Structure of varicella-zoster virus DNA

Varicella-zoster virus (VZV) DNA was prepared from nucleocapsids and from enveloped virions of a laboratory strain (Ellen) and directly from the vesicle fluids of patients with zoster infections. VZV Ellen nucleocapsid DNA was cleaved with 11 different restriction endonucleases and electrophoresed in agarose gels. The restriction profiles of the nucleocapsid DNA were identical to those of the DNA recovered from purified virions, but differed from those of another VZV strain (KM). In vitro-labeled VZV K.M. DNA purified directly from vesicle fluid yielded a distinct restriction pattern which appeared to be unchanged after several tissue culture passages of the isolate from that fluid. Restriction endonuclease analysis (EcoRI or BglII) of VZV DNA revealed the presence of four cleavage fragments with a molar ratio of approximately 0.5. No individual fragments with molar ratios of 0.25 were noted. This observation suggests that the VZV genome may contain one invertible segment. Comparison of the electrophoretic migrations of VZV DNA fragments relative to those of DNAs of known size permitted calculation of the VZV genome size to be 72 X 10(6) to 80 X 10(6) daltons. These results were confirmed by electron microscopy which demonstrated a genome size of about 76 X 10(6) daltons for passaged and unpassaged VZV DNA. Electron microscopy also revealed that some of the DNA molecules recovered from nucleocapsids or directly from vesicle fluids were superhelical circles.     

Detection of varicella-zoster virus DNA by field-inversion gel electrophoresis

A new method for detection of varicella-zoster virus (VZV) DNA using field-inversion gel electrophoresis (FIGE) was devised. VZV-genomic DNA could be differentiated from the host cell DNA of human embryonic lung (HEL) fibroblasts infected with VZV under electrophoretic conditions allowing resolution of linear and double-stranded DNAs in the 49-230 kilobase pairs (Kb) range. The detection of VZV-genomic DNA from infected HEL cells was successful regardless of whether the VZV was a laboratory strain, live vaccine strain, or fresh isolate. Under the same electrophoretic conditions, DNA of VZV-infected HEL cells could be clearly differentiated from DNA obtained from HEL cells infected with herpes simplex virus type 1 (HSV-1), type 2 (HSV-2), or human cytomegalovirus (HCMV). Furthermore, VZV genomic DNA could be detected from as small a sample as 1.9 x 10(4) VZV-infected HEL cells. Finally, we could detect VZV genomic DNA from 10 samples of vesicle tissue (blister lids, each about 1-4 mm2) and one sample of vesicle fluid (about 5 microliters) obtained from patients diagnosed as having herpes-zoster. The results of this study indicate that FIGE is a simple and promising method for the detection of VZV from clinical materials as well as infected in vitro cultured cells.     

Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.

A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is tandemly duplicated a variable number of times in different VZV strains and is responsible for the observed variation in mobilities of restriction fragments from this region of VZV DNA. The variable region sequence shares some homology with tandemly repeated regions in the a and c sequences of herpes simplex virus type 1 and probably exists in a noncoding region of the VZV genome.     

Varicella-zoster virus (VZV) open reading frame 61 protein transactivates VZV gene promoters and enhances the infectivity of VZV DNA.

The varicella-zoster virus (VZV) open reading frame 61 (ORF61) protein is the homolog of herpes simplex virus type 1 (HSV-1) ICP0. Both genes are located in similar parts of the genome, their predicted products share a cysteine-rich motif, and cell lines expressing VZV ORF61 are able to complement an HSV-1 ICP0 deletion mutant (H. Moriuchi, M. Moriuchi, H. A. Smith, S. E. Straus, and J. I. Cohen, J. Virol. 66:7303-7308, 1992). In transient expression assays, HSV-1 ICP0 is a transactivator alone and transactivates in synergy with another viral transactivator, ICP4. However, VZV ORF61 represses the activation by VZV-encoded proteins ORF62 (the homolog of ICP4) and ORF4. To further characterize the function of VZV ORF61 and its role(s) in regulation of viral gene expression, we performed transient expression assays using target promoters from VZV, HSV-1, and unrelated viruses. In the absence of other viral activators, VZV ORF61 transactivated most promoters tested. In addition, a cell line stably expressing VZV ORF61 complemented the HSV-1 mutant in 1814, which lacks the transactivating function of VP16. The cell line expressing VZV ORF61 enhanced the infectivity of HSV-1 virion DNA. Moreover, transient expression of VZV ORF61 also enhanced the infectivity of VZV DNA. These results indicate that VZV ORF61 can stimulate expression of HSV-1 and VZV genes at an early stage in the viral replicative cycle and that ORF61 has an important role in VZV gene regulation.     

Herpesvirus DNA in Peripheral Blood Mononuclear Cells of Some Patients with Meniere's Disease

Herpes simplex virus‐1 (HSV) or varicella zoster virus (VZV) DNA was detected by nested polymerase chain reaction in peripheral blood mononuclear cells of patients with Meniere's disease (one of 28 patients for HSV‐1,2 of 28 patients for VZV) during acute illness (within 5 days after onset). On the other hand, neither HSV‐1 DNA or VZV DNA was detected in PBMCs of 50 age‐ and sex‐matched healthy individuals and 50 pregnant women. These findings may imply that reactivation of HSV‐1 or VZV may be associated with the development of some cases of Meniere's disease.     

Varicella-zoster virus DNA in cells isolated from human trigeminal ganglia

To determine the type of cell(s) that contain latent varicella-zoster virus (VZV) DNA, we prepared pure populations of neurons and satellite cells from trigeminal ganglia of 18 humans who had previously had a VZV infection. VZV DNA was present in 34 of 2,226 neurons (1.5%) and in none of 20,700 satellite cells. There was an average of 4.7 (range of 2 to 9) copies of VZV DNA per latently infected neuron. Latent VZV DNA was primarily present in large neurons, whereas the size distribution of herpes simplex virus DNA was markedly different.     

Varicella-zoster virus infection of human foreskin fibroblast cells results in atypical cyclin expression and cyclin-dependent kinase activity

In its course of human infection, varicella-zoster virus (VZV) infects rarely dividing cells such as dermal fibroblasts, differentiated keratinocytes, mature T cells, and neurons, none of which are actively synthesizing DNA; however, VZV is able to productively infect them and use their machinery to replicate the viral genome. We hypothesized that VZV alters the intracellular environment to favor viral replication by dysregulating cell cycle proteins and kinases. Cyclin-dependent kinases (CDKs) and cyclins displayed a highly unusual profile in VZV-infected confluent fibroblasts: total amounts of CDK1, CDK2, cyclin B1, cyclin D3, and cyclin A protein increased, and kinase activities of CDK2, CDK4, and cyclin B1 were strongly and simultaneously induced. Cyclins B1 and D3 increased as early as 24 h after infection, concurrent with VZV protein synthesis. Confocal microscopy indicated that cyclin D3 overexpression was limited to areas of IE62 production, whereas cyclin B1 expression was irregular across the VZV plaque. Downstream substrates of CDKs, including pRb, p107, and GM130, did not show phosphorylation by immunoblotting, and p21 and p27 protein levels were increased following infection. Finally, although the complement of cyclin expression and high CDK activity indicated a progression through the S and G(2) phases of the cell cycle, DNA staining and flow cytometry indicated a possible G(1)/S blockade in infected cells. These data support earlier studies showing that pharmacological CDK inhibitors can inhibit VZV replication in cultured cells.     

Inhibition of DNA synthesis in varicella-zoster virus-infected cells by BV-araU.

The inhibitory effect of BV-araU on DNA synthesis in human embryonic lung cells infected with varicella-zoster virus (VZV) or herpes simplex virus type 1 (HSV-1) was compared with that of acyclovir. Cellular uptake of [3H]thymidine and its incorporation into DNA was markedly stimulated by the infection with VZV or HSV-1, suggesting that the incorporation was mainly due to viral DNA synthesis. DNA synthesis in VZV-infected cells was dose-dependently suppressed by BV-araU and acyclovir, although cellular uptake of [3H]thymidine decreased in cells treated with a high concentration of drugs for an extended time. DNA synthesis in HSV-1-infected cells was also markedly inhibited by both drugs in a dose-dependent manner, without affecting cellular uptake of [3H]thymidine. The concentration of drugs inhibiting DNA synthesis was well correlated to their in vitro anti-VZV and anti-HSV-1 activities. The inhibitory concentration of BV-araU for DNA synthesis in VZV-infected cells was one-thousandth of that of acyclovir. Our results suggest that the antiviral action of BV-araU against VZV and HSV-1 is based on the inhibition of DNA synthesis in herpesvirus-infected cells.     

Prevalence of Varicella-Zoster Virus DNA in Dissociated Human Trigeminal Ganglion Neurons and Nonneuronal Cells

Previous analyses using in situ hybridization alone or together with PCR have yielded conflicting results regarding the cell type in which latent varicella-zoster virus (VZV) resides. We separated human trigeminal ganglia (TG) into neuronal and nonneuronal fractions, followed by primary and nested PCR to quantitate VZV DNA at the single cell level. Both TG from each of eight cadavers were dissociated and separated into neuronal and nonneuronal cell suspensions by differential filtration. Analysis of the neuron fraction (5,000 neurons per sample) revealed VZV DNA in 9 of 16 samples, with copy numbers ranging from 1 to 12, whereas only 2 of 16 nonneuronal cell samples were positive for VZV DNA, with 1 copy each. Further analysis of 10 samples of 100 neurons and the corresponding nonneuronal cell fractions from each TG of a single subject revealed VZV DNA in 3 of 10 samples of the left TG (range, 2 to 5 copies) and in 1 of 10 samples of the right TG (2 copies) but in none of the 20 nonneuronal cell fractions. These data indicate that latent VZV DNA is present primarily, if not exclusively, in neurons, at a frequency of two to five copies per latently infected neuron.     

Comparison of the Selectivity of Anti-Varicella-Zoster Virus Nucleoside Analogues

We compared the selectivity of six anti-varicella-zoster virus (VZV) drugs, which are clinically available or of which clinical efficacy for the treatment of VZV infections has been reported. Sorivudine (BV-araU) had the most potent anti-VZV effect in the plaque inhibition assay, followed by brivudine (BVDU) and 5-propynyl-arabinofuranosyluracil (Pry-araU). All test compounds, except vidarabine (AraA), had only a very weak effect on human embryonic lung cell growth. The selectivity indexes (ID₅₀ for cell growth/ED₅₀ for VZV plaque inhibition) of BV-araU, BVDU, and Pry-araU were > 1,000,000, 20,000, and > 10,000, respectively, while those of acyclovir and penciclovir ranged from 600 to 800. AraA was much less selective than any of the other drugs tested. We measured the amount of pH] thymidine incorporated into the acid-insoluble fraction of VZV-infected cells to determine the ability of these drugs to selectively inhibit viral DNA synthesis. [³H]Thymidine incorporation was markedly inhibited by all anti-VZV compounds, except BVDU. Treatment of infected cells with drugs from 32 to 38 hr after infection inhibited the DNA synthesis to the same extent as VZV plaque formation, except that AraA inhibited the DNA synthesis at a lower dose than for VZV plaque formation. DNA synthesis in non-infected growing cells was inhibited to the same extent as cell growth. A particularly high selectivity index for the inhibition of DNA synthesis was noted for BV-araU, which was defined as the ratio of inhibitions of DNA synthesis in VZV-infected and non-infected. The highest selectivity indexes were recorded for BV-araU > Pry-araU > acyclovir ≥ penciclovir > AraA.     

Varicella-zoster virus complements herpes simplex virus type 1 temperature-sensitive mutants.

Varicella-zoster virus (VZV) can complement temperature-sensitive mutants of herpes simplex virus. Of seven mutants tested, two, carrying mutations in the immediate-early ICP4 and ICP27 proteins, were complemented. This complementation was not seen in coinfections with adenovirus type 5 or cytomegalovirus. Following transfection into CV-1 cells, a DNA fragment containing the VZV short repeat sequence complemented the ICP4 mutant. These data demonstrate a functional relationship between VZV and herpes simplex virus and have allowed localization of a putative VZV immediate-early gene.     

Varicella‐Zoster virus ORF9 is an antagonist of the DNA sensor cGAS

Varicella‐Zoster virus (VZV) causes chickenpox and shingles. Although the infection is associated with severe morbidity in some individuals, molecular mechanisms that determine innate immune responses remain poorly defined. We found that the cGAS/STING DNA sensing pathway was required for type I interferon (IFN) induction during VZV infection and that recognition of VZV by cGAS restricted its replication. Screening of a VZV ORF expression library identified the essential VZV tegument protein ORF9 as a cGAS antagonist. Ectopically or virally expressed ORF9 bound to endogenous cGAS leading to reduced type I IFN responses to transfected DNA. Confocal microscopy revealed co‐localisation of cGAS and ORF9. ORF9 and cGAS also interacted directly in a cell‐free system and phase‐separated together with DNA. Furthermore, ORF9 inhibited cGAMP production by cGAS. Taken together, these results reveal the importance of the cGAS/STING DNA sensing pathway for VZV recognition and identify a VZV immune antagonist that partially but directly interferes with DNA sensing via cGAS.     

Characterization of Varicella-Zoster virus glycoprotein K (open reading frame 5) and its role in virus growth

Varicella-zoster virus (VZV) is an alphaherpesvirus that is the causative agent of chickenpox and herpes zoster. VZV open reading frame 5 (ORF5) encodes glycoprotein K (gK), which is conserved among alphaherpesviruses. While VZV gK has not been characterized, and its role in viral replication is unknown, homologs of VZV gK in herpes simplex virus type 1 (HSV-1) and pseudorabies virus (PRV) have been well studied. To identify the VZV ORF5 gene product, we raised a polyclonal antibody against a fusion protein of ORF5 codons 25 to 122 with glutathione S-transferase and used it to study the protein in infected cells. A 40,000-molecular-weight protein was detected in cell-free virus by Western blotting. In immunogold electron microscopic studies, VZV gK was in enveloped virions and was evenly distributed in the cytoplasm in infected cells. To determine the function of VZV gK in virus growth, a series of gK deletion mutants were constructed with VZV cosmid DNA derived from the Oka strain. Full and partial deletions in gK prevented viral replication when the gK mutant cosmids were transfected into melanoma cells. Insertion of the HSV-1 (KOS) gK gene into the endogenous VZV gK site did not compensate for the deletion of VZV gK. The replacement of VZV gK at a nonnative AvrII site in the VZV genome restored the phenotypic characteristics of intact recombinant Oka (rOka) virus. Moreover, gK complementing cells transfected with a full gK deletion mutant exhibited viral plaques indistinguishable from those of rOka. Our results are consistent with the studies of gK proteins of HSV-1 and PRV showing that gK is indispensable for viral replication.     

Use of a bacterial expression vector to map the varicella-zoster virus major glycoprotein gene, gC.

The genome of varicella-zoster virus (VZV) encodes at least three major glycoprotein genes. Among viral gene products, the gC gene products are the most abundant glycoproteins and induce a substantial humoral immune response (Keller et al., J. Virol. 52:293-297, 1984). We utilized two independent approaches to map the gC gene. Small fragments of randomly digested VZV DNA were inserted into a bacterial expression vector. Bacterial colonies transformed by this vector library were screened serologically for antigen expression with monoclonal antibodies to gC. Hybridization of the plasmid DNA from a gC antigen-positive clone revealed homology to the 3' end of the VZV Us segment. In addition, mRNA from VZV-infected cells was hybrid selected by a set of VZV DNA recombinant plasmids and translated in vitro, and polypeptide products were immunoprecipitated by convalescent zoster serum or by monoclonal antibodies to gC. This analysis revealed that the mRNA encoding a 70,000-dalton polypeptide precipitable by anti-gC antibodies mapped to the HindIII C fragment, which circumscribes the entire Us region. We conclude that the VZV gC glycoprotein gene maps to the 3' end of the Us region and is expressed as a 70,000-dalton primary translational product. These results are consistent with the recently reported DNA sequence of Us (A.J. Davison, EMBO J. 2:2203-2209, 1983). Furthermore, glycosylation appears not to be required for a predominant portion of the antigenicity of gC glycoproteins. We also report the tentative map assignments for eight other VZV primary translational products.     

Frequency and Abundance of Alphaherpesvirus DNA in Human Thoracic Sympathetic Ganglia

Alphaherpesvirus reactivation from thoracic sympathetic ganglia (TSG) and transaxonal spread to target organs cause human visceral disease. Yet alphaherpesvirus latency in TSG has not been well characterized. In this study, quantitative PCR detected varicella-zoster virus (VZV), herpes simplex virus 1 (HSV-1), and HSV-2 DNA in 117 fresh TSG obtained postmortem from 15 subjects. VZV DNA was found in 76 (65%) ganglia from all subjects, HSV-1 DNA was found in 5 (4%) ganglia from 3 subjects, and no HSV-2 was found.     

Errant processing and structural alterations of genomes present in a varicella-zoster virus vaccine.

Five minority populations of aberrant, varicella-zoster virus (VZV)-derived genomes were identified among the encapsidated DNAs obtained from the nuclear and cytoplasmic fractions of an in vitro infection initiated with a lyophilized sample of the BIKEN VZV vaccine (strain Oka). These were (i) VZV genomes, present within nuclear but not cytoplasmic viral capsids, which had been cleaved at a specific site within the short segment and which were, therefore, 3.15 megadaltons (approximately 4% of the VZV genome length) short of full length; (ii) highly deleted, repetitive VZV genomes which contained the errant cleavage site but not the usual VZV genome terminal sequences; (iii) VZV genomes into which multiples of 1 through 5 defective genome repeat units had been inserted into a homologous site; (iv) VZV genomes with additions of 0.1 or 0.18 megadaltons of DNA at both the terminal and internal ends of the short segment; and (v) VZV DNA which had lost the HindIII restriction site at map position 0.11.