use the pac site-headful system for DNA packaging. Packaging is initiated on concatemeric post-replicative DNA by terminase cleavage at the sequence-specific pac site, a genome slightly longer than unit length is packaged, and packaging is completed by non-sequence-specific cleavage (reviewed in Rao and Feiss, 2008). Generalized transduction results from the initiation of packaging at pac site homologs in host chromosomal or plasmid DNA, and typically represents ∼1% of the total number of phage particles. In the alternative cos site mechanism packaging is also initiated on concatemeric post-replicative DNA by terminase cleavage at a sequence-specific ( cos) site. Here, however, packaging is completed by terminase cleavage at the next cos site, generating a precise monomer with the cohesive termini used for subsequent circularization ( Rao and Feiss, 2008). Although cos site homologs may exist in host DNA, it is exceedingly rare that two such sites would be appropriately spaced. Consequently, cos phages, of which lambda is the prototype, do not engage in generalized transduction. For this reason, cos-site phages have been preferred for possible phage therapy, since they would not introduce adventitious host DNA into target organisms.The Staphylococcus aureus pathogenicity islands (SaPIs) are the best-characterized members of the phage-inducible chromosomal island family of mobile genetic elements (MGEs; Novick et al., 2010). SaPIs are ∼15 kb mobile elements that encode virulence factors and are parasitic on specific temperate (helper) phages. Helper phage proteins are required to lift their repression ( Tormo-Más et al., 2010, 2013), thereby initiating their excision, circularization and replication. Phage-induced lysis releases vast numbers of infectious SaPI particles, resulting in high frequencies of transfer. Most SaPI helper phages identified to date are pac phages, and many well-studied SaPIs are packaged by the headful mechanism ( Ruzin et al., 2001; Ubeda et al., 2007). Recently, we have reported that some SaPIs, of which the prototype is SaPIbov5 ( Viana et al., 2010), carry phage cos sequences in their genomes, and can be efficiently packaged and transferred by cos phages to S. aureus strains at high frequencies ( Quiles-Puchalt et al., 2014). Here we show that this transfer extends to non- aureus staphylococci and to Listeria monocytogenes.Since the pac phages transfer SaPIs to non- aureus staphylococci and to the Gram-positive pathogen Listeria monocytogenes ( Maiques et al., 2007; Chen and Novick, 2009), we reasoned that cos phages might also be capable of intra- and intergeneric transfer. We tested this with SaPIbov5, into which we had previously inserted a tetracycline resistance ( tetM) marker to enable selection, and with lysogens of two helper cos phages, φ12 and φSLT, carrying SaPIbov5 (strains JP11010 and JP11194, respectively; Supplementary Table 1). The prophages in these strains were induced with mitomycin C, and the resulting lysates were adjusted to 1 μg ml −1 DNase I and RNase A, filter sterilized (0.2 μm pore), and tested for SaPI transfer with tetracycline selection, as previously described ( Ubeda et al., 2008). To test for trans-specific or trans-generic transduction, coagulase-negative staphylococci species and L. monocytogenes strains were used as recipients for SaPIbov5 transfer, respectively, as previously described ( Maiques et al., 2007; Chen and Novick, 2009). As shown in and Supplementary Table 2). In contrast, deletion of the SaPIbov5 cos site (strains JP11229 and JP11230) did not affect SaPI replication ( Supplementary Figure 1), but completely eliminated SaPIbov5 transfer (). The TerS protein is essential for φ12 and SaPIbov5 DNA packaging, but not for phage-mediated lysis ( Quiles-Puchalt et al., 2014). As expected, this mutation abolished SaPIbov5 transfer ( Open in a separate window(a) Map of SaPIbov5. Arrows represent the localization and orientation of ORFs greater than 50 amino acids in length. Rectangles represent the position of the ori (in purple) or cos (in red) sites. Positions of different primers described in the text are shown. (b) Amplimers generated for detection of SaPIbov5 in the different recipient strains. Supplementary Table 2 lists the sequence of the different primers used. The element was detected in S. epidermidis JP829 (Se-1), S. epidermidis JP830 (Se-2), L. monocytogenes SK1351 (Lm-1), L. monocytogenes EGDe (Lm-2), S. xylosus C2a (Sx) and S. aureus JP4226 (Sa). Table 1Intra- and intergeneric SaPIbov5 transfer aDonor strain
| | |
---|
Phage | SaPI | Recipient strain | SaPI titreb |
---|
φ12 | SaPIbov5 | S. aureus JP4226 | 8.3 × 104 | | | S. epidermidis JP829 | 2.4 × 104 | | | S. epidermidis JP830 | 4.7 × 104 | | | L. monocytogenes SK1351 | 6.6 × 103 | | | L. monocytogenes EGDe | 2.1 × 104 | | | S. xylosus C2a | 7.1 × 104 | | | | | φ12 | SaPIbov5 Δcos | S. aureus JP4226 | <10 | | | S. epidermidis JP829 | <10 | | | S. epidermidis JP830 | <10 | | | L. monocytogenes SK1351 | <10 | | | L. monocytogenes EGDe | <10 | | | S. xylosus C2a | <10 | | | | | φ12 ΔterS | SaPIbov5 | S. aureus JP4226 | <10 | | | S. epidermidis JP829 | <10 | | | S. epidermidis JP830 | <10 | | | L. monocytogenes SK1351 | <10 | | | L. monocytogenes EGDe | <10 | | | S. xylosus C2a | <10 | | | | | φSLT | SaPIbov5 | S. aureus JP4226 | 4.1 × 103 | | | S. epidermidis JP829 | 1.1 × 103 | | | S. epidermidis JP830 | 2.1 × 103 | | | L. monocytogenes SK1351 | 3.6 × 102 | | | L. monocytogenes EGDe | 3.1 × 103 | | | S. xylosus C2a | 4.0 × 103 | | | | | φSLT | SaPIbov5 Δcos | S. aureus JP4226 | <10 | | | S. epidermidis JP829 | <10 | | | S. epidermidis JP830 | <10 | | | L. monocytogenes SK1351 | <10 | | | L. monocytogenes EGDe | <10 | | | S. xylosus C2a | <10 | Open in a separate windowAbbreviation: SAPI, Staphylococcus aureus pathogenicity island. aThe means of results from three independent experiments are shown. Variation was within ±5% in all cases. bNo. of transductants per ml induced culture.Because plaque formation is commonly used to determine phage host range, we next determined the ability of phages φ12 and φSLT to parasitize and form plaques on S. xylosus, S. epidermidis and L. monocytogenes strains. As shown in Supplementary Figure 2, phages φ12 and φSLT can parasitize and form plaques on their normal S. aureus hosts, but are completely unable to lyse the non- aureus strains. Therefore, as previously observed with pac phages ( Chen and Novick, 2009), these results indicate that the overall host range of a cos phage may also be much wider if it includes infection without plaque formation.Previous studies have demonstrated pac phage-mediated transfer of MGEs between S. aureus and other bacterial species ( Maiques et al., 2007; Chen and Novick, 2009; Uchiyama et al., 2014); however, no previous studies have described the natural intra- or intergeneric transfer of pathogenicity islands by cos phages. As bacterial pathogens become increasingly antibiotic resistant, lytic and poorly transducing phages, such as cos phages, have been proposed for phage therapy, on the grounds that they would not introduce adventitious host DNA into target organisms and that the phages are so restricted in host range that the resulting progeny are harmless and will not result in dysbiosis of human bacterial flora. Because plaque formation was once thought to determine the host range of a phage, the evolutionary impact of phages on bacterial strains they can transduce, but are unable to parasitize, has remained an unrecognized aspect of phage biology and pathogen evolution. Our results add to the recently recognized concept of ‘silent transfer'' of pathogenicity factors carried by MGEs ( Maiques et al., 2007; Chen and Novick, 2009) by phages that cannot grow on the target organism. They extend this capability to cos phages, which have hitherto been unrecognized as mediators of natural genetic transfer.The potential for gene transfer of MGEs by this mechanism is limited by the ability of cos phages to adsorb and inject DNA into recipient strains, and also by the presence of suitable attachment sites in recipient genomes. However, since different bacterial genera express wall teichoic acid with similar structures, which can act as bacteriophage receptors governing the routes of horizontal gene transfer between major bacterial pathogens, horizontal gene transfer even across long phylogenetic distances is possible ( Winstel et al., 2013). In addition, our previous results also demonstrated that the SaPI integrases have much lower sequence specificity than other typical integrases, and SaPIs readily integrate into alternative sites in the absence of the cognate attC site, such that any bacterium that can adsorb SaPI helper phage is a potential recipient ( Chen and Novick, 2009). Thus, we anticipate that cos phages can have an important role in spreading MGEs carrying virulence and resistance genes. We also predict that cos sites will be found on many other MGEs, enabling cos phage-mediated transfer of any such element that can generate post-replicative concatemeric DNA. 相似文献
8.
The effects of the challenge dose and major histocompatibility complex (MHC) class IB alleles were analyzed in 112 Mauritian cynomolgus monkeys vaccinated ( n = 67) or not vaccinated ( n = 45) with Tat and challenged with simian/human immunodeficiency virus (SHIV) 89.6P cy243. In the controls, the challenge dose (10 to 20 50% monkey infectious doses [MID 50]) or MHC did not affect susceptibility to infection, peak viral load, or acute CD4 T-cell loss, whereas in the chronic phase of infection, the H1 haplotype correlated with a high viral load ( P = 0.0280) and CD4 loss ( P = 0.0343). Vaccination reduced the rate of infection acquisition at 10 MID 50 ( P < 0.0001), and contained acute CD4 loss at 15 MID 50 ( P = 0.0099). Haplotypes H2 and H6 were correlated with increased susceptibility ( P = 0.0199) and resistance ( P = 0.0087) to infection, respectively. Vaccination also contained CD4 depletion ( P = 0.0391) during chronic infection, independently of the challenge dose or haplotype.Advances in typing of the major histocompatibility complex (MHC) of Mauritian cynomolgus macaques ( 14, 20, 26) have provided the opportunity to address the influence of host factors on vaccine studies ( 13). Retrospective analysis of 22 macaques vaccinated with Tat or a Tat-expressing adenoviral vector revealed that monkeys with the H6 or H3 MHC class IB haplotype were overrepresented among aviremic or controller animals, whereas macaques with the H2 or H5 haplotype clustered in the noncontrollers ( 12). More recently, the H6 haplotype was reported to correlate with control of chronic infection with simian immunodeficiency virus (SIV) mac251, regardless of vaccination ( 18).Here, we performed a retrospective analysis of 112 Mauritian cynomolgus macaques, which included the 22 animals studied previously (12), to evaluate the impact of the challenge dose and class IB haplotype on the acquisition and severity of simian/human immunodeficiency virus (SHIV) 89.6P cy243 infection in 45 control monkeys and 67 monkeys vaccinated with Tat from different protocols (Table ). TABLE 1.Summary of treatment, challenge dose, and outcome of infection in cynomolgus monkeys Protocol code | No. of monkeys | Immunogen (dose)a | Adjuvantb | Schedule of immunization (wk) | Routec | Challenged (MID50) | Virological outcomee
| Reference(s) or source |
---|
A | C | V |
---|
ISS-ST | 6 | Tat (10) | Alum or RIBI | 0, 2, 6, 12, 15, 21, 28, 32, 36 | s.c., i.m. | 10 | 4 | 1 | 1 | 4, 17 | ISS-ST | 1 | Tat (6) | None | 0, 5, 12, 17, 22, 27, 32, 38, 42, 48 | i.d. | 10 | 1 | 0 | 0 | 4, 17 | ISS-PCV | 3 | pCV-tat (1 mg) | Bupivacaine + methylparaben | 0, 2, 6, 11, 15, 21, 28, 32, 36 | i.m. | 10 | 3 | 0 | 0 | 6 | ISS-ID | 3 | Tat (6) | none | 0, 4, 8, 12, 16, 20, 24, 28, 39, 43, 60 | i.d. | 10 | 1 | 1 | 1 | B. Ensoli, unpublished data | ISS-TR | 6 | Tat (10) | Alum-Iscom | 0, 2, 6, 11, 16, 21, 28, 32, 36 | s.c., i.d., i.m. | 10 | 4 | 2 | 0 | Ensoli, unpublished | ISS-TGf | 3 | Tat (10) | Alum | 0, 4, 12, 22 | s.c. | 15 | 0 | | 3 | Ensoli, unpublished | ISS-TG | 3 | Tatcys22 (10) | Alum | | | 15 | 0 | | 3 | Ensoli, unpublished | ISS-TG | 4 | Tatcys22 (10) + Gag (60) | Alum | | | 15 | 0 | | 4 | Ensoli, unpublished | ISS-TG | 4 | Tat (10) + Gag (60) | Alum | | | 15 | 0 | | 4 | Ensoli, unpublished | ISS-MP | 3 | Tat (10) | H1D-Alum | 0, 4, 12, 18, 21, 38 | s.c., i.m. | 15 | 0 | 2 | 1 | Ensoli, unpublished | ISS-MP | 3 | Tat (10) | Alum | | s.c. | 15 | 0 | 0 | 3 | Ensoli, unpublished | ISS-GS | 6 | Tat (10) | H1D-Alum | 0, 4, 12, 18, 21, 36 | s.c., i.m. | 15 | 1 | 3 | 2 | Ensoli, unpublished | NCI-Ad-tat/Tat | 7 | Ad-tat (5 × 108 PFU), Tat (10) | Alum | 0, 12, 24, 36 | i.n., i.t., s.c. | 15 | 2 | 3 | 2 | Ensoli, unpublished | NCI-Tat | 9 | Tat (6 and 10) | Alum/Iscom | 0, 2, 6, 11, 15, 21, 28, 32, 36 | s.c., i.d., i.m. | 15 | 2 | 4 | 3 | 12 | ISS-NPT | 3 | pCV-tat (1 mg) | Bupivacaine + methylparaben-Iscom | 0, 2, 8, 13, 17, 22, 28, 46, 71 | i.m. | 20 | 0 | 0 | 3 | Ensoli, unpublished | ISS-NPT | 3 | pCV-tatcys22 (1 mg) | Bupivacaine + methylparaben-Iscom | 0, 2, 8, 13, 17, 22, 28, 46, 71 | i.m. | 20 | 1 | 1 | 1 | | Total vaccinated | 67 | | | | | | 19 | 17 | 31 | | Naive | 11 | None | None | NAg | NA | 10 or 15 | 1 | 3 | 7 | | Control | 34 | None, Ad, or pCV-0 | Alum, RIBI, H1D, Iscom or bupivacaine + methylparaben-Iscom | | s.c., i.d., i.n., i.t., i.m. | 10, 15, or 20 | 5 | 13 | 16 | | Total controls | 45 | | | | | | 6 | 16 | 23 | | Total | 112 | | | | | | 25 | 33 | 54 | | Open in a separate windowaAll animals were inoculated with the indicated dose of Tat plasmid DNA (pCV-tat [ 8], adenovirus-tat [Ad-tat] [ 27]) or protein, Gag protein, or empty vectors (pCV-0, adenovirus [Ad]) by the indicated route. Doses are in micrograms unless indicated otherwise. bAlum, aluminum phosphate ( 4); RIBI oil-in-water emulsions containing squalene, bacterial monophosphoryl lipid A, and refined mycobacterial products ( 4); Iscom, immune-stimulating complex ( 4); H1D are biocompatible anionic polymeric microparticles used for vaccine delivery ( 10, 12, 25a). cs.c., subcutaneous; i.m., intramuscular; i.d., intradermal; i.n., intranasal; i.t., intratracheal. dAll animals were inoculated intravenously with the indicated dose of the same SHIV89.6.P cy243 stock. eAccording to the virological outcome upon challenge, monkeys were grouped as aviremic (A), controllers (C), or viremic (V). fBecause of the short follow-up, controller status could not be determined and all infected monkeys of the ISS-TG protocol were therefore considered viremic. gNA, not applicable. 相似文献
9.
Poribacteria were found in nine sponge species belonging to six orders of Porifera from three oceans. Phylogenetic analysis revealed four distinct poribacterial clades, which contained organisms obtained from several different geographic regions, indicating that the distribution of poribacteria is cosmopolitan. Members of divergent poribacterial clades were also found in the same sponge species in three different sponge genera.Recently, a novel bacterial phylum, termed “ Poribacteria,” was discovered, and members of this phylum have been found exclusively in sponges ( 2). Phylogenetic analyses of 16S rRNA genes indicated that poribacteria are evolutionarily deeply branching organisms and related to a superphylum composed of Planctomycetes, Verrucomicrobia, and Chlamydia ( 11). Poribacterial 16S rRNA genes contain 13 of 15 planctomycete signature nucleotides, but a level of sequence divergence of more than 25% compared to any other bacterial phylum, including the Planctomycetes, justifies the status of this taxon as an independent phylum. A consistent treeing pattern is difficult to resolve in comparative phylogenetic sequence analyses, making the poribacteria an unusual line of phylogenetic descent. In addition to their divergent status as a separate phylum on the basis of the 16S rRNA sequence, poribacteria are also divergent because they may have a compartmentalized cell structure, a cell plan they share only with members of the phyla Planctomycetes and Verrucomicrobia ( 2). They are also of interest for understanding the potential contribution of obligate sponge-associated bacteria to the sponges harboring them and as an example of a yet-to-be-cultured group of bacteria associated with invertebrate tissue apparently exclusively but for unknown reasons. This study aimed to further explore the presence and diversity of poribacteria in different marine demosponge genera using samples from around the world.The Mediterranean sponges were collected by scuba divers offshore at Banyuls sur Mer, France (42°29′N, 03°08′E). The Caribbean sponges were collected offshore at Little San Salvador Island, Bahamas (24°32′N, 75°55′W). The eastern Pacific sponge Aplysina fistularis was collected offshore at San Diego, CA (32°51′N, 117°15′W). The western Pacific sponge Theonella swinhoei was collected offshore at Palau (07°23′N, 134°38′E). All non-Great Barrier Reef (non-GBR) sponges were collected between May and July 2000, and once individual sponge specimens were brought to the surface, they were frozen in liquid nitrogen on board ship and stored at −80°C until microbiological processing ( 9). The GBR marine sponges were collected off Heron Island Research Station (23°27′S, 151°5′E) in April 2002 ( 5). Pseudoceratina clavata was collected by scuba divers at a depth of 14 m, and Rhabdastrella globostellata was collected at a depth of ca. 0.5 m after a reef walk consisting of a few hundred meters. The samples were immediately placed in plastic bags and brought to Heron Island Research Station, where they were stored at −80°C until processing. Sponge DNA was extracted as described previously ( 2, 5).Total sponge-derived genomic DNA was screened by PCR for the presence of poribacteria using a 16S rRNA gene primer set. Poribacterial 16S rRNA genes were amplified by employing a pair of Poribacteria-specific primers, POR389f (5′-ACG ATG CGA CGC CGC GTG-3′) and POR1130r (5′-GGC TCG TCA CCA GCG GTC-3′) ( 2). The poribacterial PCR products that were ca. 740 bp long derived from one sponge individual were cloned into the pGEM-T Easy vector (Promega, Madison, WI). Clone inserts were digested with restriction endonucleases MspI and HaeIII (New England Biolabs, Inc., United States), characterized to obtain restriction profiles and unique profiles, and sequenced. The compiled partial 16S rRNA gene sequences were then analyzed using BLASTN to select the most closely related poribacterial reference sequences.The sequences exhibiting levels of similarity of less than 97% were used for further analysis. Poribacterial 16S rRNA gene sequences were aligned using the ARB software package ( 7). The resulting alignment was imported into PAUP ( 10) and analyzed by using distance, maximum parsimony, and maximum likelihood algorithms together with bootstrap resamplings (3,000, 3,000, and 200 resamplings, respectively), and the resulting bootstrap values were applied to nodes on the ARB neighbor-joining tree. Signature sequences were detected using the ARB software package. A signature sequence is defined here as a short sequence that is present in a group of poribacterial sequences in a phylogenetic clade but is not found in any other clade in the poribacterial tree.Analysis of the 16S rRNA gene clone library sequences generated from sponge tissues revealed the presence of poribacteria in sponge individuals belonging to the orders Verongida, Astrophorida, Dictyoceratida, Haplosclerida, Lithistida, and Homosclerophorida, while poribacteria could not be detected in sponges belonging to the orders Hadromerida and Agelasida. In the order Halichondrida, poribacteria were detected in Xestospongia muta but not in Haliclona sp. Altogether, nine sponge species were added to the list of Poribacteria-containing sponges (Table ). Three distinct clades were observed that were clearly supported by bootstrap values greater than 75 with every tree-building algorithm applied (Fig. ), and one clade (clade I) was supported by bootstrap values of 64, 98, and 71 in distance, maximum parsimony, and maximum likelihood trees, respectively. Similarity calculations using approximately 740-bp amplified poribacterial 16S rRNA gene fragments and other poribacterial sequences from the NCBI database showed that the dissimilarity between clades was consistent with their separation in phylogenetic trees. For example, the levels of dissimilarity between members of clade I and clade II were 3 to 8%, while the levels of dissimilarity between members of clades I and III and between members of clades I and IV were 10 to 14% and 11 to 15%, respectively. Open in a separate windowNeighbor-joining phylogenetic tree for poribacterial clones based on Poribacteria-specific PCR products (740 bp) of the 16S rRNA gene, showing relationships of poribacterial clones from different global regions. The poribacterial clones on the right are additional clones belonging to the same clades as strains in the tree at the same level. Bootstrap confidence values of >75% for distance, maximum parsimony, and maximum likelihood algorithm analyses are indicated by filled circles at nodes, and open circles indicate unsupported nodes. Prefixes for clones: A, Aplysina aerophoba; C, Aplysina cavernicola; F, Aplysina fistularis; L, Aplysina lacunosa; S, Ircinia sp.; P, Plakortis sp.; PC, Pseudoceratina clavata; RG, Rhabdastrella globostellata; T, Theonella swinhoei; X, Xestospongia muta. Scale bar = 0.1 nucleotide substitution per site. TABLE 1.Distribution of poribacteria in different demosponge orders Sponge species or seawater | Order | Geographic locationa | Presence of poribacteriab | Reference |
---|
Aplysina aerophoba | Verongida | MED | + | 2 | Aplysina lacunosa | Verongida | BAH | + | 2 | Aplysina fistularis | Verongida | EPAC or BAH | + | 2 | Aplysina insularis | Verongida | BAH | + | 2 | Verongula gigantea | Verongida | BAH | + | 2 | Smenospongia aurea | Dictyoceratida | BAH | + | 2 | Aplysina cauliformis | Verongida | BAH | + | This study | Aplysina archeri | Verongida | BAH | + | This study | Aplysina cavernicola | Verongida | MED | + | This study | Pseudoceratina clavata | Verongida | WPAC | + | This study | Rhabdastrella globostellata | Astrophorida | WPAC | + | This study | Ircinia sp. | Dictyoceratida | BAH | + | This study | Xestospongia muta | Haplosclerida | BAH | + | This study | Theonella swinhoei | Lithistida | EPAC | + | This study | Plakortis sp. | Homosclerophorida | BAH | + | This study | Chondrilla nucula | Hadromerida | BAH | − | 2 | Agelas wiedenmayeri | Agelasida | BAH | − | 2 | Agelas cerebrum | Agelasida | BAH | − | This study | Axinella polypoides | Halichondrida | MED | − | This study | Ptilocaulis sp. | Halichondrida | BAH | − | 2 | Dysidea avara | Dictyoceratida | MED | − | This study | Haliclona sp. | Haplosclerida | MED | − | This study | Ectyoplasia ferox | Poecilosclerida | BAH | − | 2 | Seawater | NAc | MED | − | This study | Open in a separate windowaMED, Mediterranean Sea; BAH, Bahamas; WPAC, western Pacific Ocean; EPAC, eastern Pacific Ocean. bThe presence of poribacteria was evaluated by sequencing and phylogenetic analysis of amplified PCR products. +, present; −, absent. cNA, not applicable.Within each clade in the phylum Poribacteria, there were higher similarity values, including 94 to 100% among members of clade I, 94 to 99% among members of clade II, 96 to 99% among members of clade III, and 96 to 99% among members of clade IV. When members of the the phylum Poribacteria were compared to members of the Planctomycetes (Fig. ), the 16S rRNA genes exhibited levels of sequence dissimilarity of up to 38%, consistent with the conclusion of Fieseler et al. concerning the separate phylum level status of poribacteria based on a similarity value of <75%. A phylogenetic correlation between sponge phylogeny and poribacterial phylogeny is not evident, since, for example, clones from A. fistularis and Aplysina aerophoba occurred in both clade I and clade II and one clone from A. aerophoba also occurred in clade III, while clones from P. clavata and R. globostellata occurred in clades I, II, and III but not in clade IV. Clades I and II included poribacterial clones derived from all sponge species occurring in all of the widely separated geographic regions examined in this study (Fig. ). Clade III represented poribacterial clones derived from sponge species obtained in the eastern Pacific region, GBR, and the Bahamas but not in the Mediterranean region. The majority of poribacterial clones in clade IV were derived from sponge species obtained in the Bahamas, and one clade IV clone was obtained from a sponge species collected in the Mediterranean region. Open in a separate windowNeighbor-joining phylogenetic tree for poribacterial clones based on Poribacteria-specific PCR products (740 bp) of the 16S rRNA gene, showing the internal relationships of and occurrence of clade I members in distinct sponge species representing cosmopolitan geographic regions. For an explanation of the colors, see Fig. . Bootstrap confidence values of >75% for distance, maximum parsimony, and maximum likelihood algorithm analyses are indicated by filled circles at nodes, and open circles indicate unsupported nodes. Prefixes for clones: A, Aplysina aerophoba; C, Aplysina cavernicola; F, Aplysina fistularis; L, Aplysina lacunosa; S, Ircinia sp.; P, Plakortis sp.; PC, Pseudoceratina clavata; RG, Rhabdastrella globostellata; T, Theonella swinhoei; X, Xestospongia muta. Scale bar = 0.1 nucleotide substitution per site. Clones PC15, L8, T6, C2, P3, S2, and X1 were removed from this analysis to allow better branch resolution.Poribacterial clones from different sponges from widely separated marine habitats belonged to at least four major clades with similarities ranging from 94 and 96%. For clade III (Fig. ), we detected a signature sequence characteristic of poribacterial clones from the GBR sponges R. globostellata and P. clavata. This signature sequence (CCA GTT AGC TTG ACG GTA) (Table ) at E. coli positions 469 to 487 targeted 10 sequences, 5 of which were from GBR marine sponges generated in this study (clones RG68, RG112, RG105, PC96, and PC8). Another five poribacterial sequences were detected in an unpublished study investigating the microbial diversity in GBR sponges. This signature sequence indicates a specific geographic presence of poribacteria belonging to clade IV in the GBR region. In addition, a sequence (GAG TGT GAA ATG GCT TGG at E. coli positions 599 to 617) characteristic of clade IV was found in 11 sequences derived from sponges from the Bahamas and one sequence (A7) from a Mediterranean sponge. TABLE 2.Poribacterial signature sequences for clades III and IV, including a GBR-specific signature sequence (pori_SSIII) and a signature sequence specific to 11 of 12 sequences from the Bahamas (pori_SSIV) Signature sequence | Name | Full namea | E. coli position | Sequenceb |
---|
pori_SSIII | Pla101P | Pla101P* | 469 | GGUGAUAAG-==================-CCAUAGUA | | Pla131P | Pla131P* | 469 | GGUGAUAAG-==================-CCAUAGUA | | Pla134P | Pla134P* | 469 | GGUGAUAAG-==================-CCAUAGUA | | Pla50P | Pla50P* | 469 | GGUGAUAAG-==================-CCAUAGUA | | Pla82P | Pla82P* | 469 | GGUGAUAAG-==================-CCAUAGUA | | PO68 | Pori clone RGPo68 | 469 | GGUGAUAAG-==================-GAGAAAAG | | PO112 | Pori clone RGPo112 | 469 | GGUGAUAAU-==================-CCAUAGUA | | PO105 | Pori clone RGPo105 | 469 | GGUGAUAAG-==================-CCAUAGUA | | PO96 | Uncultured Pori clone | 469 | GGUGAUAAG-==================-CCAUAGUA | | PCPO8 | Pori clone PCPo8 | 469 | GGUGAUAAG-==================-CCAUAGUA | pori_SSIV | AY485286 | Uncultured Pori clone | 599 | ACAUUAGUC-==================-CUCAACCA | | AY485285 | Uncultured Pori clone | 599 | ACAUNAGUC-==================-CUCAACNA | | AY485284 | Uncultured Pori clone | 599 | ACAUUAGUC-==================-CUCAACCA | | AY485281 | Uncultured Pori bacterium | 599 | ACAUUAGUC-==================-CUCAACCA | | A7 | A7 | 599 | AUAUUAGUC-==================-CUCAACCA | | F2 | F2 | 599 | ACAUAAGUC-==================-CUCAACCA | | L16 | L16 | 599 | ACAUUAGUC-==================-CUCAACCA | | P20 | P20 | 599 | ACAUAAGUC-==================-CUCAACCA | | P38 | P38 | 599 | ACAUUAGUC-==================-CUCAACCA | | S6 | S6 | 599 | AUAUUAGUC-==================-CUCAACCA | | S10 | S10 | 599 | AUAUUAGUC-==================-CUCAACCA | | X18 | X18 | 599 | ACAUUAGUC-==================-CUCAACCA | Open in a separate windowaAsterisks indicate poribacterial clones derived from the GBR sponge R. globostellata in a separate study. bThe internal sequence (indicated by equals signs) of each pori_SSIII clone is CCAGUUAGCUUGACGGUA, and that of each pori_SSIV clone is GAGUGUGAAAUGGCUUGG.Based on the data presented here, Poribacteria appears to be a bacterial phylum that is specifically found in several demosponge genera of the phylum Porifera (Table ). To our knowledge, this is the only case of a bacterial phylum specifically associated with a marine invertebrate phylum. Certain phylum members appear to be widely distributed among sponges belonging to different species and in different geographic regions, forming sponge-specific lineages ( 3), but these are individual species level or at most genus level clades in a subdivision of a phylum rather than in a whole phylum.PCR analyses of seawater samples collected in this study (Table ) and searches using nucleotide sequence databases of seawater metagenomes were negative for poribacteria. This is consistent with the concept that Poribacteria is a sponge-specific phylum. Within the sponges poribacteria are distributed among members of distinct demosponge orders that occur in various geographic locations, indicating that there is wide distribution of poribacteria among marine demosponges. Very similar 16S rRNA clone sequences that cluster in clade I were found in sponges from all geographic regions sampled in this study, including locations in the Northern and Southern hemispheres (Fig. ). Similarly, clade II contains poribacterial clones from the Mediterranean Aplysina species and from GBR Pseudoceratina and Rhabdastrella species. This appears to contrast, albeit at a lower level of resolution, with results suggesting that bacterial populations are endemic in different geographic regions, e.g., with the findings that marine bacterioplankton communities include few cosmopolitan operational taxonomic units ( 8), that fluorescent Pseudomonas genotypes from soil are endemic at different geographic sites ( 1), and that hyperthermophilic Sulfolobus archaea from different geothermal areas are genetically divergent ( 12). Judging the endemicity of populations in different geographic regions may depend on the taxonomic scale used to distinguish populations ( 1). In this study we provide evidence that at least some clades may be relatively characteristic of particular regions, e.g., GBR clade III (Table ). It is remarkable that in the case of the sponge species R. globostellata and P. clavata from a single geographic region (GBR), the microbial communities include representatives of distantly related poribacterial clades II and III, whose sequences exhibit levels of dissimilarity ranging from 10 to 13%. In another case poribacteria belonging to clades I, II, and IV were found in a single host, A. aerophoba, from the Mediterranean. Thus, members of widely divergent poribacterial clades occur in the same specimen in sponges in widely separated geographic regions in the world''s oceans. Three different sponge species belonging to three different genera exhibit this phenomenon.The morphology and life strategy of sponges have remained unchanged for the past 580 million years, as judged by the dramatic similarity of the morphologies of Precambrian fossils to the morphologies of recent sponges ( 6). Adaptation of the poribacteria to this niche might have taken place early in evolution before the various sponge orders separated from each other. It seems likely that poribacteria diverged from other bacterial phyla long before evolution of the metazoans as part of the fan-like radiation by which all bacterial phyla appear to have arisen ( 4). This bacterial radiation may have resulted in the divergence of the clades that we have observed for the poribacteria, but there is no indication of cospeciation between host sponges and the poribacteria.In summary, poribacteria exhibit considerable diversity and are classified into four phylogenetic clades. Poribacteria seem to be widely distributed among many different marine demosponge genera, and further studies are needed to explain the nature of the poribacterium-sponge interaction. 相似文献
11.
We used a mixture of surrogates ( Acinetobacter baumannii, Mycobacterium terrae, hepatitis A virus, and spores of Geobacillus stearothermophilus) for bioagents in a standardized approach to test environmental surface disinfectants. Each carrier containing 10 μl of mixture received 50 μl of a test chemical or saline at 22 ± 2°C. Disinfectant efficacy criteria were ≥6 log 10 reduction for the bacteria and the spores and ≥3 log 10 reduction for the virus. Peracetic acid (1,000 ppm) was effective in 5 min against the two bacteria and the spores but not against the virus. Chlorine dioxide (CD; 500 and 1,000 ppm) and domestic bleach (DB; 2,500, 3,500, and 5,000 ppm) were effective in 5 min, except for sporicidal activity, which needed 20 min of contact with either 1,000 ppm of CD or the two higher concentrations of DB.Disinfectant testing with a single type of organism does not represent field conditions, where bioagents or other pathogens may be mixed with other contaminants. Such an approach also cannot predict the true spectrum of microbicidal activity of a given chemical, while the identity of the target pathogen(s) is often unknown. We used a mixture of Acinetobacter baumannii, Mycobacterium terrae ( 15), hepatitis A virus (HAV) ( 4), and the spores of Geobacillus stearothermophilus as surrogates for infectious bioagents, with an added soil load on disks (1 cm in diameter; 0.75 mm thick) of brushed stainless steel (AISI no. 430; Muzeen & Blythe, Winnipeg, MB, Canada), to better simulate environmental surface disinfection ( 1, 11). Table gives details on the microbial strains, media used for their culture and recovery, and methods for preparing working stocks. The quantitative carrier test (QCT) method, ASTM standard E-2197 ( 1), was used to test the organisms singly and in a mixture. Each 200 μl of the inoculum contained 34 μl each of the four organisms, 40 μl of bovine mucin, 14 μl of yeast extract, and 10 μl of bovine serum albumin stocks. TABLE 1.Organisms in the mixture and their growth/recovery media and titers Organism (ATCC no.) | Growth/recovery medium or host cell line | Procedure for culture and prepn of stock | Viability titer in stock |
---|
Mycobacterium terrae pBEN genetically modified in-house (ATCC 15755) | Middlebrook 7H11 agar, OADC,a and kanamycin (10 μg/ml); incubation 20 days at 36 ± 1°C | 7H9 broth with ADCb and glycerol; cells washed and resuspended in deionized water (8 ml) in a Bijoux bottle (Wheaton, Millville, NJ) with glass beads (Sigma-Aldrich; 3 mm in diam; catalog no. Z143928) and stored at 4°C | 3.7 × 109 CFU/ml | Geobacillus stearothermophilus (ATCC 12980) | Trypticase soy agar plates incubated at 56°C for 48 h | Spores heat shocked at 100°C for 45 min, washed in deionized H2O, and stored at 4°C | 1.5 × 108 CFU/ml | Acinetobacter baumannii (ATCC 19606) | Trypticase soy agar plates incubated at 36 ± 1°C for 24 h | Inoculated into Trypticase soy broth and incubated for 24 h at 36 ± 1°C, broth centrifuged, and pellet resuspended in deionized H2O and stored at 4°C | 1.2 × 109 CFU/ml | Hepatitis A virus (ATCC VR-1402) | FRhK-4 cells (CRL-1688) infected and incubated for 6 days | Cells grown in MEMc with 7% (vol/vol) fetal bovine serum (Fisher; M33-500) and 1% nonessential amino acids (Gibco; 11140) at 36 ± 1°C, monolayers infected and incubated at 36 ± 1°C for 7 days in medium with no antibiotics, flasks frozen and thawed (thrice), cell lysate centrifuged, and supernatant aliquoted for storage at −80°C | 8 × 108 PFU/ml | Open in a separate windowaOADC, oleic acid-albumin-dextrose-catalase. bADC, albumin dextrose-catalase. cMEM, minimal essential medium.Disinfectants tested were peracetic acid (PAA; 500 and 1,000 ppm), chlorine dioxide (CD; 500 and 1,000 ppm), and domestic bleach (DB; 2,500, 3,300, and 5,000 ppm). Buffered saline (pH 7.2) was the control fluid, eluent, and diluent. Hard water (400 ppm CaCO 3) was the diluent for disinfectants ( 1).Each disk received 10 μl of the inoculum, dried and covered with 50 μl of test substance, or saline at 22 ± 2°C. At the end of the contact time, each disk was eluted in a neutralizer and the eluates were assayed ( 1, 9, 11, 12). The neutralizer consisted of 1% dextrose (Difco), 0.7% lecithin (Alfa Aesar), 0.25% sodium bisulfite (J. T. Baker), 0.1% sodium thioglycolate (Sigma), 0.6% sodium thiosulfate (Analar), 0.2% l-cysteine (Sigma), 0.5% tryptone (Oxoid), and 0.1% Tween 80 (Bioshop) in buffered saline (pH 7.2). In each experiment, three control and three test carriers were used, and all experiments were repeated thrice. The performance criteria for the tested substances were ≥3.0 log 10 reduction in PFU of the virus and ≥6.0 log 10 reductions in the CFU for the other three organisms. When the mixture of test organisms was used, the components were separated by first passing the mixture through a membrane filter (0.22-μm pore diameter) to retain all the organisms except the virus. The filtrate was subjected to plaque assays for HAV in FRhK-4 cells. For the three bacteria, separate filters were placed on appropriate agar plates (Table ) and incubated.The data for 5-min contact are given in Table . All levels of the disinfectants tested met the criterion for M. terrae and A. baumannii when tested individually or in mixture. Only 1,000 ppm of PAA was effective against the spores. Both levels of PAA were ineffective against HAV, while the other disinfectants could reduce its titer between 3.5 and 4 log 10. Only 1,000 ppm of PAA could consistently meet the criterion for sporicidal activity after 10 min (data not shown). Extending the contact time to 20 min allowed both levels of PAA and DB to meet the criterion for sporicidal activity, while 500 ppm of CD failed to do so; CD at 1,000 ppm barely met the criterion when tested alone against the spores but could not do so in the mixture (Fig. ). Open in a separate windowReductions of G. stearothermophilus spores by the test formulations after 20 min of contact, individually and in a mixture at 22 ± 2°C. TABLE 2.Reductions by the test formulations in 5 min at 22 ± 2°C when tested against each organism individually and in a mixture Disinfectant (concn [ppm]) | Mean log10 reduction ± SD of:
|
---|
M. terrae
| A. baumannii
| G. stearothermophilus
| Hepatitis A virus
|
---|
Individual | Mixture | Individual | Mixture | Individual | Mixture | Individual | Mixture |
---|
Peracetic acid (500) | 8.18 ± 0.19 | 7.33 ± 0.16 | 7.19 ± 0.03 | 6.33 ± 0.03 | 4.03 ± 0.08 | 4.45 ± 0.98 | Not tested | 0.30 ± 0.01 | Peracetic acid (1,000) | 8.18 ± 0.19 | 7.33 ± 0.16 | 7.19 ± 0.03 | 6.33 ± 0.03 | 8.03 ± 0.28 | 7.21 ± 0.59 | 0.58 ± 0.22 | 0.68 ± 0.09 | Chlorine dioxide (500) | 8.18 ± 0.19 | 7.72 ± 0.21 | 7.22 ± 0.03 | 6.37 ± 0.13 | 1.47 ± 0.45 | 0.69 ± 0.05 | 4.30 ± 0.18 | 3.97 ± 0.19 | Chlorine dioxide (1,000) | 8.18 ± 0.19 | 7.72 ± 0.21 | 7.22 ± 0.03 | 6.37 ± 0.13 | 3.07 ± 0.09 | 1.27 ± 0.05 | 4.30 ± 0.18 | 3.97 ± 0.19 | Domestic bleach (2,500) | 8.18 ± 0.19 | 7.72 ± 0.21 | 7.22 ± 0.03 | 6.37 ± 0.13 | 0.27 ± 0.03 | 0.25 ± 0.02 | 4.41 ± 0.23 | 3.97 ± 0.29 | Domestic bleach (3,500) | 8.18 ± 0.19 | 7.72 ± 0.21 | 7.22 ± 0.03 | 6.37 ± 0.13 | 0.27 ± 0.03 | 0.25 ± 0.02 | 4.41 ± 0.23 | 3.45 ± 0.09 | Domestic bleach (5,000) | 8.18 ± 0.19 | 7.72 ± 0.21 | 7.22 ± 0.03 | 6.37 ± 0.13 | 0.28 ± 0.01 | 0.25 ± 0.02 | 4.41 ± 0.23 | 3.97 ± 0.29 | Open in a separate windowThe study showed the feasibility of testing liquid chemicals against a mixture of suitable surrogates for infectious bioagents. This approach allowed standardized and simultaneous assessment of the spectrum of microbicidal activities of the test formulations under identical conditions that better simulate field conditions and that can be readily adapted to test foams and gaseous chemicals on other carrier materials. The surrogates selected covered the spectrum of microbicide resistances of all currently known classes of infectious bioagents. A. baumannii is among the more environmentally stable and microbicide-resistant vegetative bacteria known ( 7, 13). M. terrae represented pathogens with generally higher resistance to microbicides ( 3) and possibly drug-resistant Mycobacterium tuberculosis and category C agents ( 6). HAV, a small, nonenveloped virus known for its stability and microbicide resistance ( 9), represented select agents (CBW, biological weapons classification, 2001 [ http://www.selectagents.gov/Select%20Agents%20and%20Toxins%20List.html]) and also food- and waterborne pathogens listed as biothreats ( 2, 10). The spores of G. stearothermophilus may be more resistant to oxidizing chemicals than the spores of Bacillus anthracis ( 8); their thermophilic nature made them safer to handle and easy to separate from the mixtures.The disinfectants were selected for their commercial availability and broad-spectrum and relatively rapid action ( 5, 14). The last criterion excluded all but oxidizers because other common active agents are limited as microbicides and/or require hours of contact for sporicidal action.For PAA tests, the recovery of infectious HAV in the absence of any viable spores is somewhat anomalous but not surprising. While we do not believe HAV to be more resistant than bacterial spores, the small size of the virus in the dried inocula likely afforded it significant protection. Compared to HAV, the mycobacterium proved more susceptible to all the disinfectants tested. This highlights a serious weakness in the traditional rankings of disinfectant susceptibility, where mycobacteria are often considered more resistant than nonenveloped viruses ( 5, 14).In the initial trials with the mixtures, the titer of A. baumannii dropped sharply; using virus pools without antibiotics resolved the issue. The ability of A. baumannii to grow on 7H11 agar and thus interfere with the recovery of M. terrae was addressed by replacing the standard strain of M. terrae with one containing a kanamycin resistance gene ( 15). Incorporation of enough kanamycin in 7H11 suppressed the growth of A. baumannii while allowing the mycobacterium to grow.Using a mixture of surrogates in QCT not only proved feasible but also highlighted the need to review certain long-held concepts about the relative sensitivities of classes of pathogens to disinfectants. The details reported should allow extension of the work to CL-3 and possibly CL-4 agents to confirm that the results obtained with the carefully chosen surrogates are indeed applicable to various classes of infectious bioagents. 相似文献
12.
Melioidosis has been considered an emerging disease in Brazil since the first cases were reported to occur in the northeast region. This study investigated two municipalities in Ceará state where melioidosis cases have been confirmed to occur. Burkholderia pseudomallei was isolated in 26 (4.3%) of 600 samples in the dry and rainy seasons.Melioidosis is an endemic disease in Southeast Asia and northern Australia ( 2, 4) and also occurs sporadically in other parts of the world ( 3, 7). Human melioidosis was reported to occur in Brazil only in 2003, when a family outbreak afflicted four sisters in the rural part of the municipality of Tejuçuoca, Ceará state ( 14). After this episode, there was one reported case of melioidosis in 2004 in the rural area of Banabuiú, Ceará ( 14). And in 2005, a case of melioidosis associated with near drowning after a car accident was confirmed to occur in Aracoiaba, Ceará ( 11).The goal of this study was to investigate the Tejuçuoca and Banabuiú municipalities, where human cases of melioidosis have been confirmed to occur, and to gain a better understanding of the ecology of Burkholderia pseudomallei in this region.We chose as central points of the study the residences and surrounding areas of the melioidosis patients in the rural areas of Banabuiú (5°18′35″S, 38°55′14″W) and Tejuçuoca (03°59′20″S, 39°34′50′W) (Fig. ). There are two well-defined seasons in each of these locations: one rainy (running from January to May) and one dry (from June to December). A total of 600 samples were collected at five sites in Tejuçuoca (T1, T2, T3, T4, and T5) and five in Banabuiú (B1, B2, B3, B4, and B5), distributed as follows (Fig. ): backyards (B1 and T1), places shaded by trees (B2 and T2), water courses (B3 and T3), wet places (B4 and T4), and stock breeding areas (B5 and T5). Open in a separate windowMunicipalities of Banabuiú (5°18′35″S, 38°55′14″W) and Tejuçuoca (03°59′20″S, 39°34′50″W). Open in a separate windowSoil sampling sites in Banabuiú and Tejuçuoca.Once a month for 12 months (a complete dry/rainy cycle), five samples were gathered at five different depths: at the surface and at 10, 20, 30 and 40 cm (Table ). The samples were gathered according to the method used by Inglis et al. ( 9). Additionally, the sample processing and B. pseudomallei identification were carried out as previously reported ( 1, 8, 9). TABLE 1.Distribution of samples with isolates by site and soil depth Sitesa and depth (cm) | No. of B. pseudomallei isolates in samples from:
|
---|
Banabuiú (n = 300) | Tejuçuoca (n = 300) | Total (n = 600) |
---|
B1/T1 | | | 3 | Surface | 2 | | | 10 | | | | 20 | | 1 | | 30 | | | | 40 | | | | B2/T2 | | | 1 | Surface | 1 | | | 10 | | | | 20 | | | | 30 | | | | 40 | | | | B3/T3 | | | 15 | Surface | | 2 | | 10 | | 2 | | 20 | | 4 | | 30 | | 3 | | 40 | | 4 | | B4/T4 | | | 5 | Surface | | | | 10 | | 1 | | 20 | 1 | | | 30 | 1 | 1 | | 40 | 1 | | | B5/T5 | | | 2 | Surface | | | | 10 | | | | 20 | | | | 30 | | 2 | | 40 | | | | Total | 6 | 20 | 26 | Open in a separate windowaSites designated with B are in Banabuiú, and sites designated with T are in Tejuçuoca. See the text for details.The data on weather and soil composition were obtained from specialized government institutions, such as FUNCEME, IPECE, and EMBRAPA. The average annual temperature in both municipalities is between 26 and 28°C. In 2007, the annual rainfall in Tejuçuoca was 496.8 mm, and that in Banabuiú was 766.8 mm. There are a range of soil types in both Tejuçuoca and Banabuiú: noncalcic brown, sodic planossolic, red-yellow podzolic, and litholic. In Banabuiú, there are also alluvial and cambisol soils. The characteristic vegetation in both municipalities is caatinga (scrublands).There were isolates of B. pseudomallei in 26 (4.3%) of the 600 samples collected. The bacterium was isolated at a rate (3%) similar to that previously reported ( 9). The bacterium isolation occurred in both the dry (53.8%) and the rainy (46.2%) seasons. Tejuçuoca represented 76.9% (20/26) of the strains isolated. Four sites in Tejuçuoca (T1, T3, T4, and T5) and three in Banabuiú (B1, B2, and B4) presented isolates of the bacterium (Table ). The isolation of the B. pseudomallei strains varied from the surface down to 40 cm. However, 17 of the 26 positive samples (65.3%) were found at depths between 20 and 40 cm (Table ). Only two isolates were found at the surface during the dry season.A study in Vietnam ( 13) and one in Australia ( 9) reported the presence of B. pseudomallei near the houses of melioidosis patients. In our study, the same thing happened. Site T3 (15/26; 57.6%) was located 290 m from the patient''s house, as reported by the Rolim group ( 14). B. pseudomallei was isolated from a sheep paddock in Australia, where animals sought shelter below mango and fig trees ( 17). In our study, the bacterium was isolated at site T5, a goat corral alongside the house where the outbreak occurred in Tejuçuoca. Four sites in places shaded by trees yielded positive samples (30.7%) in both Tejuçuoca (palm trees) and Banabuiú (mango trees). Additionally, B. pseudomallei was isolated on three occasions from a cornfield (site 4B) located alongside the house of the melioidosis patient in Banabuiú.In the main areas of endemicity, the disease is more prevalent in the rainy season ( 4, 5, 16). The outbreak in Tejuçuoca was related to rainfall ( 14). Besides the association of cases of the disease with rainfall itself, the isolation of B. pseudomallei in soil and water was also demonstrated during the dry season ( 12, 15). An Australian study isolated strains from soil and water during the dry and rainy seasons ( 17). A Thai study also reported B. pseudomallei in the dry season ( 18). In our study, the isolation of B. pseudomallei took place either at the end of the wet season or in the dry months. Fourteen of the positive samples (53.8%) were collected during the dry season, albeit near a river or reservoir (sites T3 and B4).Physical, biological, and chemical soil features appear to influence the survival of B. pseudomallei ( 6, 10). In the present study, the soil was classified as litholic with sandy or clayey textures. It is susceptible to erosion, and when there is a lack of water, it is subject to salinization. During the dry season, the clay layer becomes dried, cracked, and very hard. During the rainy season, it becomes soggy and sticky. The isolation of B. pseudomallei in the dry season is possibly related to the capacity for adaptation of this soil, since the extreme conditions of lithosols do not prevent the bacterial growth and survival.It has been shown that B. pseudomallei is more often isolated at depths between 25 and 45 cm ( 17). In our study, 65.3% of the positive samples were taken at depths between 20 and 40 cm. Moreover, of these 17 samples, 10 (58.8%) were collected during the dry months. Also, unlike in other regions, two positive samples were taken from the surface in the period without rainfall.The rainfall in Tejuçuoca and Banabuiú is generally low, and temperatures do not vary significantly during the year. Therefore, the isolation of B. pseudomallei in these places occurs outside the rainfall, temperature, and moisture conditions observed in other regions of endemicity. Our data thus suggest that peculiar environmental features, such as soil composition, might favor the multiplication of B. pseudomallei in northeast Brazil. 相似文献
14.
Feeding high levels of zinc oxide to piglets significantly increased the relative abundance of ileal Weissella spp., Leuconostoc spp., and Streptococcus spp., reduced the occurrence of Sarcina spp. and Neisseria spp., and led to numerical increases of all Gram-negative facultative anaerobic genera. High dietary zinc oxide intake has a major impact on the porcine ileal bacterial composition.Zinc oxide (ZnO) is used as a feed additive for diarrhea prophylaxis in piglets ( 23). However, the mode of action of ZnO is not fully understood. Besides its effects on the host ( 10, 30, 31), high dietary zinc levels may affect the diversity of intestinal microbial communities ( 2, 11, 20). The prevention of postweaning diarrhea in piglets due to high dietary ZnO intake may not be directly related to a reduction of pathogenic E. coli ( 8) but, rather, to the diversity of the coliform community ( 15). Studies on the impact of high ZnO levels on the porcine ileal bacterial community are scarce but nevertheless important, as bacterial diarrhea is initiated in the small intestine ( 9, 17). The small intestine is a very complex habitat with many different factors shaping the bacterial community. Studies on the ecophysiology ( 22) and maturation of the porcine ileal microbiota ( 13, 27) indicate a drastic impact directly after weaning and a gradual decline of modifications during the following 2 weeks. Thus, the time point for analysis chosen in this study (14 days postweaning) does reflect a more stable period of the ileal porcine microbiota. In this study, we used bar-coded pyrosequencing of 16S rRNA genes to gain further insight into the mode of action of pharmacological levels of ZnO in the gastrointestinal tract of young pigs.Total DNA was extracted from the ileal digesta of 40- to 42-day-old piglets using a commercial kit (Qiagen stool kit; Qiagen, Hilden, Germany) and PCR amplified with unique bar-coded primer sets targeting the V1-to-V3 and the V6-to-V8 hypervariable regions (see the supplemental material for detailed methods). The rationale behind this approach was derived from the fact that no single “universal” primer pair can completely cover a complex bacterial habitat ( 4, 24, 32, 33). Furthermore, these studies also show that in silico information on the coverage of selected primer sets diverges from empirical results, and hence, two hypervariable regions were chosen in this study to maximize the detection of phylogenetically diverse bacterial groups.Equimolar dilutions of all samples were combined into one master sample. Pyrosequencing was performed by Agowa (Berlin, Germany) on a Roche genome sequencer FLX system using a Titanium series PicoTiterPlate. The resulting data files were uploaded to the MG-RAST server ( http://metagenomics.nmpdr.org/) ( 19) and processed with its SEED software tool using the RDP database ( 5) as the reference database. After automated sequence analysis, all sequences with less than five identical reads per sample were deleted in order to increase the confidence of sequence reads and reduce bias from possible sequencing errors ( 12, 16). Thus, 0.43% of all sequences were not considered (1,882 of 433,302 sequences). These sequences were assigned to a total of 238 genera, of which most only occurred in a few samples (see the supplemental material). Furthermore, all unclassified sequences were removed (8.7%; 41,467 of 474,769 sequences). Due to the use of the RDP reference database, the SEED software incorrectly assigned the majority of unclassified sequences as unclassified Deferribacterales (83%; 34,393 sequences), which were actually identified as 16S soybean or wheat chloroplasts by BLAST or as cyanobacterial chloroplasts by the RDP II seqmatch tool.The pyrosequencing results for the two primer combinations were merged by taking only sequences from the primer combination that yielded the higher number of reads for a specific sequence assignment in a sample. The remaining reads were used to calculate the relative contribution of assigned sequences to total sequence reads in a sample.The Firmicutes phylum dominated the small intestinal bacterial communities in both the control group and the group with high dietary ZnO intake, with 98.3% and 97.0% of total sequence reads, respectively. No significant influence of high dietary ZnO intake was found for the main phyla Proteobacteria (0.92% versus 1.84%), Actinobacteria (0.61% versus 0.75%), Bacteroidetes (0.15% versus 0.17%), and Fusobacteria (0.09% versus 0.12%).On the order level, a total of 20 bacterial orders were detected (data not shown). Lactobacillales dominated bacterial communities in the control and high-dietary-ZnO-intake groups, with 83.37% and 93.24% of total reads. Lactic acid bacteria are well known to dominate the bacterial community in the ileum of piglets ( 11, 22). No significant difference between the control group and the group with high dietary ZnO intake was observed on the order level, although high dietary ZnO intake led to a strong numerical decrease for Clostridiales (14.4 ± 24.0% [mean ± standard deviation] versus 2.8 ± 1.7%), as well as to numerical increases for Pseudomonadales (0.3 ± 0.3% versus 0.6 ± 0.6%) and Enterobacteriales (0.2 ± 0.2% versus 0.5 ± 0.6%).On the genus level, a total of 103 genera were detected. Table summarizes the main 31 genera which exceeded 0.05% of total reads (see the supplemental material for a complete list). Lactobacilli clearly dominated the bacterial communities in both trial groups, but they also were numerically lower due to high dietary ZnO intake. TABLE 1.Bacterial genera in the ileum of piglets fed diets supplemented with 200 or 3,000 ppm ZnO Genus | Proportion (% ± SD) of ileal microbiota in groupa receiving:
|
---|
200 ppm ZnO | 3,000 ppm ZnO |
---|
Lactobacillus | 59.3 ± 30.6 | 40.7 ± 19.1 | Weissella | 11.6 ± 7.8 A | 24.1 ± 8.3 B | Sarcina | 11.4 ± 20.5 A | 0.84 ± 1.2 B | Leuconostoc | 4.7 ± 3.2 A | 9.4 ± 3.1 B | Streptococcus | 1.8 ± 1.6 A | 5.7 ± 5.1 B | Lactococcus | 1.6 ± 1.5 | 2.6 ± 3.1 | Veillonella | 0.57 ± 0.63 | 0.34 ± 0.30 | Gemella | 0.34 ± 0.67 A | 0.45 ± 0.25 B | Acinetobacter | 0.25 ± 0.21 | 0.44 ± 0.50 | Clostridium | 0.25 ± 0.40 | 0.22 ± 0.21 | Enterococcus | 0.19 ± 0.15 | 0.26 ± 0.24 | Acidovorax | 0.14 ± 0.04 | 0.16 ± 0.19 | Arcobacter | 0.14 ± 0.15 | 0.16 ± 0.17 | Neisseria | 0.14b | 0.03 ± 0.01 | Enterobacter | 0.13 ± 0.09 | 0.29 ± 0.34 | Lachnospira | 0.12 ± 0.13 | 0.13 ± 0.03 | Peptostreptococcus | 0.11 ± 0.10 | 0.07 ± 0.09 | Chryseobacterium | 0.10 ± 0.07 | 0.15 ± 0.16 | Actinomyces | 0.09 ± 0.04 | 0.15 ± 0.16 | Anaerobacter | 0.07 ± 0.08 | 0.02 ± 0.01 | Aerococcus | 0.07 ± 0.04 | 0.07 ± 0.04 | Dorea | 0.07b | 0.05 ± 0.05 | Fusobacterium | 0.06 ± 0.09 | 0.08 ± 0.11 | Microbacterium | 0.06 ± 0.01 | 0.07 ± 0.04 | Carnobacterium | 0.06 ± 0.02 | 0.08 ± 0.13 | Granulicatella | 0.06 ± 0.02 | 0.09 ± 0.10 | Staphylococcus | 0.06 ± 0.04 | 0.05 ± 0.02 | Facklamia | 0.05 ± 0.06 | 0.03 ± 0.01 | Comamonas | 0.05 ± 0.03 | 0.04 ± 0.02 | Citrobacter | 0.05 ± 0.02 | 0.07 ± 0.08 | Erysipelothrix | 0.05 ± 0.01 | 0.22 ± 0.40 | Open in a separate windowan = 6 piglets per trial group. A,B, results are significantly different by Kruskal-Wallis test. bSingle sample.Significant changes due to high dietary ZnO intake were observed for other lactic acid bacteria, including Weissella spp., Leuconostoc spp., and Streptococcus spp. A significant and strong decrease was observed for Sarcina spp., which is a genus of acid-tolerant strictly anaerobic species found in the intestinal tract of piglets and other mammals ( 6, 28, 29). This genus thus appeared to be very sensitive to modifications induced by high dietary ZnO intake.An interesting result was observed for Gram-negative Proteobacteria, (i.e., enterobacteria and relatives). Although not statistically significant, virtually all detected proteobacteria increased numerically due to high dietary ZnO intake ( Enterobacter spp., Microbacterium spp., Citrobacter spp., Neisseria spp., and Acinetobacter spp.). Apparently, enterobacteria gained colonization potential by high dietary ZnO intake. This is in good agreement with the results of studies by Hojberg et al. ( 11), Amezcua et al. ( 1), and Castillo et al. ( 3). Therefore, the frequently observed diarrhea-reducing effect of zinc oxide may not be directly related to a reduction of pathogenic E. coli strains. Considering a possible antagonistic activity of lactobacilli against enterobacteria ( 25), it can be speculated that a numerical decrease of dominant lactobacilli may lead to increased colonization with Gram-negative enterobacteria. On the other hand, specific plasmid-borne genes for resistance against heavy metals have been reported for both Gram-positive and Gram-negative bacteria present in the intestine ( 21, 26), and an increased resistance against Zn ions may exist for Gram-negative enterobacteria. Zinc oxide is an amphoteric molecule and shows a high solubility at acid pH. The low pH in the stomach of piglets (pH 3.5 to 4.5) transforms a considerable amount of insoluble ZnO into zinc ions (54 to 84% free Zn 2+ at 150 ppm and 24 ppm ZnO, respectively) ( 7), and thus, high concentrations of toxic zinc ions exist in the stomach. The stomach of piglets harbors large numbers of lactic acid bacteria, especially lactobacilli. Zn ions may thus lead to a modification of the lactic acid bacterial community in the stomach, and the changes observed in the ileum could have been created in the stomach. A reduction of dominant lactobacilli may thus point to an increased adaptation potential of Gram-negative facultative anaerobes and a generally increased bacterial diversity.Additionally, the direct effects of dietary ZnO on intestinal tissues include altered expression of genes responsible for glutathione metabolism and apoptosis ( 30), enhanced gastric ghrelin secretion, which increases feed intake ( 31), and increased production of digestive enzymes ( 10). An analysis of the intestinal morphology was beyond the scope of this study, but although ZnO concentrations are markedly increased in intestinal tissue, the influence of ZnO on morphology is apparently not always observed ( 10, 14, 18). Consequently, any changes in epithelial cell turnover, feed intake, or digestive capacity may influence the composition of bacterial communities in the small intestine.In conclusion, this study has shown that high dietary zinc oxide has a major impact on ileal bacterial communities in piglets. Future studies on the impact of zinc oxide in pigs should include a detailed analysis of host responses in order to identify the cause for the observed modifications of intestinal bacterial communities. 相似文献
16.
A real-time quantitative PCR-based detection assay targeting the dnaJ gene (encoding heat shock protein 40) of the coral pathogen Vibrio coralliilyticus was developed. The assay is sensitive, detecting as little as 1 CFU per ml in seawater and 10 4 CFU per cm 2 of coral tissue. Moreover, inhibition by DNA and cells derived from bacteria other than V. coralliilyticus was minimal. This assay represents a novel approach to coral disease diagnosis that will advance the field of coral disease research. Vibrio coralliilyticus has recently emerged as a coral pathogen of concern on reefs throughout the Indo-Pacific. It was first implicated as the etiological agent responsible for bleaching and tissue lysis of the coral Pocillopora damicornis on Zanzibar reefs ( 2). More recently, V. coralliilyticus has been identified as the causative agent of white syndrome (WS) outbreaks on several Pacific reefs ( 14). WS is a collective term describing coral diseases characterized by a spreading band of tissue loss exposing white skeleton on Indo-Pacific scleractinian corals ( 16). V. coralliilyticus is an emerging model pathogen for understanding the mechanisms linking bacterial infection and coral disease ( 13) and therefore provides an ideal model for the development of diagnostic assays to detect coral disease. Current coral disease diagnostic methods, which are based primarily upon field-based observations of macroscopic disease signs, often detect disease only at the latest stages of infection, when control measures are least effective. The development of diagnostic tools targeting pathogens underlying coral disease pathologies may provide early indications of infection, aid the identification of disease vectors and reservoirs, and assist managers in developing strategies to prevent the spread of coral disease outbreaks. In this paper, we describe the development and validation of a TaqMan-based real-time quantitative PCR (qPCR) assay that targets a segment of the V. coralliilyticus heat shock protein 40-encoding gene ( dnaJ).Nucleotide sequences of the dnaJ gene were retrieved from relevant Vibrio species, including V. coralliilyticus (LMG 20984), using the National Center for Biotechnology Information''s (NCBI) Entrez Nucleotide Database search tool ( http://www.ncbi.nlm.nih.gov/). Gene sequences of strains not available in public databases ( V. coralliilyticus strains LMG 21348, LMG 21349, LMG 21350, LMG 10953, LMG 20538, LMG 23696, LMG 23691, LMG 23693, LMG 23692, and LMG 23694) were obtained through extraction of total DNA using a Promega Wizard Prep DNA Purification Kit (Promega, Sydney, Australia), PCR amplification, and sequencing using primers and thermal cycling parameters described by Nhung et al. ( 8). A 128-bp region (nucleotides 363 to 490) containing high concentrations of single nucleotide polymorphisms (SNPs), which were conserved within V. coralliilyticus strains but differed from non- V. coralliilyticus strains, was identified, and oligonucleotide primers Vc_dnaJ_F1 (5′-CGG TTC GYG GTG TTT CAA AA-3′) and Vc_dnaJ_R1 (5′-AAC CTG ACC ATG ACC GTG ACA-3′) and a TaqMan probe, Vc_dnaJ_TMP (5′-6-FAM-CAG TGG CGC GAA G-MGBNFQ-3′; 6-FAM is 6-carboxyfluorescein and MGBNFQ is molecular groove binding nonfluorescent quencher), were designed to target this region. The qPCR assay was optimized and validated using DNA extracted from V. coralliilyticus isolates, nontarget Vibrio species, and other bacterial species grown in marine broth (MB) (Table ), under the following optimal conditions: 1× TaqMan buffer A, 0.5 U of AmpliTaq Gold DNA polymerase, 200 μM deoxynucleotide triphosphates (with 400 μM dUTP replacing deoxythymidine triphosphate), 0.2 U of AmpErase uracil N-glycosylase (UNG), 3 mM MgCl 2, 0.6 μM each primer, 0.2 μM fluorophore-labeled TaqMan, 1 μl of template, and sterile MilliQ water for a total reaction volume to 20 μl. All assays were conducted on a RotoGene 300 (Corbett Research, Sydney, Australia) real-time analyzer with the following cycling parameters: 50°C for 120 s (UNG activation) and 95°C for 10 min (AmpliTaq Gold DNA polymerase activation), followed by 40 cycles of 95°C for 15 s (denaturation) and 60°C for 60 s (annealing/extension). During the annealing/extension phase of each thermal cycle, fluorescence was measured in the FAM channel (470-nm excitation and 510-nm detection). TABLE 1.Species, strain, and threshold cycle for all bacterial strains tested aSpecies | Strainb | Origin | Host organism | CT ± SEMc | dnaJ gene sequence accession no. | Reference |
---|
Vibrio coralliilyticus | LMG 23696 | Nelly Bay, Magnetic Island, Australia | Montipora aequituberculata | 12.43 ± 0.20 | {"type":"entrez-nucleotide","attrs":{"text":"HM215570","term_id":"298112849","term_text":"HM215570"}}HM215570 | 14 | | LMG 23691 | Majuro Atoll, Republic of Marshall Islands | Acropora cytherea | 14.07 ± 1.33 | {"type":"entrez-nucleotide","attrs":{"text":"HM215571","term_id":"298112851","term_text":"HM215571"}}HM215571 | 14 | | LMG 23693 | Nikko Bay, Palau | Pachyseris speciosa | 10.83 ± 2.76 | {"type":"entrez-nucleotide","attrs":{"text":"HM215572","term_id":"298112853","term_text":"HM215572"}}HM215572 | 14 | | LMG 23692 | Nikko Bay, Palau | Pachyseris speciosa | 9.40 ± 0.36 | {"type":"entrez-nucleotide","attrs":{"text":"HM215573","term_id":"298112855","term_text":"HM215573"}}HM215573 | 14 | | LMG 23694 | Nikko Bay, Palau | Pachyseris speciosad | 12.54 ± 0.24 | {"type":"entrez-nucleotide","attrs":{"text":"HM215574","term_id":"298112857","term_text":"HM215574"}}HM215574 | 14 | | LMG 20984T | Indian Ocean, Zanzibar, Tanzania | Pocillopora damicornis | 12.80 ± 0.71 | {"type":"entrez-nucleotide","attrs":{"text":"HM215575","term_id":"298112859","term_text":"HM215575"}}HM215575 | 2 | | LMG 21348 | Red Sea, Eilat, Israel | Pocillopora damicornis | 13.81 ± 0.49 | {"type":"entrez-nucleotide","attrs":{"text":"HM215576","term_id":"298112861","term_text":"HM215576"}}HM215576 | 3 | | LMG 21349 | Red Sea, Eilat, | Pocillopora damicornis | 12.98 ± 0.94 | {"type":"entrez-nucleotide","attrs":{"text":"HM215577","term_id":"298112863","term_text":"HM215577"}}HM215577 | 3 | | LMG 21350 | Red Sea, Eilat, | Pocillopora damicornis | 11.49 ± 0.19 | {"type":"entrez-nucleotide","attrs":{"text":"HM215578","term_id":"298112865","term_text":"HM215578"}}HM215578 | 3 | | LMG 10953 | Kent, United Kingdom | Crassostrea gigas (oyster) larvae | 10.53 ± 0.40 | {"type":"entrez-nucleotide","attrs":{"text":"HM215579","term_id":"298112867","term_text":"HM215579"}}HM215579 | 3 | | LMG 20538 | Atlantic Ocean, Florianópolis, Brazil | Nodipecten nodosus (bivalve) larvae | 12.13 ± 0.50 | {"type":"entrez-nucleotide","attrs":{"text":"HM215580","term_id":"298112869","term_text":"HM215580"}}HM215580 | 3 | | C1 | Caribbean Sea, La Parguera, Puerto Rico | Pseudopterogorgia americana | 14.53 ± 0.28 | {"type":"entrez-nucleotide","attrs":{"text":"HM215568","term_id":"298112845","term_text":"HM215568"}}HM215568 | 15 | | C2 | Caribbean Sea, La Parguera, Puerto Rico | Pseudopterogorgia americana | NA | {"type":"entrez-nucleotide","attrs":{"text":"HM215569","term_id":"298112847","term_text":"HM215569"}}HM215569 | 15 | Vibrio alginolyticus | ATCC 17749 | | | 33.74 ± 0.33 | | | Vibio brasiliensis | DSM 17184 | | | 37.84† | | | Vibrio calviensis | DSM 14347 | | | 27.06 ± 0.52 | | | Vibrio campbellii | ATCC 25920T | | | 39.10† | | | Enterovibrio campbellii | LMG 21363 | | | 37.33 ± 2.41 | | | Alliivibrio fischeri | DSM 507 | | | 31.36 ± 1.42 | | | Vibrio fortis | DSM 19133 | | | NA | | | Vibrio furnissii | DSM 19622 | | | NA | | | Vibrio harveyi | DSM 19623 | | | NA | | | Vibrio natriegens | ATCC 14048 | | | 28.56 ± 0.60 | | | Vibrio neptunius | LMG 20536 | | | NA | | | Vibrio ordalii | ATCC 33509 | | | 25.56 ± 0.41 | | | Vibrio parahaemolyticus | ATCC 17802 | | | NA | | | Vibrio proteolyticus | ATCC 15338 | | | 30.00 ± 0.89†† | | | Vibrio rotiferianus | LMG 21460 | | | NA | | | Vibrio splendidus | ATCC 33125 | | | 32.31 ± 0.82 | | | Vibrio tubiashii | ATCC 19109 | | | NA | | | Vibrio xuii | LMG 21346 | | | NA | | | Escherichia coli | ATCC 25922 | | | NA | | | Psychrobacter sp. | AIMS 1618 | | | NA | | | Shewanella sp. | AIMS C041 | | | 25.34 ± 0.45 | | | Open in a separate windowaOrigin, host organism, and dnaJ gene sequence accession numbers are shown for V. coralliilyticus strains. bStrain designations beginning with LMG were derived from the Belgian Coordinated Collections of Microorganisms, ATCC strains are from the American Type Culture Collection, DSM strains are from the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH culture collection, AIMS strains are from the Australian Institute of Marine Science culture collection, and C1 and C2 were provided by Pamela Morris. c†, amplification in one of three reactions; ††, amplification in two of three reactions; NA, no amplification. dIsolated from seawater above coral.The qPCR assay specifically detected 12 out of 13 isolated V. coralliilyticus strains tested in this study (Table ). The exception was one Caribbean strain (C2), which failed to give specific amplification despite repeated attempts. Positive detection of the target gene segment was determined by the increase in fluorescent signal beyond the fluorescence threshold value (normalized fluorescence, 0.010) at a specific cycle, referred to as the threshold cycle ( CT). Specific detection was further confirmed by gel electrophoresis, which revealed a PCR product of the correct theoretical size (128 bp) (data not shown), and DNA sequencing, which confirmed the target amplified product to be a segment of the dnaJ gene. No amplification with the assay was detected for 13 other closely related Vibrio strains, including the closely related Vibrio neptunius and two non- Vibrio species (Table ). A total of five other Vibrio strains and one non- Vibrio strain ( Shewanella sp.) exhibited CT values less than the cutoff of 32 cycles. However, CT values for these strains (mean ± standard error of the mean [SEM], 27.96 ± 2.40) were all much higher than those for V. coralliilyticus strains (12.30 ± 1.52), and no amplicons were evident in post-qPCR gel electrophoresis (data not shown).The detection limit for purified V. coralliilyticus genomic DNA was 0.1 pg of DNA, determined by performing 10-fold serial dilutions (100 ng to 0.01 pg per reaction), followed by qPCR amplification. Similarly, qPCR assays of serial dilutions of V. coralliilyticus (LMG 23696) cells cultured overnight in MB (10 8 CFU ml −1 to extinction) were able to detect as few as 10 4 CFU (Fig. ). Standard curves revealed a strong linear negative correlation between CT values and both DNA and cell concentrations of V. coralliilyticus over several orders of magnitude, with r2 values of 0.998 and 0.953 for DNA and cells, respectively (Fig. ). Open in a separate windowStandard curves delineating threshold ( CT) values of fluorescence for indicators of pathogen presence: (A) concentration of V. coralliilyticus DNA and (B) number of V. coralliilyticus cells in pure culture. Error bars indicate standard error of the mean for three replicate qPCRs.Little interference of the qPCR assay was observed when purified V. coralliilyticus (LMG 23696) DNA (10 ng) was combined with 10-fold serial dilutions (0.01 to 100 ng per reaction) of non- V. coralliilyticus DNA (i.e., Vibrio campbellii [ATCC 25920 T]). Over the entire range of nontarget DNA concentrations tested, the resulting CT values (mean ± SEM, 17.76 ± 0.53) were not significantly different from those of a control treatment containing 10 ng of V. coralliilyticus DNA and no nonspecific DNA (16.75 ± 0.18; analysis of variance [ANOVA], P = 0.51) (Table ). Detection of V. coralliilyticus (LMG 23696) bacterial cells (10 4, 10 5, 10 6, 10 7, or 10 8 CFU per ml) in a background of non- V. coralliilyticus cells (i.e., V. campbellii [ATCC 25920 T] at 0, 10, 10 4, or 10 7 CFU per ml) showed little reduction in assay sensitivity (see Fig. S1 in the supplemental material). For example, when V. coralliilyticus was seeded at 10 7 cells with similarly high concentrations of nontarget cells, little inhibition of the assay was observed. TABLE 2.Effect of nontarget bacterial DNA on the detection of 10 ng of purified V. coralliilyticus DNA Amt of nontarget DNA (ng) | CT (mean ± SEM) |
---|
100 | 16.97 ± 0.33 | 10 | 16.9 ± 0.08 | 1 | 16.74 ± 0.10 | 0.1 | 17 ± 0.09 | 0.01 | 16.37 ± 0.43 | 0a | 16.75 ± 0.18 | NTCb | 35.04 ± 0.02 | Open in a separate windowaV. coralliilyticus (LMG 23696) DNA (10 ng) free of nontarget DNA and cells served as positive controls. bA qPCR mixture containing no bacterial DNA served as a no-template, or negative, control (NTC).The assay''s detection limit in seawater was tested by inoculating 10-fold serial dilutions of V. coralliilyticus (LMG 23696) cultures (grown overnight in MB medium, pelleted at 14,000 rpm for 10 min, and washed twice with sterile phosphate-buffered saline [PBS]) into 1 liter of seawater (equivalent final concentrations were 10 6 to 1 CFU ml −1). The entire volume of V. coralliilyticus-seeded seawater was filtered through a Sterivex-GP filter (Millipore), and DNA was extracted using the method described by Schauer et al. ( 11). The lowest detection limit for V. coralliilyticus cells seeded into seawater was 1 CFU ml −1 (Fig. ), with no detection in a 1-liter volume of an unseeded seawater negative control. Standard curves revealed a strong correlation between CT values and the concentrations of V. coralliilyticus bacteria seeded into the seawater over several orders of magnitude ( r2 of 0.968) (Fig. ). Open in a separate windowStandard curves showing CT values of the fluorescent signal versus the number of V. coralliilyticus cells per ml seawater (▿), and cells per cm 2 of M. aequituberculata tissue, with (○) or without (·) enrichment. Each dot represents an independent experiment. Error bars indicate standard error of the mean for three replicate qPCR runs.The detection limit in seeded coral tissue homogenate was determined by seeding 10-fold dilutions (10 10 to 10 3 CFU ml −1) of pelleted, PBS-washed and resuspended (in 10 ml of sterile PBS) V. coralliilyticus cells onto healthy fragments (∼10 cm 2) of the coral Montipora aequituberculata collected from Nelly Bay (Magnetic Island, Australia). Corals were collected in March 2009 and maintained in holding tanks supplied with flowthrough ambient seawater. Resuspended cells were inoculated onto M. aequituberculata fragments, each contained in an individual 3.8-liter plastic bag, allowed to sit at room temperature for 30 min, and then air brushed with compressed air until only white skeleton remained. One-milliliter aliquots of the resulting slurry (PBS, bacteria, and coral tissue) was vortexed for 10 min at 14,000 rpm, and DNA was extracted using a PowerPlant DNA Isolation Kit (Mo Bio, Carlsbad, CA). The lowest detection limits for V. coralliilyticus cells seeded onto coral fragments was 10 4 CFU per cm 2 of coral tissue (Fig. ). Again, standard curves revealed a strong correlation between CT values and the concentrations of seeded bacteria over several orders of magnitude ( r2 of 0.981) (Fig. ). When a 1-ml aliquot of the slurry was also inoculated into 25 ml of MB and enriched for 6 h at 28°C (with shaking at 170 rpm), the detection limit increased by 1 order of magnitude, to 10 3 CFU of V. coralliilyticus per cm 2 of coral tissue (Fig. ). The slope of the standard curve reveals some inhibition, particularly at the highest V. coralliilyticus concentrations, which could result from lower replication rates in the cultures with the highest bacterial densities (i.e., 10 9 CFU). However, since this effect is most pronounced only at the highest bacterial concentrations, the detection limit is still valid. In all trials, unseeded coral fragments and enrichment cultures derived from uninoculated coral fragments served as negative controls.The current study describes the first assay developed to detect and quantify a coral pathogen using a real-time quantitative PCR (qPCR) approach. While previous studies have utilized antibodies or fluorescent in situ hybridization (FISH) to detect coral pathogens ( 1, 6), the combination of high sensitivity and specificity, low contamination risk, and ease and speed of performance ( 5) make qPCR technology an ideal choice for rapid pathogen detection in complex hosts, such as corals. The assay developed is highly sensitive for V. coralliilyticus, detecting as few as 1 CFU ml −1 of seawater and 10 4 CFU cm −2 of coral tissue (10 3 CFU cm −2 of coral tissue with a 6-h enrichment). These detection limits are likely to be within biologically relevant pathogen concentrations. For example, antibodies for specific detection of the coral bleaching pathogen Vibrio shiloi showed that bacterial densities reached 8.4 × 10 8 cells cm −3 1 month prior to maximum visual bleaching signs on the coral Oculina patagonica ( 6). Each seeded seawater and coral (enriched and nonenriched) dilution assay was performed in triplicate. The linearity of the resulting standard curves indicates consistent extraction efficiencies over V. coralliilyticus concentrations spanning 6 orders of magnitude (Fig. ) and provides strong support for the robustness of the assay. In addition, the presence of competing, non- V. coralliilyticus bacterial cells and DNA had a minimal impact on the detection of V. coralliilyticus. This is an important consideration for accurate detection within the complex coral holobiont, where the target organism is present within a matrix of other microbial and host cells. V. coralliilyticus, like V. shiloi ( 10), is becoming a model pathogen for the study of coral disease. Recent research efforts have characterized the organism''s genome (W. R. Johnson et al., submitted for publication), proteome (N. E. Kimes et al., submitted for publication), resistome ( 15), and metabolome ( 4) and enhanced our understanding of the genetic ( 7, 9) and physiological ( 7, 13) basis of its virulence. Before effective management response plans can be formulated, however, continuing research on the genetic and cellular aspects of V. coralliilyticus must be complemented with knowledge of the epidemiology of this pathogen, including information on its distribution, incidence of infection, and rates of transmission throughout populations. The V. coralliilyticus-specific qPCR assay developed in this study will provide important insights into the dynamics of pathogen invasion and spread within populations ( 6) while also aiding in the identification of disease vectors and reservoirs ( 12). These capabilities will play an important role in advancing the field of coral disease research and effective management of coral reefs worldwide. 相似文献
17.
At present there is little quantitative information on the identity and composition of bacterial populations in the rumen microbial community. Quantitative fluorescence in situ hybridization using newly designed oligonucleotide probes was applied to identify the microbial populations in liquid and solid fractions of rumen digesta from cows fed barley silage or grass hay diets with or without flaxseed. Bacteroidetes, Firmicutes, and Proteobacteria were abundant in both fractions, constituting 31.8 to 87.3% of the total cell numbers. They belong mainly to the order Bacteroidales (0.1 to 19.2%), hybridizing with probe BAC1080; the families Lachnospiraceae (9.3 to 25.5%) and Ruminococcaceae (5.5 to 23.8%), hybridizing with LAC435 and RUM831, respectively; and the classes Deltaproteobacteria (5.8 to 28.3%) and Gammaproteobacteria (1.2 to 8.2%). All were more abundant in the rumen communities of cows fed diets containing silage (75.2 to 87.3%) than in those of cows fed diets containing hay (31.8 to 49.5%). The addition of flaxseed reduced their abundance in the rumens of cows fed silage-based diets (to 45.2 to 58.7%) but did not change markedly their abundance in the rumens of cows fed hay-based diets (31.8 to 49.5%). Fibrolytic species, including Fibrobacter succinogenes and Ruminococcus spp., and archaeal methanogens accounted for only a small proportion (0.4 to 2.1% and 0.2 to 0.6%, respectively) of total cell numbers. Depending on diet, between 37.0 and 91.6% of microbial cells specifically hybridized with the probes used in this study, allowing them to be identified in situ. The identities of other microbial populations (8.4 to 63.0%) remain unknown.The rumen is an anaerobic ecosystem used by herbivores to convert fibrous plant material into fermentation products that are in turn used as energy by the host. Fibrolytic degradation is accomplished by a complex microbial community which includes specialized fungi, protozoa, and bacteria ( 14). More than 200 bacterial species ( 5) have been isolated from rumen, and many of these have been phylogenetically and physiologically characterized. Several of these, including Fibrobacter succinogenes, Ruminococcus albus, and Ruminococcus flavefaciens, have the ability to hydrolyze cellulose in axenic culture ( 24). Despite the presence of these fibrolytic populations, a large portion of the fiber in low-quality forage diets passes through the rumen undigested. In the rumen, fibrolytic bacteria do not digest plant cell walls in isolation but rather interact with a consortium of bacteria ( 18). Although culture-dependent studies have improved our understanding of rumen microbiology, the importance of the isolates to the structure and function of the rumen microbial community, with the possible exception of the fibrolytic strains, is still unknown. Expanding our knowledge of the structure and function of the rumen microbial community may provide insights into approaches to improve the efficiency of fiber digestion and biofuel production ( 14).To provide a high-resolution view of the population structure of the rumen bacterial community, we used quantitative fluorescence in situ hybridization (qFISH) to investigate the composition and distribution of bacterial populations associated with the liquid and solid rumen contents from 12 ruminally cannulated Holstein dairy cows (3 cows were used for each diet) fed (for at least 21 days) grass hay or barley silage diets with or without flaxseed (Table ). Six new 16S rRNA-targeted FISH probes (Table ) for not only the fibrolytic groups but also other unclassified bacterial groups in the rumen were designed, using ARB software ( 17), against the rumen 16S rRNA gene sequences (data not shown) retrieved from the Ribosomal Database Project (RDP) database ( 6). The new probes target Bacteroidales-related clones (probe BAC1080) (phylum Bacteroidetes), Lachnospiraceae- and Ruminococcaceae-related clones (probes LAC435 and RUM831, respectively) (phylum Firmicutes), Butyrivibrio fibrisolvens-related clones (probe BFI826), and R. albus- and R. flavefaciens-related clones (probes RAL1436 and RFL155, respectively). TABLE 1.Composition of diets used in this study Ingredient | Diet composition (% dry weight)
|
---|
Hay-based diet | Hay and flaxseed diet | Silage-based diet | Silage and flaxseed diet |
---|
Alfalfa grass hay (chopped) | 47.5 | 47.5 | 0 | 0 | Barley silage | 0 | 0 | 47.5 | 47.5 | Steamed rolled barley grain | 47.5 | 32.5 | 47.5 | 32.5 | Ground flaxseeds | 0 | 15 | 0 | 15 | Other | 5 | 5 | 5 | 5 | Open in a separate windowTABLE 2.Oligonucleotide probes and their target populations used in this study for FISH analyses Probe namea | Target rRNA | Designed target(s) | % FAb | Reference |
---|
EUB338 (00159) | 16S | Domain Bacteria | 0-50 | 16 | EUB338II (00160) | 16S | Phylum Planctomycetes | 0-50 | 16 | EUB338III (00161) | 16S | Phylum Verrucomicrobia | 0-50 | 16 | NONEUB (00243) | 16S | Control probe complementary to EUB338 | 0-50 | 16 | ALF968 (00021) | 16S | Class Alphaproteobacteria, phylum Proteobacteria | 20 | 16 | BET42a (00034) | 23S | Class Betaproteobacteria, phylum Proteobacteria | 35 | 16 | GAM42a (00174) | 23S | Class Gammaproteobacteria, phylum Proteobacteria | 35 | 16 | SRB385 (00300) | 16S | Class Deltaproteobacteria, phylum Proteobacteria | 35 | 16 | SRB385Db (00301) | 16S | Class Deltaproteobacteria, phylum Proteobacteria | 35 | 16 | HGC69a (00182) | 23S | Phylum Actinobacteria | 25 | 16 | GNSB941 (00718) | 16S | Phylum Chloroflexi | 35 | 16 | CFX1223 (00719) | 16S | Phylum Chloroflexi | 35 | 16 | SPIRO1400 (01004) | 16S | Subgroup of family Spirochaetaceae | 20 | 16 | TM7-905 (00600) | 16S | Candidate phylum TM7 | 20 | 16 | LGC354A (00195) | 16S | Phylum Firmicutes | 35 | 16 | LGC354B (00196) | 16S | Phylum Firmicutes | 35 | 16 | LGC354C (00197) | 16S | Phylum Firmicutes | 35 | 16 | RUM831 | 16S | Rumen clones in family Ruminococcaceae, phylum Firmicutes | 35 | This study | RAL1436 | 16S | Ruminococcus albus-related clones, phylum Firmicutes | 20 | This study | RFL155 | 16S | Ruminococcus flavefaciens-related clones, phylum Firmicutes | 45 | This study | LAC435 | 16S | Clones in family Lachnospiraceae, phylum Firmicutes | 35 | This study | BFI826 | 16S | Butyrivibrio fibrisolvens-related clones, phylum Firmicutes | 35 | This study | BAC1080 | 16S | Clones in order Bacteroidales, phylum Bacteroidetes | 20 | This study | Fibr225 (00005) | 16S | Fibrobacter succinogenes-related clones, phylum Fibrobacteres | 20c | 16 | ARCH915 (00027) | 16S | Domain Archaea | 20 | 16 | Open in a separate windowaThe numbers in parentheses after the probe names represent the probe accession numbers in probeBase ( 16). bFA, formamide concentration used in the FISH buffer. cThe optimum formamide concentration for the probe was determined in this study.The optimal formamide concentrations (OFC) of the new probes used in FISH were assessed in different ways. Probes RUM831 and BAC1080 were assessed by using pure cultures of Ruminococcus and Prevotella strains with zero and one mismatch (Fig. ) to the probes. The OFC of probes LAC435 and BFI826 were assessed using Clone-FISH ( 21) with zero and one mismatch 16S rRNA clone (Fig. ) by following the procedure described previously ( 9, 10). The highest formamide concentration (tested in 5% stepwise increases) at which a clear fluorescent signal was observed with the reference bacterium or competent cells with zero mismatches after FISH probing, but not with bacteria or competent cells with one mismatch, was selected. The OFC of probes FIB225 (designed by Stahl et al. [ 23]), RFL155, and RAL1436 were assessed using only pure cultures of F. succinogenes, R. flavefaciens, and R. albus, respectively, all having perfect matches to each probe (Fig. ). The highest formamide concentration (tested in 5% stepwise increases) at which a clear fluorescent signal was observed with the reference bacterium after FISH probing was selected. These probes were employed with other available probes (Table ) chosen from probeBase ( 16) based on the alignment and classification of the 16S rRNA gene sequences retrieved from rumen communities. Open in a separate windowAlignments of the probe sequences and their target sites and sequences of corresponding sites in reference bacteria or clones. The probe names in parentheses after the abbreviated names are according to Oligonucleotide Probe Database nomenclature ( 2). Only the nucleotides that are different from target sequences are shown. E, empty space; R., Ruminococcus; P., Prevotella; F., Fibrobacter.The digest samples from the top, bottom, and middle of the rumen were collected through a cannula, thoroughly mixed, and fractioned as liquid fraction (LiqF) and solid fraction (SolF). On-site, about 100 ml was transferred to a heavy-wall 250-ml beaker and squeezed using a Bodum coffee maker plunger (Bodum Inc., Triengen, Switzerland). The extruded liquid samples (containing the planktonic cells) were fixed in ethanol and paraformaldehyde (PFA) for FISH probing ( 3). The remaining liquid was discarded, and the squeezed particulate samples (used to collect particulate-attached cells) were washed with 100 ml phosphate buffer (5.23 g/liter K 2HPO 4, 2.27 g/liter KH 2PO 4, 3.00 g/liter NaHCO 3, and 20 ml/liter 2.5% cysteine HCl) by stirring gently with a spatula, followed by squeezing again and decanting. Washed particulate samples (5 g) were then fixed for FISH as described above.After fixation, the particulate samples plus the fixation solution were transferred into a stomacher bag and “stomached” (Stomacher 400 Circulator, Seaward England) at 230 rpm for 6 min. Treated samples were then transferred into a clean 250-ml beaker and squeezed again. Microscopic examination of the squeezed residues after DAPI (4′,6-diamidino-2-phenylindole) staining (100 μl [0.003 mg/ml] for 10 min) showed only a few bacterial cells attached on the plant fibers, indicating that most bacterial cells had been “stomached” into the liquid (data not shown). To recover cells, filtrates were centrifuged (5,000 × g), and the cell pellet was washed three times with phosphate buffer before being used for FISH probing. On the day of sampling, each cow was sampled twice, at 1100 h and 1600 h. The liquid FISH samples obtained from the 3 cows fed with the same diet (at two different sampling times) were mixed, as were the particulate FISH samples, and used in qFISH analysis. FISH was carried out according to Amann ( 3). FISH was carried out on glass coverslips (24 by 60 mm) coated with gelatin ( 9). DAPI staining of biomass samples was carried out after FISH probing. FISH and DAPI images were captured with a Zeiss epifluorescence microscope (Zeiss PM III) equipped with a Canon 5D Mark II camera. Raw images captured randomly were transferred into gray TIF images and sharpened in Adobe Photoshop CS3. Cells stained with DAPI and hybridized to the probes were enumerated using the function provided in ImageJ ( 1). The percent compositions of these probe-defined groups (against all DAPI-stained cells in the same microscopic field) in the different fractions of rumen contents from cows fed different diets are presented in Table . TABLE 3.Distribution and composition of FISH probe-defined groups in rumen microbial communities in cows fed with different diets Probe-defined microbial group | Composition (mean value [%] ± SD)a
|
---|
Hay-based diet
| Hay and flaxseed diet
| Silage-based diet
| Silage and flaxseed diet
|
---|
LiqF | SolF | LiqF | SolF | LiqF | SolF | LiqF | SolF |
---|
BAC1080 | 9.6 ± 1.33 | 0.1 ± 0.02 | 19.2 ± 3.71 | 4.2 ± 0.72 | 14.2 ± 3.11 | 18.8 ± 3.88 | 14.4 ± 2.89 | 16.7 ± 4.33 | ALF968 | 0.2 ± 0.02 | 0.2 ± 0.02 | 0.2 ± 0.03 | 0.2 ± 0.04 | 0.7 ± 0.14 | 1.5 ± 0.41 | 0.1 ± 0.01 | 0.1 ± 0.01 | BET42a | 0 | 0 | 0.6 ± 0.01 | 1.2 ± 0.27 | 0.1 ± 0.01 | <0.1 | 0.4 ± 0.06 | 0.2 ± 0.04 | GAM42a | 3.2 ± 0.53 | 4.4 ± 0.57 | 4.2 ± 0.76 | 4.5 ± 0.67 | 2.0 ± 0.32 | 1.2 ± 0.23 | 8.2 ± 1.23 | 5.3 ± 0.95 | SRBmix | 5.8 ± 0.88 | 11.6 ± 2.43 | 9.0 ± 1.52 | 10.1 ± 2.56 | 28.3 ± 4.43 | 23.3 ± 4.54 | 7.7 ± 0.78 | 13.2 ± 2.22 | CHLmix | 1.7 ± 0.27 | 0 | 0.5 ± 0.01 | 0 ± 0 | 0.2 ± 0.02 | 0.4 ± 0.07 | 0.1 ± 0.01 | 0.1 ± 0.02 | SPIRO1400 | 0.5 ± 0.09 | 1.9 ± 0.32 | 1.7 ± 0.33 | 2.0 ± 0.21 | 1.4 ± 0.31 | 1.9 ± 0.33 | 0.4 ± 0.03 | 0.4 ± 0.07 | TM7-905 | 0.6 ± 0.08 | 0.8 ± 0.07 | 0.5 ± 0.01 | 0.1 ± 0.03 | 1.5 ± 0.23 | 0.2 ± 0.02 | 0.6 ± 0.02 | 0.3 ± 0.08 | HGC69a | 1.3 ± 0.28 | 2.1 ± 0.31 | 0.3 ± 0.06 | 0.3 ± 0.05 | 0.4 ± 0.03 | 0.1 ± 0.02 | 0.5 ± 0.09 | 0.2 ± 0.02 | RUM831 | 5.5 ± 0.13 | 5.7 ± 0.89 | 5.8 ± 0.73 | 8.9 ± 1.32 | 18.0 ± 4.13 | 23.8 ± 3.11 | 5.6 ± 1.14 | 7.4 ± 1.32 | RAL1436 | 0.4 ± 0.06 | 0.3 ± 0.03 | 0.2 ± 0.06 | 0.2 ± 0.03 | 0.3 ± 0.05 | 0.6 ± 0.09 | 0.7 ± 0.13 | 0.6 ± 0.12 | RFL155 | 0.7 ± 0.11 | 0.2 ± 0.03 | 0.3 ± 0.07 | 0.7 ± 0.19 | 0.1 ± 0.01 | 0.8 ± 0.11 | 0.5 ± 0.06 | 1.2 ± 0.34 | LAC435 | 25.5 ± 3.98 | 10.0 ± 1.51 | 9.6 ± 1.31 | 11.7 ± 1.67 | 12.6 ± 2.56 | 20.2 ± 3.23 | 9.3 ± 1.51 | 16.1 ± 3.31 | BFI826 | 0.3 ± 0.06 | 0.4 ± 0.05 | 0.4 ± 0.06 | 0.7 ± 0.12 | 0.5 ± 0.05 | 0.3 ± 0.08 | 2.4 ± 0.37 | 0.2 ± 0.02 | Fibr225 | 0 | 0 | 0.2 ± 0.04 | 0.1 ± 0.02 | 0.8 ± 0.14 | 0.7 ± 0.14 | 0.4 ± 0.11 | 0.1 ± 0.04 | ARCH915 | 0.3 ± 0.08 | 0.2 ± 0.07 | 0.6 ± 0.01 | 0.3 ± 0.07 | 0.6 ± 0.09 | 0.1 ± 0.02 | 0.4 ± 0.05 | 0.4 ± 0.06 | Total hybridizedb | 54.1 | 37 | 52.4 | 43.7 | 80.9 | 91.6 | 48 | 60.7 | Otherc | 45.9 | 63 | 47.6 | 56.3 | 19.1 | 8.4 | 52 | 39.3 | Open in a separate windowaThe two numbers represent the mean value (%) and the standard deviation of individual probe-defined microbial groups in a specified rumen digest fraction, which were calculated based on 3 mean values, each consisting of 20 enumerations. bThe numbers represent the sum of percentages of all individual probe-defined microbial groups in a specified rumen digest fraction. The percentages obtained with FISH probes RAL1436, RFL155, and BFI826 were not counted in the sum because the bacterial cells hybridizing with the former two probes also hybridized with RUM831, and the bacterial cells hybridizing with the last probe also hybridized with probe LAC435. cThe numbers represent the percentages of microorganisms which were not identified by FISH in a specified rumen digest fraction.We provided quantitative data by using qFISH to show that Bacteroidetes, Firmicutes, and Proteobacteria were abundant in both the LiqF and the SolF, constituting 31.8 to 87.3% of the total cell numbers. These FISH data add weight to the view that Firmicutes and Bacteroidetes might be dominant in rumens, as suggested previously from their high ratios retrieved from 16S rRNA clone libraries (e.g., see references 12, 26, and 27). However, information emerging from 16S rRNA gene clone library data cannot be used to reach conclusions on the quantitative composition of the rumen bacterial community. Bacteria may have 1 to 14 copies of rRNA genes, and several biases are known to be associated with their PCR amplification ( 8).These 3 dominant bacterial groups have been identified at a high-resolution level. They belong mainly to the order Bacteroidales (0.1 to 19.2%), hybridizing with probe BAC1080 (Fig. A); the families Lachnospiraceae (9.3 to 25.5%) and Ruminococcaceae (5.5 to 23.8%), hybridizing with LAC435 (Fig. ) and RUM831 (Fig. ), respectively; and the classes Deltaproteobacteria (5.8 to 28.3%) and Gammaproteobacteria (1.2 to 8.2%), hybridizing with SRBmix (equal moles of SRB385 and SRB385Db) (Fig. ) and GAM42a (Fig. ), respectively. All were more abundant in the microbial communities in the rumens of cows fed diets containing silage (75.2 to 87.3%) than in those in the rumens of cows fed diets containing hay (31.8 to 49.5%). These results show how diets containing different forages (hay or silage) may influence the distribution of the microbial populations, which is in line with data by Tajima et al. ( 25). We also found in this study that the addition of flaxseed (to inhibit methane emission) reduced their abundance in the rumens of cows fed silage-based diets (to 45.2 to 58.7%) but did not change markedly their abundance in the rumens of cows fed hay-based diets (31.8 to 49.5%), suggesting that adding flaxseed to these diets also affected rumen microbial community composition, although the extent of its influence reflected the forage used, being more profound with a silage-based diet than when hay was used. Open in a separate windowImages of digest samples from the rumens of cows fed hay- or silage-based diets with and without flaxseed after color combination. Images from probes are labeled in red, and those from DAPI staining are in green. The yellow (combination of red and green), including those partly colored cells in panels A to F, hybridized with probes BAC1080, GAM42a, SRBmix, RUM831, LAC435, and ARCH915, respectively. A few cells (arrows) hybridizing with SRBmix (C) were not stained by DAPI. Bars, 10 μm.We also present evidence here to suggest that Proteobacteria are common members of the microbial community, with sulfur-reducing bacteria (SRB) belonging to Deltaproteobacteria in particular being readily detected (up to 28% of the total cells) in both the LiqF and the SolF of rumen contents from cows fed the four different diets examined here. SRB have seldom been retrieved in clone libraries obtained from rumen samples. Lin et al. ( 15) have estimated SRB abundance in the rumen using DNA hybridization and concluded that they were of minor importance (0.7 to 0.8% of the total rRNA). Our estimates are much higher than those for every diet regime examined, possibly reflecting the coverage of the probes used in the two different studies. The probe mixture SRBmix used here targets most members of the Deltaproteobacteria, while those of Lin et al. ( 15) covered mainly members of the Desulfobacteraceae, Desulfovibrionaceae, and Desulfobulbaceae. We also recognized that the probe mixture SRBmix perfectly matched with the 16S rRNA genes of some bacteria other than SRB in Deltaproteobacteria. The possibility of overestimation of SRB cannot be ruled out. Interestingly, our data suggest that Gammaproteobacteria were abundant in some of the rumen communities we examined by FISH, comprising 1.2 to 8.2% of total cells.The other unexpected finding was that the fibrolytic bacteria and archaeal methanogens accounted for only a minor fraction of the communities. Of the three characterized fibrolytic bacterial species, F. succinogenes was not detected in the rumen digesta from cattle fed the hay-based diet but was present in the remainder of the diets. In contrast, R. albus and R. flavefaciens were present in both the LiqF and the SolF of the rumen digesta from cows fed all four diets. Although the importance of these bacteria within the rumen microbial community cannot be denied, these three populations accounted for only 0.7 to 2.1% of the total microbial cells. This numerical range compares well with that determined previously for F. succinogenes (0.1 to 6.9% of total rRNA) ( 4, 23) and Ruminococcus spp. (1.5 to 2.9% of total rRNA) ( 11), considering that different animals and diets were used in those studies and that different specificities of the probes and different detection methods were used. However, this is much lower than the 9% (of total rRNA) detected by Michalet-Doreau et al. ( 19) in their work. The abundance of fibrolytic B. fibrisolvens-related species was also low, being present at <1% in all fractions, except in the LiqF in cows fed the mixture of silage and flaxseed, where they contributed 2.4% of total cells.Methanogens hybridized to ARCH915 (Fig. ) were present (0.1 to 0.6%) in all rumen samples examined by FISH, which is close to or within the range (0.3 to 3.3%) estimated in other studies ( 15, 22). Interestingly, no marked difference in abundance of the methanogens could be seen between the samples from the rumens of cows fed diets with flaxseed and those from the rumens of cows fed diets without flaxseed, although it has been reported ( 7) that the addition of fatty acids could decrease methane production in the rumen. This may be due to the presence of methanogens with different activities in different rumen samples or the inability of probe ARCH915 to hybridize to all methanogens in the rumen samples examined here.Bacteria belonging to Chloroflexi, TM7, Spirochetes, and Actinobacteria hybridizing with CHLmix, TM7-905, SPRO1400, and HGC69a, respectively, accounted for only a minor fraction of the total cell numbers observed. In most cases, their abundances in each fraction did not change markedly with diet, always being present in small numbers (0 to 1%), suggesting that they have a minor role there. This conclusion, however, has to be confirmed since many (8.4 to 63.0%, depending on diet) of the bacteria could not be identified in the rumens of cows fed with all diets except the silage-based diet (Table ).FISH with the probes designed in this study failed to identify all of the bacterial cells. This is because the probes do not target all rumen 16S rRNA gene sequences and/or the true extent of rumen biodiversity has not been revealed from cloning analyses. This indicates that our current understanding of the quantitative composition of the rumen microbial community is far from complete. Moreover, no physiological data were generated in this study to suggest what the role(s) of most of the dominant populations (except the SRB hybridized with probe SRBmix) identified by FISH might be, meaning that it is still not possible to link their abundance to their in situ function. Furthermore, each FISH-probed population probably includes bacteria with different phenotypes. Clearly, much needs to be done before the structure and function of the rumen microbial community are fully understood.FISH is a useful tool in the investigation of microbial composition in complex ecosystems ( 3). However, FISH probes targeting rumen bacterial populations are limited. By comparison with other culture-independent methods, e.g., quantitative PCR, FISH has several advantages ( 8). In particular, in combination with histochemical staining methods ( 20) and microautoradiography (MAR-FISH) ( 13), the in situ ecophysiology of a targeted population can be determined under specified electron acceptor conditions. These techniques may provide important clues as to the functional role of microbial populations within complex communities, like that of the rumen. The possession of the FISH probes described in this paper could allow such studies to be undertaken in herbivore rumens. 相似文献
19.
Twenty-one salts were tested for their effects on the growth of Pectobacterium carotovorum subsp. carotovorum and Pectobacterium atrosepticum. In liquid medium, 11 salts (0.2 M) exhibited strong inhibition of bacterial growth. The inhibitory action of salts relates to the water-ionizing capacity and the lipophilicity of their constituent ions.Different biochemical mechanisms have been put forth to explain the antimicrobial activity of organic and inorganic salts, including inhibition of several steps of the energy metabolism (benzoate, bicarbonate, propionate, sorbate, and sulfite salts) ( 2, 3, 11, 16, 17, 19, 25) and complexation to DNA and RNA (aluminum and sulfites) ( 12, 13, 15, 20, 27, 28). However, little is known about the physicochemical basis for the general antimicrobial action of salts. The objective of this work was to gain an understanding of the relationship between the inhibitory action of salts on bacterial growth and their physicochemical properties by using the bacteria Pectobacterium carotovorum subsp. carotovorum (formerly Erwinia carotovora subsp. carotovora) and Pectobacterium atrosepticum (formerly Erwinia carotovora subsp. atroseptica). These bacteria are responsible for soft rot, a disease of economic importance affecting numerous stored vegetable crops ( 14, 22). Pectobacterium carotovorum subsp. carotovorum (strain Ecc 1367) and P. atrosepticum (strain Eca 709), provided by the Laboratoire de Diagnostic en Phytoprotection (MAPAQ, Québec, Canada), were grown in 250-ml flasks containing 50 ml of 20% tryptic soy broth (Difco Laboratories, Becton Dickinson, Sparks, MD) amended with salts (200 mM) or unamended (control), by incubation at 24°C with agitation (150 rpm; Lab-Line Instruments Inc., Melrose Park, IL) for 24 h. The pHs of the media were not adjusted but varied with the type of salts, unless stated otherwise. Flasks were inoculated with 100 μl of each bacterial suspension (1 × 10 7 CFU/ml). Bacterial growth was determined by turbidimetry at 600 nm with a UV/visible spectrophotometer (Ultrospec 2000; Pharmacia Biotech Ltd, Cambridge, United Kingdom), using appropriate blanks. Results were expressed as the percentage of growth inhibition compared with the growth of the control. A completely randomized experimental design with three replicates was used, the experimental unit being a flask. Analysis of variance was carried out with the GLM (general linear model) procedure of SAS (SAS Institute, Cary, NC) software. When they were significant ( P < 0.05), treatment means were compared using Fisher''s protected least-significant-difference test.Among the 21 salts tested, sodium carbonate, sodium metabisulfite, trisodium phosphate, aluminum lactate, aluminum chloride, sodium bicarbonate, sodium propionate, ammonium acetate, aluminum dihydroxy acetate, potassium sorbate, and sodium benzoate exhibited strong inhibition (≥97%) of the growth of both P. carotovorum subsp. carotovorum and P. atrosepticum (Table ). Calcium chloride, sodium formate, sodium acetate, ammonium hydrogen phosphate, and sodium hydrogen phosphate exhibited a moderately inhibitory effect; sodium lactate and tartrate had no effect. On the other hand, ammonium chloride, potassium chloride, and sodium chloride stimulated the growth of P. atrosepticum. TABLE 1.Effect of salts on the growth of P. atrosepticum and P. carotovorum subsp. carotovorumSalt (0.2 M)a | pHb | Osmotic pressure (atm)c | Growth inhibition (%)d
|
---|
P. atrosepticum | P. carotovorum subsp. carotovorum |
---|
Aluminum dihydroxy acetate [Al(OH)2C2H3O2] | 4.9 | 9.79 | 100 a | 100 a | Aluminum chloride (AlCl3·6H2O) | 2.5 | 19.57 | 100 a | 100 a | Aluminum lactate [Al(C3H5O3)3] | 3.4 | 19.57 | 100 a | 100 a | Ammonium acetate (NH4C2H3O2) | 7.2 | 9.79 | 100 a | 100 a | Ammonium chloride (NH4Cl) | 7.0 | 9.79 | −18 d | ND | Ammonium hydrogen phosphate [(NH4)2HPO4] | 8.3 | 14.68 | 43 b | 23 c | Calcium chloride (CaCl2·2H2O) | 5.8 | 14.68 | 85 a | 70 b | Potassium chloride (KCl) | 7.3 | 9.79 | −27 d | ND | Potassium sorbate (KC6H7O2) | 7.7 | 9.79 | 100 a | 97 a | Sodium acetate (NaC2H3O2·3H2O) | 7.4 | 9.79 | 63 b | ND | Sodium benzoate (NaC7H5O2) | 7.4 | 9.79 | 100 a | 100 a | Sodium bicarbonate (NaHCO3) | 8.1 | 9.79 | 100 a | 100 a | Sodium carbonate (Na2CO3) | 10.6 | 14.68 | 100 a | 100 a | Sodium chloride (NaCl) | 7.2 | 9.79 | −29 d | ND | Sodium formate (NaCHO2) | 7.3 | 9.79 | 24 c | ND | Sodium lactate (C3H5O3Na) | 7.3 | 9.79 | 3 c | ND | Sodium metabisulfite (Na2S2O5) | 4.5 | 19.57 | 100 a | 100 a | Sodium hydrogen phosphate (Na2HPO4) | 8.7 | 14.68 | 69 b | 61 b | Sodium propionate (NaC3H5O2) | 7.4 | 9.79 | 100 a | 99 a | Sodium tartrate (Na2C4H4O6·2H2O) | 7.3 | 14.68 | 2 c | ND | Trisodium phosphate (Na3PO4·12H2O) | 11.9 | 19.57 | 100 a | 100 a | Open in a separate windowaSalts were purchased from Sigma Chemical Co. (St. Louis, MO), except for ammonium acetate (BDH Inc., Toronto, Canada), sodium chloride (BDH), sodium bicarbonate (BDH), and aluminum lactate (Aldrich Chemical, Milwaukee, WI). bpH of the medium amended with each salt. cOsmotic pressure of the salt solution was calculated using van’t Hoff''s equation, Π = iRTc, where R is the gas constant, T is the absolute temperature (K), c is the concentration of the salt (mol/liter), and i is the number of ions into which the salt dissociates in solution. dPercentage of growth inhibition compared to growth of the control. Each value represents the mean of three replicates. Values in the same column followed by the same letter are not significantly different according to Fisher''s protected least-significant-difference test ( P > 0.05). ND, not determined. Negative values signify bacterial growth stimulation.Several factors in the salt solutions can contribute to bacterial growth inhibition. Elevated osmolarity due to salt addition may trigger the osmoregulatory process, causing an increased maintenance metabolism and leading to reduction in bacterial growth. Thus, we calculated the osmotic pressure (Π) of salt solutions using van''t Hoff''s equation ( 26). As shown in Table , salts with comparable osmolarities displayed complete or no bacterial growth inhibition, indicating that osmotic stress or reduction in water activity alone may not have brought about the inhibition of the bacterial growth. Therefore, other factors may play a role.The acidity or alkalinity of the medium resulting from the addition of some of the salts can have profoundly adverse effects on bacterial growth. Extreme pH conditions can lead to denaturation of proteins like enzymes present on the cell surface, depolarization of transport for essential ions and nutrients, modification of cytoplasmic pH, and DNA damage ( 12, 18). Table shows that the addition of aluminum lactate, aluminum chloride, and sodium metabisulfite, whose ΔpHs (ΔpH = |7.5 [the optimal pH for growth] − the pH of the salt-amended medium|) are ≥3, strongly acidified the medium, whereas the addition of sodium carbonate and trisodium phosphate strongly increased the pH (ΔpH ≥ 3.1). Except for ammonium acetate, sodium acetate, sodium bicarbonate, and the preservative salts (potassium sorbate, sodium benzoate, and sodium propionate), whose ΔpHs are <1, all the other salts generally display inhibitory effects when ΔpH values are ≥1 (Fig. ). Based on this result, the effect of the highly acidic or alkaline salts (which strongly affected the pH of the medium) on the growth of P. atrosepticum was evaluated at pH 7.5. Sodium carbonate and sodium metabisulfite completely inhibited bacterial growth at pH 7.5, as they did at pHs 10.6 and 4.5, respectively; trisodium phosphate (pH 11.9) exhibited a slightly lower inhibitory effect (growth inhibition of 83.2%) at pH 7.5. These observations suggest that growth inhibition by sodium carbonate, sodium metabisulfite, and trisodium phosphate cannot be attributed solely to extreme pH and passive proton transfer (extreme pH) across the bacterial membrane. Since aluminum salts precipitate at pH 7.5 (due to formation of hydrated aluminum hydroxide), it was not possible to test their inhibitory effect at pH 7.5. Open in a separate windowRelationship between ΔpH (|7.5 [the optimal pH for growth] − the pH of the salt-amended medium|) and growth inhibition of Pectobacterium atrosepticum. 1, Sodium chloride; 2, potassium chloride; 3, ammonium chloride; 4, sodium tartrate; 5, sodium lactate; 6, sodium formate; 7, ammonium hydrogen phosphate; 8, sodium acetate; 9, sodium hydrogen phosphate; 10, calcium chloride; 11, ammonium acetate; 12, sodium benzoate; 13, sodium propionate; 14, potassium sorbate; 15, sodium bicarbonate; 16, aluminum dihydroxy acetate; 17, sodium metabisulfite; 18, sodium carbonate; 19, aluminum lactate; 20, aluminum chloride; 21, trisodium phosphate.The dissociation of salts in aqueous medium generates ionic species which can participate in proton exchange reactions with water molecules. The capacity of an ion to dissociate water is an intrinsic characteristic, determined by its pK value (pK a for acidic species or pK b for basic ones) ( 4, 21, 24). For an ionic strength of >0.1 M, pK a and pK b values of the ions are more accurate when they are defined as apparent constants (pK′ a or pK′ b) in terms of the activities of hydronium and hydroxyl ions, ionic species concentrations and activity coefficients ( 6). Thus, for the acidic ions, we have the equation ), and for the basic anions, pK′ b = pK b + log(γ HB/γ B−), where pK′ a and pK′ b are the apparent acidity constant and basicity constant, respectively; is the activity coefficient of the conjugate base ( B−); and γ HB is that of the acidic ( HB) species. The activity coefficient (γ) of the species i can be expressed as a function of ionic strength (μ), using the Güntelberg approximation of the Debye-Hückel equation ( 21), as follows: −log γ i=[(0.51 Zi2 μ 1/2)/(1 + μ 1/2)], where Zi is the charge on the species i, and μ is the ionic strength. Thus, log(/γ HB) = [(0.51μ 1/2)/(1 + μ 1/2)] (), and log(γ HB/) = −[(0.51μ 1/2)/(1 + μ 1/2)] ().Polytropic acid-potentiating ions (bicarbonate, carbonate, monohydrogen phosphate, phosphate, sulfite, and tartrate) in an aqueous solution can exist as ( n + 1) possible species for which the parent acid is H nA. These species may coexist in equilibrium under certain pH conditions. For these ions, pK′ a or pK′ b were expressed as the means of the coexisting species at a specified pH. Calculated values for pK′ a of acidic anions and cations and calculated values for pK′ b of basic anions are presented in Table . Figure shows a sigmoidal relationship between the inhibitory effect of salts on bacterial growth and the pK′ b value of the basic ions (with a common cation, sodium or potassium, in the salt) and the pK′ a value of the acidic ions (with a common anion, chloride, in the salt). The plot exhibits a sharp linear relationship in the pK′ range of 8.0 to 12.0. Below the pK′ value of 8.0, inhibition is maximal, whereas above the pK′ value of 11.0, ions appear to stimulate growth (growth was maximal above the pK′ value of 12). This result demonstrates that the capacity of the constitutive ions of the salts to either donate or subtract protons to water molecules, either in the growth environment (as reflected in the modification of the medium pH) or in the developing cells, generally plays a role in their inhibitory action. The consequent transmembrane pH gradient generated leads to a passive H + transport across the microbial membrane and to acidification (in the case of ions with low pK′ a) or alkalinization (in the case of ions with low pK′ b) of the cytoplasm, once the capacity for proton-coupled active transport is outstripped. In both cases, proton exchange with outer membrane proteins will destabilize these proteins, their interaction with membrane lipids, and ultimately, their function in solute transport, leading to growth inhibition. The modification of cytoplasmic pH can also alter nucleic acid structures and functions and contribute to growth inhibition ( 18). Open in a separate window(A) Relationship between the growth inhibition of Pectobacterium atrosepticum and the apparent basicity constant (pK′ b,•) of basic anions with common Na + (or K +) cations in the salt, the apparent acidity constant (pK′ a,○) of acidic bisulfite anion (HSO 3−), and the cations with common Cl − ions in the salt. (B) Relationship between the growth inhibition of Pectobacterium atrosepticum and the addition parameter (pK′ + p Po/w) combining the partition coefficient ( Po/w) and pK′ b (•) of basic anions (common cation, Na + or K +, in the salt) or pK′ a (○) of cations (common anion, Cl −, in the salt) and the acidic bisulfite anion (HSO 3−). TABLE 2.Calculated apparent values for acidity, pK′ a, and basicity, pK′ baSalt | Basic anion
| Cation and acidic anion
|
---|
pH | Ionic species or species in equilibrium | pK′b | pH | Ionic species or species in equilibrium | pK′a |
---|
Sodium acetate | 7.4 | Acetate− | 9.5 | | | | Sodium benzoate | 7.4 | Benzoate− | 10.0 | | | | Sodium bicarbonate | 8.1 | H2CO3/HCO3−b | 7.7 | | | | Sodium carbonate | 10.6 | HCO3−/CO32− | 6.1 | | | | Sodium formate | 7.3 | Formate− | 10.4 | | | | Sodium hydrogen phosphate | 8.7 | H2PO4−/HPO42− | 9.8 | | | | Sodium lactate | 7.3 | Lactate− | 11.1 | | | | Trisodium phosphate | 11.9 | HPO42−/PO43− | 5.3 | | | | Sodium propionate | 7.4 | Propionate− | 9.3 | | | | Potassium sorbate | 7.7 | Sorbate− | 9.4 | | | | Sodium tartrate | 7.3 | Tartrate2− | 10.6 | | | | Sodium chloride | 7.2 | Cl− | 17.2 | | | | Sodium metabisulfite | | | | 4.5 | SO2·H2O/HSO3− | 4.0 | Aluminum chloride | | | | 2.5 | Al3+ | 6.2 | Calcium chloride | | | | 5.8 | Ca2+ | 13.4 | Potassium chloride | | | | 7.3 | K+ | 16.2 | Sodium chloride | | | | 7.2 | Na+ | 15.0 | Ammonium chloride | | | | 7.0 | NH4+ | 9.5 | Open in a separate windowaCalculation of pK′ was performed according to Edsall and Wyman ( 6). pH values were measured at 0.2 M. bIncludes CO 2·H 2O and H 2CO 3.However, the water-ionizing capacity of the constituent ions of the salts and the consequent modification of the pH of the medium are not the sole factors accounting for growth inhibition, as suggested by the exceptional inhibitory actions of benzoate, propionate, and sorbate (Fig. and ). These ions provide a higher inhibition than is expected from their pK′ values (pK′ b values of 10.0, 9.3, and 9.4, respectively), while the pH of their solution is optimal for bacterial growth (pHs of 7.4, 7.4, and 7.7, respectively). This suggests that they possess additional characteristics mediating their action, in addition to their water-ionization property. In fact, these preservative agents have been shown to be active either as undissociated acids (like other weak acids) or as anions ( 7, 8), due to their possibly hydrophobic nature which would allow them to interact with lipid constituents of the cell envelope of gram-negative bacteria such as Pectobacterium spp., and to modify their functionality ( 5), resulting in growth inhibition. They can also cross the cell envelope due to their lipophilicity, and their acidification inside the cell can cause additional adverse effects.Thus, we determined the octanol/water partition coefficient ( Po/w), an indicator of the lipophilic character of a compound, for the effective salts with common sodium (or potassium) or chloride ions. The Po/w coefficients of the salts were determined in duplicate by using the general solvent-solvent separation procedure ( 9). Equal volumes (50 ml) of 1-octanol (Sigma Chemical Co., St. Louis, MO) and bidistilled water were poured into a separating flask and thoroughly shaken for 5 min. Four grams of each salt was then added, and the flask content was thoroughly mixed three times for 5 min each time, with a rest period of 5 min after each agitation. After complete separation (20 to 24 h at room temperature), the two phases were recovered separately in different flasks, and the concentration of the accompanying ion of the salt was measured in each phase by atomic absorption (model 3300 unit; Perkin-Elmer, Ueberlinger, Germany). The Po/w coefficient was calculated as the ratio of the concentration of ion in 1-octanol to the concentration of ion in the aqueous phase. Sodium benzoate was found to be the most lipophilic ( Po/w = 1.41 × 10 −2), followed by potassium sorbate ( Po/w = 7.6 × 10 −3) and sodium metabisulfite ( Po/w = 2.0 × 10 −4). Most other salts, sodium chloride (reference salt), sodium bicarbonate and carbonate, sodium propionate, sodium acetate, calcium chloride, and aluminum chloride mainly remained in the aqueous phase ( Po/w = 2.0 × 10 −5 to 5.0 × 10 −5). This lipophilic characteristic of benzoate and sorbate ions would result from a reduced charge density in their molecules (due to the conjugated double bonds in their molecules). An addition parameter, pK′ + p Po/w, which combines the two properties of salts ions, i.e., the water-ionizing capacity (pK′) and the lipophilicity (p Po/w = −log Po/w), appears to provide a more general basis for the inhibitory effect of salts (Fig. ). This suggests that while the dissociation constant of ions plays a major role in growth inhibition, as seen in Fig. A, the lipophilic character of the preservative-salt ions confers to them an added ability to penetrate the cell envelope and to inhibit bacterial growth ( 5, 10). The exclusion of ammonium (lower inhibition than expected from its pK′ a value) and calcium (higher inhibition than expected from its pK′ a value) ions from the sigmoidal pattern portrayed in Fig. would have resulted from their interactions with water and other molecules (NH 4+) ( 1) or from cell membrane destabilization (Ca 2+) ( 23).In conclusion, the study has shown that several salts (0.2 M concentration), including aluminum dihydroxy acetate, aluminum chloride, aluminum lactate, ammonium acetate, potassium sorbate, sodium benzoate, sodium metabisulfite, sodium bicarbonate, sodium carbonate, sodium propionate, and trisodium phosphate, strongly inhibited the growth of P. carotovorum subsp. carotovorum and P. atrosepticum. In addition, the study has established for the first time a basic sigmoidal relationship between the antimicrobial activity of the salts and the physicochemical characteristics of their constituent ions, namely their water-ionizing capacity and their lipophilicity. The constituent ions of the highly inhibiting salts generally displayed a high capacity to ionize water molecules (low pK′ a or pK′ b values) (Al 3+, CO 32−, PO 43−, HCO 3−, and HSO 3−) or a high lipophilicity (benzoate − and sorbate −), and these two parameters in combination with known biochemical activities of salts ions would affect bacterial growth. 相似文献
20.
Short-chain alcohol dehydrogenase, encoded by the gene Tsib_0319 from the hyperthermophilic archaeon Thermococcus sibiricus, was expressed in Escherichia coli, purified and characterized as an NADPH-dependent enantioselective oxidoreductase with broad substrate specificity. The enzyme exhibits extremely high thermophilicity, thermostability, and tolerance to organic solvents and salts.Alcohol dehydrogenases (ADHs; EC 1.1.1.1.) catalyze the interconversion of alcohols to their corresponding aldehydes or ketones by using different redox-mediating cofactors. NAD(P)-dependent ADHs, due to their broad substrate specificity and enantioselectivity, have attracted particular attention as catalysts in industrial processes ( 5). However, mesophilic ADHs are unstable at high temperatures, sensitive to organic solvents, and often lose activity during immobilization. In this relation, there is a considerable interest in ADHs from extremophilic microorganisms; among them, Archaea are of great interest. The representatives of all groups of NAD(P)-dependent ADHs have been detected in genomes of Archaea ( 11, 12); however, only a few enzymes have been characterized, and the great majority of them belong to medium-chain ( 3, 4, 14, 16, 19) or long-chain iron-activated ADHs ( 1, 8, 9). Up to now, a single short-chain archaeal ADH from Pyrococcus furiosus ( 10, 18) and only one archaeal aldo-keto reductase also from P. furiosus ( 11) have been characterized. Thermococcus sibiricus is a hyperthermophilic anaerobic archaeon isolated from a high-temperature oil reservoir capable of growth on complex organic substrates ( 15). The complete genome sequence of T. sibiricus has been recently determined and annotated ( 13). Several ADHs are encoded by the T. sibiricus genome, including three short-chain ADHs (Tsib_0319, Tsib_0703, and Tsib_1998) ( 13). In this report, we describe the cloning and expression of the Tsib_0319 gene from T. sibiricus and the purification and the biochemical characterization of its product, the thermostable short-chain ADH (TsAdh319).The Tsib_0319 gene encodes a protein with a size of 234 amino acids and the calculated molecular mass of 26.2 kDa. TsAdh319 has an 85% degree of sequence identity with short-chain ADH from P. furiosus (AdhA; PF_0074) ( 18). Besides AdhA, close homologs of TsAdh319 were found among different bacterial ADHs, but not archaeal ADHs. The gene flanked by the XhoI and BamHI sites was PCR amplified using two primers (sense primer, 5′-GTTCTCGAGATGAAGGTTGCTGTGATAACAGGG-3′, and antisense primer, 5′-GCTGGATCCTCAGTATTCTGGTCTCTGGTAGACGG-3′) and cloned into the pET-15b vector. TsAdh319 was overexpressed, with an N-terminal His 6 tag in Escherichia coli Rosetta-gami (DE3) and purified to homogeneity by metallochelating chromatography (Hi-Trap chelating HP column; GE Healthcare) followed by gel filtration on Superdex 200 10/300 GL column (GE Healthcare) equilibrated in 50 mM Tris-HCl (pH 7.5) with 200 mM NaCl. The homogeneity and the correspondence to the calculated molecular mass of 28.7 kDa were verified by SDS-PAGE ( 7). The molecular mass of native TsAdh319 was 56 to 60 kDa, which confirmed the dimeric structure in solution.The standard ADH activity measurement was made spectrophotometrically at the optimal pH by following either the reduction of NADP (in 50 mM Gly-NaOH buffer; pH 10.5) or the oxidation of NADPH (in 0.1 M sodium phosphate buffer; pH 7.5) at 340 nm at 60°C. The enzyme exhibited a strong preference for NADP(H) and broad substrate specificity (Table ). The highest oxidation rates were found with pentoses d-arabinose (2.0 U mg −1) and d-xylose (2.46 U mg −1), and the highest reduction rates were found with dimethylglyoxal (5.9 U mg −1) and pyruvaldehyde (2.2 U mg −1). The enzyme did not reduce sugars which were good substrates for the oxidation reaction. The kinetic parameters of TsAdh319 determined for the preferred substrates are shown in Table . The enantioselectivity of the enzyme was estimated by measuring the conversion rates of 2-butanol enantiomers. TsAdh319 showed an evident preference, >2-fold, for ( S)-2-butanol over ( RS)-2-butanol. The enzyme stereoselectivity is confirmed by the preferred oxidation of d-arabinose over l-arabinose (Table ). The fact that TsAdh319 is metal independent was supported by the absence of a significant effect of TsAdh319 preincubation with 10 mM Me 2+ for 30 min before measuring the activity in the presence of 1 mM Me 2+ or EDTA (Table ). TsAdh319 also exhibited a halophilic property, so the enzyme activity increased in the presence of NaCl and KCl and the activation was maintained even at concentration of 4 M and 3 M, respectively (Table ). TABLE 1.Substrate specificity of TsAdh319 Substratea | Relative activity (%) |
---|
Oxidation reactionb | | Methanol | 0 | 2-Methoxyethanol | 0 | Ethanol | 36 | 1-Butanol | 80 | 2-Propanol | 100 | (RS)-(±)-2-Butanol | 86 | (S)-(+)-2-Butanol | 196 | 2-Pentanol | 67 | 1-Phenylmethanol | 180 | 1.3-Butanediol | 91 | Ethyleneglycol | 0 | Glycerol | 16 | d-Arabinose* | 200 | l-Arabinose* | 17 | d-Xylose* | 246 | d-Ribose* | 35 | d-Glucose* | 146 | d-Mannose* | 48 | d-Galactose* | 0 | Cellobiose* | 71 | Reduction reactionc | | Pyruvaldehyde | 100 | Dimethylglyoxal | 270 | Glyoxylic acid | 36 | Acetone | 0 | Cyclopentanone | 0 | Cyclohexanone | 4 | 3-Methyl-2-pentanone* | 13 | d-Arabinose* | 0 | d-Xylose* | 0 | d-Glucose* | 0 | Cellobiose* | 0 | Open in a separate windowaSubstrates were present in 250 mM or 50 mM (*) concentrations. bRelative rates, measured under standard conditions, were calculated by defining the activity for 2-propanol as 100%, which corresponds to 1.0 U mg −1. Data are averages from triplicate experiments. cRelative rates, measured under standard conditions, were calculated by defining the activity for pyruvaldehyde as 100%, which corresponds to 2.2 U mg −1. Data are averages from triplicate experiments. TABLE 2.Apparent Km and Vmax values for TsAdh319 Coenzyme or substrate | Apparent Km (mM) | Vmax (U mg−1) | kcat (s−1) |
---|
NADPa | 0.022 ± 0.002 | 0.94 ± 0.02 | 0.45 ± 0.01 | NADPHb | 0.020 ± 0.003 | 3.16 ± 0.11 | 1.51 ± 0.05 | 2-Propanol | 168 ± 29 | 1.10 ± 0.09 | 0.53 ± 0.04 | d-Xylose | 54.4 ± 7.4 | 1.47 ± 0.09 | 0.70 ± 0.04 | Pyruvaldehyde | 17.75 ± 3.38 | 4.26 ± 0.40 | 2.04 ± 0.19 | Open in a separate windowaActivity was measured under standard conditions with 2-propanol. Data are averages from triplicate experiments. bActivity was measured under standard conditions with pyruvaldehyde. Data are averages from triplicate experiments. TABLE 3.Effect of various ions and EDTA on TsAdh319 aCompound | Concn (mM) | Relative activity (%) |
---|
None | 0 | 100 | NaCl | 400 | 206 | 600 | 227 | 4,000 | 230 | KCl | 600 | 147 | 2,000 | 200 | 3,000 | 194 | MgCl2 | 10 | 78 | CoCl2 | 10 | 105 | NiSO4 | 10 | 100 | ZnSO4 | 10 | 79 | FeSO4 | 10 | 74 | EDTA | 1 | 100 | 5 | 80 | Open in a separate windowaThe activity was measured under standard conditions with 2-propanol; relative rates were calculated by defining the activity without salts as 100%, which corresponds to 0.9 U mg −1. Data are averages from duplicate experiments.The most essential distinctions of TsAdh319 are the thermophilicity and high thermostability of the enzyme. The optimum temperature for the 2-propanol oxidation catalyzed by TsAdh319 was not achieved. The initial reaction rate of oxidation increased up to 100°C (Fig. ). The Arrhenius plot is a straight line, typical of a single rate-limited thermally activated process, but there is no obvious transition point due to the temperature-dependent conformational changes of the protein molecule. The activation energy for the oxidation of 2-propanol was estimated at 84.0 ± 5.8 kJ·mol −1. The thermostability of TsAdh319 was calculated from residual TsAdh319 activity after preincubation of 0.4 mg/ml enzyme solution in 50 mM Tris-HCl buffer (pH 7.5) containing 200 mM NaCl at 70, 80, 90, or 100°C. The preincubation at 70°C or 80°C for 1.5 h did not cause a decrease in the TsAdh319 activity, but provoked slight activation. The residual TsAdh319 activities began to decrease after 2 h of preincubation at 70°C or 80°C and were 10% and 15% down from the control, respectively. The determined half-life values of TsAdh319 were 2 h at 90°C and 1 h at 100°C. Open in a separate windowTemperature dependence of the initial rate of the 2-propanol reduction by TsAdh319. The reaction was initiated by enzyme addition to a prewarmed 2-propanol-NADP mixture. The inset shows the Arrhenius plot of the same data.Protein thermostability often correlates with such important biotechnological properties as increased solvent tolerance ( 2). We tested the influence of organic solvents at a high concentration (50% [vol/vol]) on TsAdh319 by using either preincubation of the enzyme at a concentration of 0.2 mg/ml with solvents for 4 h at 55°C or solvent addition into the reaction mixture to distinguish the effect of solvent on the protein stability and on the enzyme activity. TsAdh319 showed significant solvent tolerance in both cases (Table ), and the effects of solvents could be modulated by salts, acting apparently as molecular lyoprotectants ( 17). Furthermore, TsAdh319 maintained 57% of its activity in 25% (vol/vol) 2-propanol, which could be used as the cosubstrate in cofactor regeneration ( 6). TABLE 4.Influence of various solvents on TsAdh319 activity aSolvent | Relative activity (%)b | Relative activity (%)c
|
---|
Buffer without NaCl | Buffer with 600 mM NaCl |
---|
None | 100 | 100 | 100 | DMSOd | 98 | 0 | 40 | DMFAe | 101 | 13 | 41 | Methanol | 98 | 25 | 9 | Acetonitrile | 95 | 0 | 0 | Ethyl acetate | 47 | 0* | 33* | Chloroform | 105 | 79* | 81* | n-Hexane | 105 | 60* | 118* | n-Decane | 36 | 91* | 107* | Open in a separate windowaThe activity measured at the standard condition with 2-propanol as a substrate. Data are averages from triplicate experiments. bPreincubation for 4 h at 55°C in the presence of 50% (vol/vol) of solvent prior the activity assay. cWithout preincubation, solvent addition to the reaction mixture up to 50% (vol/vol) or using the buffer saturated by a solvent (*). dDMSO, dimethyl sulfoxide. eDMFA, dimethylformamide.From all the aforesaid we may suppose TsAdh319 or its improved variant to be interesting both for the investigation of structural features of protein tolerance and for biotechnological applications. 相似文献
|