Cloning of genes for bacteriophage T5 stable RNAs

One EcoRI-generated fragment (440 basepairs) and two EcoRI/HindIII fragments (220 and 960 basepairs) from the deletion region of T5 phage have been inserted into the phage λ XIII and the plasmid pBR322 as vectors. Recombinant DNA molecules were studied by hybridization with in vivo ³²P-labeled T5 4–5 S RNAs on nitrocellulose filters. Two-dimensional polyacrylamide gel electrophoretic fractionation and fingerprint analysis of the RNAs eluted from the filters were carried out to identify RNAs coded by cloned fragments. For the accurate localization of the genes for these RNAs, RNA-DNA hybrids were treated with T1 and pancreatic RNAases, and the eluted RNA fragments stable against RNAase action were electrophoresed. It was shown that the EcoRI¹440 fragment contains the gene for tRNA 10 (tRNA^Asp), the EcoRI/HindIII¹220 fragment contains the gene for RNA III (107 bases) and parts of the genes for RNA I (107 bases) and tRNA 12 (tRNA^His), and the EcoRI/HindIII¹960 fragment contains only a part of the gene for tRNA 9 (tRNA^Gln). The arrangement of these genes on the physical map of T5 phage was as follows: -tRNA^Gln-tRNA^His-RNA III-RNA I-…-tRNA^Asp.     

Isolation and some properties of DNA coding for tRNA1met from Xenopus laevis

DNA containing the reiterated genes for tRNA₁^met has been partially purified from Xenopus laevis by centrifugation in actinomycin C₁-CsCl and Ag⁺-Cs₂SO₄ gradients. These gradients separate the tRNA₁^met genes from those coding for tRNA₂^met and tRNA^val, thus confirming our earlier suggestion that these genes are not intermingled with each other (Clarkson, Birnstiel, and Purdom, 1973). The gradients also demonstrate the existence of a minor 5S DNA fraction which appears to differ from that previously isolated by Brown, Wensink, and Jordan (1971).When the enriched tDNA₁^met is digested to completion with either of the restriction endonucleases EcoRI or Hpa I, the tRNA₁^met genes are predominantly found within DNA fragments that are about 3100 base pairs long. A partial digestion with EcoRI shows that these fragments arise from the regular spacing of the enzyme restriction sites. The 3100 base pair EcoRI fragments are cleaved by Hpa I into fragments of two size classes, one of which is about 2200 base pairs long and contains the tRNA₁^met genes. The shorter fragments are about 700 base pairs long, and they appear to contain genes coding for at least one other kind of tRNA species. X. laevis tDNA₁^met thus comprises tandemly repeated DNA whose component parts show little if any length heterogeneity.     

Cloning of the yeast tyrosine transfer RNA genes in bacteriophage lambda.

Lambda bacteriophage containing yeast tyrosine transfer RNA genes were prepared by molecular recombination. These phage were identified by hybridization of ¹²⁵I-labeled yeast tRNA^Tyr to plaques from lambda-yeast recombinant phage pools. The cloned yeast EcoRI fragments that hybridize to ¹²⁵I-labeled tRNA^Tyr were compared in size with the fragments in total yeast DNA that hybridize to the same probe. These comparisons indicate that seven of the eight different tRNA^Tyr genes have been isolated. Unambiguous evidence that these seven fragments contain tRNA^Tyr coding regions was obtained by showing that they hybridize to aminoacylated [^3H]Tyr-tRNA^Tyr. Only one of the fragments hybridizes to ³²P-labeled total yeast tRNA in the presence of competing unlabeled tRNA^Tyr; the tRNA^Tyr genes, therefore, are not predominantly organized into heteroclusters of tRNA genes.     

Clustering of transfer RNA genes of Xenopus laevis

The arrangement of the reiterated DNA sequences complementary to transfer RNA has been studied in Xenopus laevis. Prehybridization of denatured DNA with an excess of unfractionated tRNA results in a small but well-defined increase in the buoyant density of fragments which contain sequences homologous to tRNA. The density increase is smaller than that found for 5 S DNA, but is the same or nearly so for all tRNA coding sequences examined. These results indicate that the majority of tRNA genes are clustered together with spacer DNA, the average size of which is estimated to be approximately 0.5 × 10⁶ daltons (native) DNA.In high molecular weight native DNA preparations, the sequences homologous to unfractionated tRNA, tRNA^Val, tRNA₁^Met and tRNA₂^Met band in CsCl at 1.707, 1.702, 1.708 and 1.711 g cm^?3, respectively. The mean buoyant densities are constant at all molecular weights examined but they do not correspond to the base compositions of the complementary tRNA species. These results indicate that isocoding genes are linked to spacer DNA in separate and extensive gene clusters, and that the different clusters contain different spacer DNA sequences. These clusters form well-defined cryptic DNA satellites which are potentially separable from each other as well as from other chromosomal DNA.     

Analysis of purified tRNA species by polyacrylamide gel electrophoresis

Six purified amino acid acceptor tRNA species were examined by polyacrylamide gel electrophoresis. Small differences in migration were observed under conditions that preserve the conformation of tRNA. When tRNA was heated in the presence of either 10 mM acetate or EDTA at 60° a change in migration was observed for tRNA^Glu. No difference in migration was seen between Val-tRNA^Val and tRNA^Val. When tRNA was denatured by heating in 4M urea and applied to a gel containing the same amount of urea, all tRNA species migrated approximately the same distance with the exception of tRNA^{Leu V}, which showed an appreciable slower migration. From the difference in migration of tRNA^{Leu V} as compared to tRNA^Val and 5 S RNA, the difference in chain length between tRNA^Val and tRNA^{Leu V} was estimated to be approximately 9 nucleotides.     

A comparison of the structural organization of amplified ribosomal DNA from Xenopus mulleri and Xenopus laevis.

Secondary structure maps of long single strands of amplified ribosomal DNA from two closely related species of frogs, Xenopus laevis and X. mulleri, have been compared. The secondary structure pattern of the gene region is identical in both ribosomal DNAs while the patterns in the non-transcribed spacers² differ. In X. mulleri, the spacer shows an extended region without any secondary structure adjacent to the 28 S ribosomal RNA sequence. In contrast, the same region in the X. laevis spacer has extensive secondary structure. A comparison of secondary structure maps and denaturation maps of these two ribosomal DNAs (Brown et al., 1972) reveals that the portion without secondary structure in the X. mulleri spacer corresponds to an early melting A + T-rich region. As in X. laevis ribosomal DNA, Escherichia coli restriction endonuclease (EcoRI) makes two cuts in each repeating unit of amplified ribosomal DNA from X. mulleri. The position of the cleavage sites is identical in the two species as judged from secondary structure mapping of the two classes of EcoRI fragments generated. The small fragments of X. mulleri ribosomal DNA are homogeneous in size with a duplex molecular weight of 3.0 × 10⁶, and contain about 85% of the 28 S ribosomal RNA gene and about 17% of the 18 S ribosomal RNA gene. The large fragments are heterogeneous in size with molecular weights ranging from 4.2 to 4.9 × 10⁶, and contain the remaining portions of the gene regions and the nontranscribed spacer. Heteroduplexes made between large fragments of different lengths show only deletion loops. The position of these loops indicates that the length heterogeneity resides in the non-transcribed spacer region. Electrophoretic analysis of EcoRI digests of chromosomal ribosomal DNA from X. mulleri demonstrates that this DNA is heterogeneous in length as well.     

The nucleotide sequence of bacteriophage T5 glutamine transfer RNA

Uniformly ³²P-labeled phage-specific tRNA^Gln has been isolated from bacteriophage T5-infected Escherichia coli cells and its nucleotide sequence has been determined using thin-layer chromatography on cellulose to fractionate the oligonucleotides. The sequence is: pUGGGGAUUAGCUUAGCUUGGCCUAAAGCUUCGGCCUUUGAAGψCGAGAUCAUUGGTψCAAAUCCAAUAUCCCCUGCCA_OH. The main feature of this tRNA is the absence of Watson-Crick pairing between the 5′-terminal base and the fifth base from its 3′-end. The structure of tRNA was confirmed by DNA sequencing of its gene.     

Sequence studies on human placenta tRNAVal : comparison with the mouse myeloma tRNAVal

The major species of valine specific tRNA was isolated from human placenta, degraded to oligonucleotides, and shown to have the nucleotide sequence pG-U-U-U-C-C-G-U-A-G-U-G-U?-A-G-D-G-G-D-D-A-U-C-A-C-m²G-U?-U-C-G-C-C-U-(I or C)-A-C-A-C-G-C-G-A-A-A-G-m⁷G-D-m⁵C-m⁵C-C-C-G-G-U-U?-C-G-m¹A-A-A-C-C-G-G-G-C-G-G-A-A-A-C-A-C-C-A_OH. This human placental tRNA^Val differs from the major species of mouse myeloma tRNA^Val only in that it contains either I or C in the wobble position of the anticodon, and totally lacks 2′-O-methylcytosine and 5-methylcytosine in the anticodon loop.     

Evidence for in vivo compartmentation of phenylalanyl-tRNA ligase in amphibian oocytes

The in vivo activity of phenylalanyl-tRNA ligase of Xenopus laevis oocytes was assayed by measuring the esterification of microinjected yeast tRNA^Phe with [¹⁴C]phenylalanine added to the extracellular medium. The three enzyme substrates, ATP, phenylalanine, and tRNA^Phe, are present in the in vivo assay at saturating concentrations as seen by the fact that microinjection into the cell of additional amounts of these compounds does not increase the quantity of [¹⁴C]Phe-tRNA^Phe formed. The in vivo activity of Phe-tRNA ligase in oocytes at several stages of development is less than 10% of the in vitro activity measured in homogenates of the same cells. The in vivo assay of Phe-tRNA ligase in oocytes that have been microinjected with this enzyme partially purified from X. laevis ovary shows that the enzyme is not inhibited by the cellular conditions. The conclusion drawn from these experiments is that a large fraction of the Phe-tRNA ligase present in oocytes is in a cellular compartment which is not available to the injected tRNA.     

Mutation in the lysA gene impairs the symbiotic properties of Mesorhizobium ciceri

A Tn5-induced mutant of Mesorhizobium ciceri, TL28, requiring the amino acid lysine for growth on minimal medium was isolated and characterized. The Tn5 insertion in the mutant strain TL28 was located on a 6.8-kb EcoRI fragment of the chromosomal DNA. Complementation analysis with cloned DNA indicated that 1.269 kb of DNA of the 6.8-kb EcoRI fragment restored the wild-type phenotype of the lysine-requiring mutant. This region was further characterized by DNA sequence analysis and was shown to contain a coding sequence homologous to lysA gene of different bacteria. The lys ^? mutant TL28 was unable to elicit development of effective nodules on the roots of Cicer arietinum L. There was no detectable level of lysine in the root exudates of chickpea. However, addition of lysine to the plant growth medium restored the ability of the mutant to produce effective nodules with nitrogen fixation ability on the roots of C. arietinum.     

Organization and expression of a two-gene cluster in the arginine biosynthesis of Saccharomyces cerevisiae.

Summary Using the pMB9 recombinant plasmid pMY3, which contains a functional gene for the tRNA^Try mutant Su⁺7, the EcoRI fragment containing the tRNA^Try gene is mapped and oriented with respect to the HindIII site in the tetracycline region of pMB9. Complete HpaII and HaeIII maps of the EcoRI fragment are derived. The Su⁺7 tRNA gene is placed by hybridization to these fragments, and the tRNA gene is oriented by using the restriction sites for HinfI, TaqI, and HpaII in the tRNA gene itself. A tRNA^Asp gene is shown to lie adjacent to tRNA^Try, and is also placed and oriented in the map. The RI fragment itself originates in a locus adjacent to, and transcribed in the same direction as, the ribosomal RNA genes of 80d₃.The implications of the structure of the cloned DNA for its previously measured regulatory and tRNA gene activities are discussed. In particular, the effect on the regulation of RNA synthesis is attributable to an E. coli DNA sequence, but cannot be due to the presence of a normal tRNA promoter on the plasmid.Abbreviations MD megadaltons; expressions of the form HpaII:0.075 refer to a fragment generated by the indicated restriction nuclease, having the indicated molecular weight, in MD     

Nuclear tRNATyr genes are highly amplified at a single chromosomal site in the genome of Arabidopsis thaliana

Summary We have examined the organization of tRNA^Tyr genes in three ecotypes of Arabidopsis thaliana, a plant with an extremely small genome of 7 × 107 bp. Three tRNA^Tyr gene-containing EcoRI fragments of 1.5 kb and four fragments of 0.6, 1.7, 2.5 and 3.7 kb were cloned from A. thaliana cv. Columbia (Col-O) DNA and sequenced. All EcoRl fragments except those of 0.6 and 2.5 kb comprise an identical arrangement of two tRNA^Tyr genes flanked by a tRNA^Ser gene. The three tRNA genes have the same polarity and are separated by 250 and 370 bp, respectively. The tRNA^Tyr genes encode the known cytoplasmic tRNA_GA ^Tyr. Both genes contain a 12 by long intervening sequence. Densitometric evaluation of the genomic blot reveals the presence of at least 20 copies, including a few multimers, of the 1.5 kb fragment in Col-O DNA, indicating a multiple amplification of this unit. Southern blots of EcoRl-digested DNA from the other two ecotypes, cv. Landsberg (La-O) and cv. Niederzenz (Nd-O) also show 1.5 kb units as the major hybridizing bands. Several lines of evidence support the idea of a strict tandem arrangement of this 1.5 kb unit: (i) Sequence analysis of the EcoRI inserts of 2.5 and 0.6 kb reveals the loss of an EcoRI site between 1.5 kb units and the introduction of a new EcoRI site in a 1.5 kb dimer. (ii) Complete digestion of Col-O DNA with restriction enzymes which cleave only once within the 1.5 kb unit also produces predominantly 1.5 kb fragments. (iii) Partial digestion with EcoRI shows that the 1.5 kb fragments indeed arise from the regular spacing of the restriction sites. The high degree of sequence homology among the 1.5 kb units, ranging from 92% to 99%, suggests that the tRNA^Ser/tRNA^Tyr cluster evolved 1–5 million years ago, after the Brassicaceae diverged from the other flowering plants about 5–10 million years ago.     

Specific binding of bovine immunoglobulins to Sepharose and Sephadex

Bacteriophage T5 BglII/HindIII DNA fragment (803 basepairs), containing the genes for 2 tRNAs and 2 RNAs with unknown functions, was cloned in the plasmid pBR322. The analysis of DNA sequence indicates that tRNA genes code isoacceptor tRNAs^Ser (tRNA^Ser₁ and tRNA^Ser₂) with anticodons UGA and GGA, respectively. The main unusual structural feature of these tRNAs is the presence of extra non-basepaired nucleotides in the joinings of stem ‘b’ with stems ‘a’ and ‘c’.     

Chromosomal mapping of tRNA genes from Dictyostelium discoideum

Summary Different wild-type isolates of Dictyostelium discoideum exhibit extensive polymorphism in the length of restriction fragments carrying tRNA genes. These size differences were used to study the organisation of two tRNA gene families which encode a tRNA^Val(GUU) and a tRNA^Val(GUA) gene. The method used involved a combination of classitics. The tRNA genes were mapped to specific linkage groups (chromosomes) by correlating the presence of polymorphic DNA bands that hybridized with the tRNA gene probes with the presence of genetic markers for those linkage groups. These analyses established that both of the tRNA gene families are dispersed among sites on several of the chromosomes. Information of nine tRNA^Val(GUU) genes from the wild-type isolate NC4 was obtained: three map to linkage group I (C, E, F,), two map to linkage group II (D, I), one maps to linkage group IV (G), one, which corresponds to the cloned gene, maps to either linkage group III or VI (B), and two map to one of linkage groups III, VI or VIII (A, H). Six tRNA^Val(GUA) genes from the NC4 isolate were mapped; one to linkage group I (D), two to linkage group III, VI or VII (B, C) and three to linkage group VII or III (A, E, F).     

In vitro construction of bacteriophage λ and plasmid DNA molecules containing DNA fragments from bacteriophage T4

Restriction endonucleases EcoRI and HindIII generated fragments of T4 cytosine-containing DNA were inserted into bacteriophage vector λgtSu_III and plasmid vectors pMB9 and pBR313. Resulting clones were screened for hybridization with ³²P labeled T4 tRNA. Recombinant bacteriophages and plasmids were isolated which contained a T4 fragment coding for T4 RNA species 1 and 2 and T4 tRNA^Arg. Selected λ-T4 hybrid bacteriophages were grown to high titer and their DNA analyzed by gel electrophoresis.