The Kinetics of the Synthesis of Ribosomal RNA in E. coli

The kinetics of the synthesis of ribosomal RNA in E. coli has been studied using C¹⁴-uracil as tracer. Two fractions of RNA having sedimentation constants between 4 and 8S have kinetic behavior consistent with roles of precursors. The first consists of a very small proportion of the RNA found in the 100,000 g supernatant after ribosomes have been removed. It has been separated from the soluble RNA present in much larger quantities by chromatography on DEAE-cellulose columns. The size and magnitude of flow through this fraction are consistent with it being precursor to a large part of the ribosomal RNA.

A fraction of ribosomal RNA of similar size is also found in the ribosomes. This fraction is 5 to 10 per cent of the total ribosomal RNA and a much higher proportion of the RNA of the 20S and 30S ribosomes present in the cell extract. The rate of incorporation of label into this fraction and into the main fractions of ribosomal RNA of 18S and 28S suggests that the small molecules are the precursors of the large molecules. Measurements of the rate of labeling of the 20, 30, and 50S ribosomes made at corresponding times indicate that ribosome synthesis occurs by concurrent conversion of small to large molecules of RNA and small to large ribosomes.

     

Identification of extracellular miRNA in human cerebrospinal fluid by next-generation sequencing

There has been a growing interest in using next-generation sequencing (NGS) to profile extracellular small RNAs from the blood and cerebrospinal fluid (CSF) of patients with neurological diseases, CNS tumors, or traumatic brain injury for biomarker discovery. Small sample volumes and samples with low RNA abundance create challenges for downstream small RNA sequencing assays. Plasma, serum, and CSF contain low amounts of total RNA, of which small RNAs make up a fraction. The purpose of this study was to maximize RNA isolation from RNA-limited samples and apply these methods to profile the miRNA in human CSF by small RNA deep sequencing. We systematically tested RNA isolation efficiency using ten commercially available kits and compared their performance on human plasma samples. We used RiboGreen to quantify total RNA yield and custom TaqMan assays to determine the efficiency of small RNA isolation for each of the kits. We significantly increased the recovery of small RNA by repeating the aqueous extraction during the phenol-chloroform purification in the top performing kits. We subsequently used the methods with the highest small RNA yield to purify RNA from CSF and serum samples from the same individual. We then prepared small RNA sequencing libraries using Illumina’s TruSeq sample preparation kit and sequenced the samples on the HiSeq 2000. Not surprisingly, we found that the miRNA expression profile of CSF is substantially different from that of serum. To our knowledge, this is the first time that the small RNA fraction from CSF has been profiled using next-generation sequencing.     

Glucocorticoid prevents brain-derived neurotrophic factor-mediated maturation of synaptic function in developing hippocampal neurons through reduction in the activity of mitogen-activated protein kinase

An increased level of glucocorticoid may be related to the pathophysiology of depressive disorder. The involvement of brain-derived neurotrophic factor (BDNF) in the antidepressive effect has also been suggested; however, the possible influence of glucocorticoid on the action of BDNF in the developing central nervous system has not been elucidated. In this study, we investigated the effect of glucocorticoid (dexamethasone, DEX) on synaptic maturation and function enhanced by BDNF in early developing hippocampal neurons. In the immature stage, BDNF increased the outgrowth of dendrites and the expression of synaptic proteins including glutamate receptors and presynaptic proteins. Pretreatment with DEX significantly inhibited the BDNF-dependent up-regulation of both dendritic outgrowth and synaptic proteins. In the more mature stage, the BDNF-reinforced postsynaptic Ca(2+) influx was decreased by DEX. BDNF-enhanced presynaptic glutamate release was also suppressed. RU486, a glucocorticoid receptor antagonist, canceled the DEX-dependent blocking effect on the action of BDNF. After down-regulation of glucocorticoid receptor by small interfering RNA application, no inhibitory effect of DEX on the BDNF-increased synaptic proteins was observed. Interestingly, the BDNF-activated MAPK/ERK pathway, which is an essential intracellular signaling pathway for the BDNF-increased synaptic proteins, was reduced by DEX. These results suggest that BDNF-mediated synaptic maturation is disturbed after neurons are exposed to high-level glucocorticoid in their development stage.     

Identification of a macromolecular inhibitor of glucocorticoid-receptor complex activation in rat liver cytosol

We have identified an endogenous regulator of the glucocorticoid receptor following fractionation of dialyzed rat liver cytosol on DEAE-cellulose. The macromolecular regulator, purified approximately 20-fold as judged by Lowry-reactive material, inhibits activation of glucocorticoid-receptor complexes when assayed by DNA-cellulose binding and by chromatography on DEAE-cellulose minicolumns. In addition the active DEAE-cellulose fraction stabilizes the unoccupied glucocorticoid receptor against heat inactivation. Evidence is presented that the observed inhibition of activation by the active DEAE-cellulose fraction is not due to concentration of cytosolic proteases or RNA. The inhibitory molecule in the active fraction is not stable to heating at 90 degrees C (15 min) and is partially inactivated at 45 degrees C (15-60 min).     

Prolactin-induced accumulation of casein mRNA in mouse mammary explants: A selective role of glucocorticoid

The role of glucocorticoid in the prolactin-induced accumulation of casein mRNA in mammary explants from midpregnant mice has been studied after an initial 4-day incubation to allow the level of messenger to decline to undetectable levels. Subsequent culture for 3 days: 1) with insulin and glucocorticoid did not result in detectable accumulation of messenger; 2) with insulin and prolactin resulted in a very small accumulation; 3) with insulin, glucocorticoid and prolactin elicited a 20-fold greater accumulation of casein mRNA than the system with only insulin and prolactin. Therefore, although glucocorticoids are not an absolute requirement for casein gene expression in mouse mammary tissue, they are necessary for massive accumulation of casein mRNA induced by prolactin. It appears that this dependence is not a result of either mRNA stabilization or alteration in prolactin receptors. By contrast, stimulation of total epithelial RNA synthesis by prolactin does not have this glucocorticoid dependency.     

An increase of the regulating factor for chromatin-dependent RNA polymerase II reactions in the tightly-bound chromatin fraction by glucocorticoid injection

A sugar-containing factor for chromatin-dependent RNA polymerase II reactions exists in rat liver nuclei (1). In this communication the localization of this factor in cell nuclei was investigated. The major activity of the factor was observed in the nuclear soluble fraction whereas a minor activity was detected in the tightly-bound chromatin fraction, but not in the loosely bound chromatin fraction. The factor in the tightly-bound chromatin fraction was considerably increased by glucocorticoid injection, but not in other fractions.     

Influence of Synchronized Sleep on the Biosynthesis of RNA in Two Nuclear Classes Isolated from Rabbit Cerebral Cortex

The biosynthesis of RNA during sleep has been studied in two purified nuclear fractions, separated from rabbit cerebral cortex after subarachnoidal injection of radioactive orotate. The biochemical parameters have been referred to the percent EEG synchronization recorded during the period of incorporation (1 hr). The content of radioactive RNA per nucleus increases significantly with percent synchronization in the fraction of large nuclei (of neuronal and astroglial origin). While sedimentation and electrophoretic analyses of this RNA are consistent with the hypothesis of an enhanced turnover of rRNA during wakefulness, the accumulation of labelled RNA which is observed during sleep may be due to a modified turnover of nuclear heterogeneous RNA. On the other hand, in the fraction of small nuclei (mostly of oligodendroglial origin) the content of radioactive RNA per nucleus and the pattern of sedimentation of labelled RNA show no dependence on the electrical state of the cortex. These data indicate that in the cerebral cortex the sleep-wakefulness transition is accompanied by a different cellular response in RNA turnover.     

Identification of mRNA in the slime mold Physarum polycephalum.

Using a differential extraction procedure which had previously been shown to yield one nucleic acid fraction enriched in cytoplasmic RNA and another enriched in nuclear RNA, we have been able to isolate two polyadenylated RNA populations from microplasmodia of Physarum polycephalum. The poly(A)-containing RNA from the cytoplasmic-enriched fraction accounts for approximately 1.2% of the cytoplasmic nucleic acid, has a number-average nucleotide size of 1339+/- 39 nucleotides, and has been shown, in a protein-synthesizing system in vitro, to be capable of directing the synthesis of peptides which have also been shown to be synthesized in vivo by microplasmodia. The poly(A)-containing RNA from the nuclear-enriched fraction has a number-average nucleotide size of 1533 +/- 104 nucleotides and represents a mixture of cytoplasmic and nuclear adenylated RNA molecules. Based upon these observations, we have identified the polyadenylated RNA isolated from the fraction enriched in cytoplasmic nuclei acid as Physarum poly(A)-containing messenger RNA.     

Translation of tyrosine aminotransferase mRNA in a modified reticulocyte system.

Tyrosine aminotransferase messenger RNA has been translated in a cell-free system derived from rabbit reticulocytes. Cytoplasmic poly(A)-containing RNA from rat liver was used as the source of the messenger RNA. The newly synthesized subunits of the enzyme were isolated by immunoprecipitation and identified and quantitated using polyacrylamide gel electrophoresis. These procedures were used to demonstrate that glucocorticoid induction is associated with increased cytoplasmic levels of functional tyrosine aminotransferase messenger RNA.     

Glucocorticoids induce focus formation and increase sarcoma viral expression in a mink cell line that contains a murine sarcoma viral genome.

Dexamethasone (3 X 10(-10) to 3 X 10(-6) M) induced foci of morphologically transformed cells in a small proportion of a mink cell line that contains the Moloney murine sarcoma viral genome (S+L-). The induction was glucocorticoid specific, since other steroids with glucocorticoid activity (prednisolone, cortisol, and aldosterone) induced foci with an efficiency that paralleled their glucocorticoid activity, and steroids lacking glucocorticoid activity (17B-estradiol, testosterone, and progesterone) failed to induce foci. Viral antigen, as measured by specific immunofluorescence, was localized to the foci. The induction of foci by dexamethasone (3 X 10(-7)) was accompanied by an approximately 10-fold increase in intracellular Moloney murine sarcoma virus-specific RNA and viral p30 antigen. Removal of dexamethasone was followed by the disappearance of foci and a decrease in viral RNA and p30. In this cell system, therefore, glucocorticoids can affect the intracellular levels of type C viral RNA and protein.     

The search for the DNA of the chick embryo fibroblast cytosolic complex

1. Conventional DNA extraction procedures have failed to release free DNA from the chick embryo fibroblast cytosolic DNA-RNA complexes. 2. Free DNA has been released only from the smallest cell cytosol DNA fraction, which is not in the native state associated with RNA: it is very small (of the order of 100 bases) and single stranded. 3. However, phenol extraction does separate complex DNA-associated material from the RNA which has invariably been found to accompany it in all but the smallest fraction (see 2 above). 4. The principal factor preventing DNA release appears to be a massive aggregation of partially purified DNA-associated material.     

Nucleotide sequence of small chromatin-associated RNA (fr3 RNA)

A small RNA found in the fraction on non-histone chromosomal proteins or rat liver and chicken reticulocytes [Holoubek, V., Deacon, N.J., Buckle, D.W. and Naora, H. (1983) Eur. J. Biochem. 137, 249-256] has been isolated from rat liver and then sequenced. The RNA is 30 nucleotides long and has the following composition: 5'AGUGGGGGACUGCGUUCGCGCUCUCCCCUG3'. This sequence is identical with the sequence of the last 30 nucleotides at the 3' end of small nuclear U1 RNA.     

A possible role for sperm RNA in early embryo development

Recently it has been demonstrated that, along with sperm, some of its RNA can be introduced into the oocyte during fertilization, which stays stable until the activation of the embryonic genome. Originally it was thought that RNA present in semen relates to contamination from somatic cells and/or immature sperm both containing substantially higher amounts of RNA than the fertilizing sperm. However, RNA is still found after stringent washing through density gradients resulting in a sperm fraction that is translational silenced and devoid of cytosolic rRNA and thus of potential RNA contamination-which is not transferable to the oocyte. Sperm only delivers a relatively small amount of paternal RNA (5-10 fg) into the fertilized oocyte when compared to the amount of maternal RNA (approximately 1 ng). Pooled human sperm contains about 5000 different mRNA sequences of which half are common between ejaculates. Besides mRNA sperm also contains small sperm RNA molecules that might interfere in gene expression (iRNA). In human sperm already more than 68 putative iRNAs have been identified and 15 of them may specifically inhibit genes that are only active during early embryonic development. The composition and quantity of sperm RNA is considered to be a valuable diagnostic tool for male fertility. However, only a subpopulation of the purified mature sperm fraction (with a yet unknown composition and quantity of RNA) will appropriately respond to capacitation media to become competent to fertilize the oocyte. In this review the origin and function of sperm borne RNA transferred into the oocyte is discussed along with their putative role in early embryogenesis, which still needs to be experimentally proven.